ID: 1014599620

View in Genome Browser
Species Human (GRCh38)
Location 6:123394135-123394157
Sequence TGCCACTGCAGTTTAGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 189}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014599620_1014599627 3 Left 1014599620 6:123394135-123394157 CCCTTCCCTAAACTGCAGTGGCA 0: 1
1: 0
2: 2
3: 17
4: 189
Right 1014599627 6:123394161-123394183 ATCACTATTAGTGTGGCCCTGGG 0: 1
1: 0
2: 1
3: 5
4: 91
1014599620_1014599624 -4 Left 1014599620 6:123394135-123394157 CCCTTCCCTAAACTGCAGTGGCA 0: 1
1: 0
2: 2
3: 17
4: 189
Right 1014599624 6:123394154-123394176 GGCACCAATCACTATTAGTGTGG No data
1014599620_1014599626 2 Left 1014599620 6:123394135-123394157 CCCTTCCCTAAACTGCAGTGGCA 0: 1
1: 0
2: 2
3: 17
4: 189
Right 1014599626 6:123394160-123394182 AATCACTATTAGTGTGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014599620 Original CRISPR TGCCACTGCAGTTTAGGGAA GGG (reversed) Intronic
901144024 1:7053194-7053216 TGCCACCGCAGGAGAGGGAAGGG - Intronic
903349548 1:22709999-22710021 TCCCAGTGCAGTTTGGGGATGGG - Intergenic
904681784 1:32234477-32234499 TGTCATTGGAGTTTGGGGAAGGG - Intergenic
905695039 1:39967793-39967815 TGGCACTGCTGACTAGGGAAGGG - Exonic
907900514 1:58736944-58736966 TGACACTGCAGTGTGGTGAAAGG - Intergenic
910918742 1:92320104-92320126 TGACTCTGGAATTTAGGGAAGGG + Intronic
917012669 1:170491608-170491630 TGCCACTGCAGTTTAGCCTGGGG + Intergenic
917438059 1:175041026-175041048 TGCCACTGTGGTTTTGGGAGAGG - Intergenic
918038466 1:180897554-180897576 TGTCACAGCATATTAGGGAAGGG - Intergenic
918439716 1:184555074-184555096 TGCCACTCCAGTGAAGGCAAAGG - Intronic
922000880 1:221477116-221477138 TTCCAATGCAGTTATGGGAAGGG - Intergenic
923740603 1:236651477-236651499 TAAAACTGCAGTTTAGGTAAGGG - Intergenic
924758224 1:246961457-246961479 TGGCCCTGCAGTTTATGGAATGG - Intronic
1066153835 10:32653423-32653445 TGCCACTTCGGTTTGGGGGAGGG + Intronic
1070322068 10:75362018-75362040 AGCCACTGCAGCCTTGGGAAGGG - Intergenic
1070388391 10:75947510-75947532 TGCCACTGCAGTAGAAGGGAAGG + Intronic
1070585818 10:77765219-77765241 TGCCACTGCAGTCTAGTCTAGGG + Intergenic
1073300272 10:102466954-102466976 GGCCTCTCCATTTTAGGGAAGGG + Intronic
1074859802 10:117501660-117501682 TGGTTCTGGAGTTTAGGGAACGG + Intergenic
1076250803 10:128982560-128982582 TGCAATTGCAGTTTAGCAAAAGG - Intergenic
1077382468 11:2250569-2250591 TGCTGCTGCAGTTTAAGGATGGG - Intergenic
1077923540 11:6658806-6658828 TGCCACTGAAGCCCAGGGAATGG + Intergenic
1083390758 11:62348341-62348363 TTCAAAAGCAGTTTAGGGAAAGG + Intronic
1084903838 11:72330700-72330722 TGGCCCTGCCCTTTAGGGAAGGG + Intronic
1085874404 11:80388457-80388479 TCCCACTGGGGTTTAGGGGAGGG + Intergenic
1086123998 11:83331167-83331189 TGGCACTGAAATTCAGGGAAGGG - Intergenic
1087825626 11:102761898-102761920 TTCCACTGCAATTCAGAGAATGG - Intergenic
1088690263 11:112320741-112320763 TGCCACTGTGGTTCAGGGAAAGG + Intergenic
1088793290 11:113245571-113245593 GGCCAGTGCAGACTAGGGAATGG - Intronic
1094413827 12:30197103-30197125 TGCCACAGCAGTATGGGCAATGG - Intergenic
1095628957 12:44351893-44351915 TGCCAATGCTGTGTAGAGAATGG - Intronic
1095662056 12:44747798-44747820 TGCCTCTGAATTTTAGGGAGAGG - Intronic
1097010754 12:55952089-55952111 TTCAACAGCAGGTTAGGGAAAGG + Exonic
1098299211 12:69036982-69037004 TGCCCCTGCAGTTTAGTTAAAGG - Intergenic
1098898302 12:76086781-76086803 TGCCATTAAAGTTCAGGGAAGGG + Intergenic
1100273631 12:93049815-93049837 TGCCCCTGCAGGTTAGGGTTTGG - Intergenic
1103334058 12:120176013-120176035 TGCCAATGTAGTTTAGGTTAGGG + Intronic
1104125784 12:125844458-125844480 GGCCACTGCAGTTTAGAGTCAGG + Intergenic
1106607412 13:31241787-31241809 TGTCACTGGATATTAGGGAATGG + Intronic
1109727649 13:66364682-66364704 TCCCACTGTAGATTAAGGAAGGG + Intronic
1113081505 13:106525306-106525328 TGCCACTGTAGTTTAGTTAAGGG - Intronic
1115732036 14:36280950-36280972 TAACAATGCAATTTAGGGAATGG + Intergenic
1116793734 14:49367071-49367093 GGCTACAGCAGTATAGGGAAGGG - Intergenic
1117406547 14:55409693-55409715 TGGCACAGCAGATTAGGTAAGGG + Intronic
1118343439 14:64915407-64915429 TGCTATTCAAGTTTAGGGAAAGG + Intronic
1118375147 14:65170485-65170507 TGGCTCTGGAGTTTTGGGAATGG - Intergenic
1118780316 14:69003565-69003587 AGCCACTGCAGGTCAGGGAGAGG - Intergenic
1119818616 14:77594043-77594065 TGCCTCTGCAGTTTATGGAGAGG - Intronic
1119824485 14:77645747-77645769 TGGCACTGCGGGTTAGGGAAGGG + Intergenic
1119832080 14:77712307-77712329 TGCAACTCCAGCTTAGGCAAGGG - Intronic
1122466656 14:101938344-101938366 TGTCACTGCAGACTAGGGAAGGG - Intergenic
1122577358 14:102750768-102750790 GGCCACTGCAGGTTGGGGGATGG + Intergenic
1123994659 15:25710105-25710127 TCACACTGCATTTTAGGCAACGG + Intronic
1128231544 15:66038957-66038979 TGCCAGTGCAGTCTAGGGAATGG + Intronic
1128355063 15:66920612-66920634 AGCCATTGCAGTTTGGGGACTGG - Intergenic
1130005591 15:80093852-80093874 TTCCAGTGTAGTTTCGGGAAGGG + Intronic
1131251544 15:90834024-90834046 TGCCCCTGCAGTTCAGAGAAAGG - Intergenic
1131366980 15:91850024-91850046 GGGCACTGCAGTTCATGGAAGGG + Intergenic
1134199464 16:12185824-12185846 TGCCTCTGCATTGTAGGAAAGGG + Intronic
1137402544 16:48165145-48165167 TCCCACAGCAGTTCTGGGAATGG + Intergenic
1138932851 16:61682445-61682467 ATCCACAGCAGTCTAGGGAATGG + Intronic
1140213270 16:72987450-72987472 TGCCACCTCAGTTTAGGTAGAGG + Intronic
1143186142 17:5011621-5011643 TGACACTGCAGTGTAGGGAGGGG + Intronic
1144538991 17:16120445-16120467 AGAAAATGCAGTTTAGGGAATGG - Intronic
1145868288 17:28254685-28254707 TGTCACTGAAGTTTATGGGATGG + Intergenic
1146489139 17:33267661-33267683 GGCAACTGGAGTTCAGGGAAAGG + Intronic
1146645813 17:34576957-34576979 TGCCACTGGAGCTTAGATAAGGG - Exonic
1149507178 17:57204134-57204156 CTCCAGTGCAGGTTAGGGAAAGG - Intergenic
1149654713 17:58304218-58304240 TCCCACTGTAGTCCAGGGAATGG - Intronic
1151133516 17:71922993-71923015 TGACACTGCAATTTAGACAAGGG - Intergenic
1152502859 17:80724750-80724772 TGACACTGCAGAGGAGGGAACGG - Intronic
1203171482 17_GL000205v2_random:152011-152033 TGCCACTGCACTTTGGCGACAGG - Intergenic
1203174257 17_GL000205v2_random:180766-180788 TGCCACTGCACTTTGGCGACAGG + Intergenic
1154167801 18:12029003-12029025 TGCCGCTGCATTTCAGGGACAGG - Intronic
1155790131 18:29956806-29956828 TGCCATTTATGTTTAGGGAAGGG + Intergenic
1157806339 18:50660632-50660654 TGCCACAGGAGTTTAGAAAAGGG + Intronic
1159651628 18:70985450-70985472 TGGTACTGCAGTTTGGGGCACGG + Intergenic
1162964385 19:14149116-14149138 TGCCCCTAGAGTTGAGGGAAGGG + Exonic
1164474469 19:28564551-28564573 TGCCACTGCAGAGTGTGGAAGGG - Intergenic
1164500943 19:28819688-28819710 TGCCAGTGCAGGTGAGGGCATGG + Intergenic
1165087811 19:33363575-33363597 TGAGACTGGAGTTTGGGGAATGG + Intergenic
1165446193 19:35857954-35857976 AGCCACTGCACTTCAGGCAATGG + Intronic
1165647456 19:37454517-37454539 AGCTATTGCAGTTTAGGAAAGGG - Intronic
1167121352 19:47519116-47519138 GAACACTGCAGTTAAGGGAAAGG - Intergenic
1167201682 19:48069636-48069658 TGCCCCTGCTGTTCAGAGAAAGG - Intronic
925051502 2:819254-819276 GGCCACTGCAGATTAGGGTGCGG - Intergenic
925464931 2:4098645-4098667 TGCCACTGAAATTAAGGGGAAGG + Intergenic
925618528 2:5767490-5767512 AGCCATTGCAATGTAGGGAAAGG - Intergenic
925858239 2:8150956-8150978 AGCCACTGAAGTTTAGGCAAAGG + Intergenic
926466003 2:13189321-13189343 TGGCACTCCAGTTTGGGCAATGG - Intergenic
926510645 2:13773601-13773623 CGCCACTTCAGTCAAGGGAAAGG + Intergenic
927430259 2:23021372-23021394 TACCAATGCAGGTTAGGGAAGGG - Intergenic
928902937 2:36341015-36341037 TGCCACTGCACTCTAGGTCAAGG - Intergenic
932618205 2:73249544-73249566 TGCCACCCTAGTTTAGGGGAGGG + Intronic
933507482 2:83197073-83197095 TGCAACTGCAGGTAGGGGAAAGG - Intergenic
933861320 2:86472096-86472118 TGCAAAGGCATTTTAGGGAAGGG + Intronic
934939271 2:98488768-98488790 TGAGACTGAAGTTCAGGGAAAGG + Intronic
935078910 2:99772800-99772822 GGCGACTGCAGCTAAGGGAAAGG + Intronic
935762777 2:106336839-106336861 TGCAACAGCCCTTTAGGGAAAGG - Intergenic
936260053 2:110951098-110951120 AGCCACTTCTGGTTAGGGAATGG + Intronic
936516037 2:113182309-113182331 AGCAAGTGCAGGTTAGGGAAGGG - Intronic
940164429 2:150753733-150753755 TGCCACTGGACTTAAGGGGAGGG - Intergenic
940766060 2:157790731-157790753 TCCTCCTGCAGTTTAGGGACAGG - Intronic
942553670 2:177148707-177148729 TGACACTGCAATGTACGGAAGGG - Intergenic
942932961 2:181518180-181518202 TACCACAACATTTTAGGGAATGG - Intronic
943052233 2:182928642-182928664 GGAAACTGCAGTTTAGGAAAAGG + Intronic
943765034 2:191651408-191651430 TATGACTGCAGTTTGGGGAATGG + Intergenic
943991485 2:194698841-194698863 TGCCATTGAAGTTCAGAGAAGGG - Intergenic
945103813 2:206289277-206289299 TGCCACTTCAGCTTAGGTATTGG + Intronic
945332480 2:208556074-208556096 TGCCACACCAGCTTAAGGAATGG + Intronic
945689743 2:213018720-213018742 TGTAACTGCAGTTTAAGGAGTGG - Intronic
1169790201 20:9402140-9402162 GCCCCCTGTAGTTTAGGGAAAGG + Intronic
1172428134 20:34869991-34870013 TGGCACTTGGGTTTAGGGAATGG + Intronic
1173349252 20:42230055-42230077 AGCAACTGCAGTTCAGAGAAAGG + Intronic
1174498082 20:50963583-50963605 TGCCTCTGCAGTTTCTTGAACGG - Exonic
1175712745 20:61234073-61234095 TGTTACTGCTGTTTAAGGAAAGG - Intergenic
1176060080 20:63168698-63168720 TACCACTGCAGCTTTGCGAATGG + Intergenic
1176327459 21:5513842-5513864 TGCCACTGCACTTTGGCGACAGG - Intergenic
1176400298 21:6307109-6307131 TGCCACTGCACTTTGGCGACAGG + Intergenic
1176436859 21:6681995-6682017 TGCCACTGCACTTTGGCGACAGG - Intergenic
1176461121 21:7009065-7009087 TGCCACTGCACTTTGGCGACAGG - Intergenic
1176484682 21:7390843-7390865 TGCCACTGCACTTTGGCGACAGG - Intergenic
1177447064 21:21211469-21211491 TGCAACTGCGGTTTATGGTAAGG - Intronic
1179610097 21:42544745-42544767 TGTCACTGCAGTTCTGAGAAAGG + Intronic
1180260143 21:46662925-46662947 AGCCTCTGCAGCTTAGGCAAGGG + Intronic
1182636571 22:31732355-31732377 AGACACTCCTGTTTAGGGAATGG - Intronic
950520262 3:13493905-13493927 TGCCACTGCAGTTTTGCAGAAGG + Intronic
951144355 3:19209189-19209211 TGCCAAAGCAGTTAAGGGATGGG - Intronic
953787559 3:45922416-45922438 TGCCACTGCAGAGTAGGAAATGG + Intronic
953845113 3:46420655-46420677 AGCCACTGCCATTTAAGGAAGGG - Intergenic
954870228 3:53762141-53762163 TGCCACTGCAGGGCAGGGAGCGG - Intronic
959959282 3:112278152-112278174 TTCTAATGCAGTTTAGGTAATGG + Intronic
962193514 3:133336281-133336303 TGCAACTGGGGTTTGGGGAAGGG - Intronic
962281327 3:134054056-134054078 TGCCACAGAAGTTTAGGAATAGG + Intergenic
964892470 3:161553517-161553539 TTCCACTGGAATTTAAGGAAAGG + Intergenic
965275734 3:166679421-166679443 TGTGAATGCATTTTAGGGAATGG - Intergenic
966532352 3:180994930-180994952 CGCCACTGAATTTTAGGCAAAGG - Intergenic
967370850 3:188744406-188744428 TGGCAGTGCAGTTGCGGGAAGGG - Intronic
967425601 3:189323713-189323735 TACCACTACAGTTTAGCAAATGG + Exonic
968718078 4:2176884-2176906 TGGCACTCCAGGTTAGGGGAAGG - Intronic
971565310 4:28131842-28131864 TGGCACTCTAGTGTAGGGAAGGG - Intergenic
971877747 4:32326662-32326684 TGCAACTGCTGTTTAGTGAATGG - Intergenic
976098810 4:81538428-81538450 TACCACTCCATTATAGGGAAAGG - Intronic
983096081 4:163563532-163563554 TGCCACTGTAGTTCAGGGTAGGG - Intronic
984432752 4:179668949-179668971 TGCCACTGCAGCTTGGATAAAGG + Intergenic
986002851 5:3643570-3643592 TGCCACTGGAGTAGAGGGAGGGG - Intergenic
986485398 5:8231074-8231096 TTCCAAGGCAGTTTAGGGAAGGG + Intergenic
988362073 5:30249271-30249293 TGCCACTGCATATTTAGGAAAGG + Intergenic
992242262 5:74784466-74784488 TGCCACTGCAGTCCAGCCAAGGG + Intronic
996600363 5:125255345-125255367 AGCCACTGGAATTGAGGGAATGG - Intergenic
997442152 5:133916431-133916453 AGTCACTGCAGTTTAGAGCAAGG + Intergenic
997700797 5:135897708-135897730 TTCCACTGCACTATGGGGAAGGG + Intergenic
997826584 5:137112040-137112062 TGCCAGTGCAGTGGAAGGAAGGG - Intronic
998163400 5:139826369-139826391 TGCCACTGCAGGAGAGAGAAGGG + Intronic
998896452 5:146805256-146805278 TGCTTCTGCGGTCTAGGGAAAGG - Intronic
1000937268 5:167317751-167317773 AGCAAATGCACTTTAGGGAAAGG - Intronic
1002625424 5:180524341-180524363 TAGCACTGCAGATTAGGTAAAGG - Intronic
1003245547 6:4379019-4379041 TTCCACTTCAGTTATGGGAATGG - Intergenic
1003997414 6:11556759-11556781 TAGAACTCCAGTTTAGGGAAGGG - Intronic
1006671570 6:35732518-35732540 TTTCACTGGAGTTTAGGGTAGGG + Intergenic
1006806008 6:36789674-36789696 TGCCACTGGAGTTCAGACAAGGG - Intronic
1008408112 6:51141809-51141831 TGACACTGCAGTTCAGATAAAGG + Intergenic
1009767338 6:68097462-68097484 TGCCACTGCACTTTAGGCCCTGG - Intergenic
1011010150 6:82694798-82694820 TGGAAATGCAGGTTAGGGAATGG + Intergenic
1013138029 6:107301198-107301220 TGCCACTGCTTTTCAAGGAAAGG - Intronic
1013644188 6:112119492-112119514 TGGCAATGCAGTTTTTGGAATGG + Intronic
1013839477 6:114373208-114373230 TACCACTGCAATTCAGTGAAGGG - Intergenic
1014599620 6:123394135-123394157 TGCCACTGCAGTTTAGGGAAGGG - Intronic
1017373764 6:153743014-153743036 TGTCACTGCAATTTAAGAAATGG + Intergenic
1020095865 7:5368957-5368979 TGCCTCTGGGGTGTAGGGAAGGG - Intronic
1022868194 7:34445131-34445153 TGGCTCTGGAGTGTAGGGAATGG + Intergenic
1028411920 7:90539274-90539296 GCCCACTGCAGTGAAGGGAAGGG - Intronic
1028540550 7:91938555-91938577 TGCCACTGCACTCTAGAGTAAGG - Intergenic
1029149539 7:98470342-98470364 GGCCAAGGCAGTTTAGGGGAGGG + Intergenic
1029679444 7:102098085-102098107 TGCCTCTGGATTTTAGGTAAAGG - Intronic
1032515372 7:132502737-132502759 ATCCTCTGCAGTTGAGGGAATGG - Intronic
1034984861 7:155504178-155504200 TGCCACTGCAGTTTATATACTGG - Intronic
1035154249 7:156899280-156899302 TGCCCCTCAAGTTTCGGGAATGG + Intergenic
1037014574 8:13886523-13886545 TGCCACTGCTTTTGGGGGAAGGG - Intergenic
1037285675 8:17296458-17296480 GGCCAGTGCAGTATAAGGAAAGG - Exonic
1038142553 8:24862481-24862503 TGCCACTGAAGCTTCGAGAACGG - Intergenic
1038688727 8:29742220-29742242 TCCCACTGCCCTTTAGGGATGGG - Intergenic
1039372284 8:36997578-36997600 TGCCACTGCATTTAAGTGACAGG + Intergenic
1040886150 8:52266132-52266154 TGCAAGAGCAGTTTTGGGAATGG + Intronic
1041248995 8:55916740-55916762 TGCCATTGCAGTATTGGGCATGG - Intronic
1042658489 8:71127824-71127846 TGACAATGCAGTTTAGAGCATGG - Intergenic
1042700088 8:71602686-71602708 TGGCCCTGGAATTTAGGGAAGGG + Intergenic
1043245015 8:77987794-77987816 GACCTCTGCAGTTTAGAGAAGGG + Intergenic
1043796834 8:84553201-84553223 TGCCACTGCACTCCAGGGACTGG - Intronic
1046582689 8:116112532-116112554 TTCCACTGTAGTTTGGGAAAGGG - Intergenic
1047878076 8:129162499-129162521 TGCTGCTGCAGTTTACAGAATGG + Intergenic
1050017526 9:1250581-1250603 TGCAACTGCCATTTCGGGAAAGG - Intergenic
1051283340 9:15466541-15466563 TGCCACTGAATTCAAGGGAATGG - Intronic
1051344119 9:16137202-16137224 AGCCACTGCTGTTCAGGGCAGGG - Intergenic
1052871765 9:33514485-33514507 TGCCAATGCAATGCAGGGAAGGG - Intergenic
1058211740 9:102177636-102177658 TGCCACTTCAGTTTAGGGACAGG + Intergenic
1059701789 9:116782089-116782111 GGCAACTACAGTTTGGGGAAGGG + Intronic
1061518521 9:131103602-131103624 TGCCACTGCACTTTAGGCTTGGG + Intronic
1203434652 Un_GL000195v1:126666-126688 TGCCACTGCACTTTGGCGACAGG + Intergenic
1188184962 X:27102533-27102555 TGACACTAGAGTTCAGGGAAAGG - Intergenic
1188545535 X:31301682-31301704 TACCACTGCATTTTAGGGGAAGG + Intronic
1189440757 X:41033679-41033701 TGCCACTGCAGAAAAGGGAGGGG + Intergenic
1192203142 X:69079697-69079719 TACCTCTTCAGTTGAGGGAAGGG + Intergenic
1193894767 X:87099753-87099775 AGCCACTGAAGGATAGGGAAGGG - Intergenic
1195863129 X:109402165-109402187 TGCCACTGCAATTTGGAGAATGG + Intronic
1196070832 X:111519623-111519645 AATCACTGCTGTTTAGGGAAAGG - Intergenic
1197776651 X:130122497-130122519 TGTCACTGCACTTCAGGGCACGG + Intergenic
1201791664 Y:17848081-17848103 TCCCAGTGCAGTGTAGTGAAGGG + Intergenic
1201809890 Y:18057908-18057930 TCCCAGTGCAGTGTAGTGAAGGG - Intergenic