ID: 1014599719

View in Genome Browser
Species Human (GRCh38)
Location 6:123395593-123395615
Sequence GACGCGGGACAATGAGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014599719 Original CRISPR GACGCGGGACAATGAGGGGC AGG (reversed) Intronic
900969293 1:5980590-5980612 GAGGCGAGACAGGGAGGGGCAGG + Intronic
901199254 1:7457487-7457509 GCCCGGGGACACTGAGGGGCAGG - Intronic
903190302 1:21652268-21652290 GTCGAGGGACAGGGAGGGGCGGG - Intronic
903822093 1:26111089-26111111 GCCGGGGAACAATGAGGCGCCGG + Intergenic
904813735 1:33180852-33180874 AACGCGGGGCAGGGAGGGGCGGG - Intronic
905269425 1:36777332-36777354 GAAGTGGGACAATGATGGGCTGG + Intergenic
905790289 1:40785821-40785843 GATGCGGCACAGGGAGGGGCAGG + Intronic
906299268 1:44670344-44670366 GAAGGGGGACAGTGAGTGGCTGG - Intronic
907464359 1:54624962-54624984 GAAGGGGGACAATGAGGGAGAGG + Intronic
907884088 1:58577181-58577203 GACGCGGGCGGATGAGGCGCGGG + Exonic
912401641 1:109398050-109398072 GACGCGAGCCAATGAGGAGTGGG - Intergenic
914226206 1:145721270-145721292 GACGCGGGCCAACGCGGGGCAGG + Intronic
920116921 1:203628060-203628082 GAGGCTGGACACTGTGGGGCTGG + Intronic
920358950 1:205398771-205398793 GAAGAGGGACAGTGAGGGGAAGG + Intronic
922261293 1:223948080-223948102 TGCGCGGGGCAATGAGGGACTGG - Intergenic
1063661210 10:8036055-8036077 GAGGAAGGACAGTGAGGGGCCGG + Intergenic
1071135102 10:82444566-82444588 GAGGGGGGAAAATGAGGGGAGGG + Intronic
1084400518 11:68940353-68940375 GAGGCGCAACAAGGAGGGGCTGG - Exonic
1084636801 11:70398460-70398482 GACGCGGGAGGAGGCGGGGCAGG + Intronic
1084944925 11:72633280-72633302 GACGTGGGACAATGGGGAGGCGG - Intronic
1086895842 11:92311801-92311823 GACACTGGACAGTGAGGGACTGG - Intergenic
1088470234 11:110182246-110182268 GATGCTGCACAATGAGTGGCTGG - Intronic
1088953829 11:114598429-114598451 GTGGAGGGACAATGTGGGGCTGG - Intergenic
1094553058 12:31470840-31470862 GAAGAGGGACAATGAGAGGGTGG + Intronic
1095982355 12:47980678-47980700 GAAGCAGGTGAATGAGGGGCAGG + Intronic
1098320628 12:69239860-69239882 GACGCGGTAGAACGAGGGGCGGG - Intronic
1103447281 12:121002370-121002392 GACGCGGTACACTGAAGGCCAGG - Exonic
1106099609 13:26682836-26682858 GACCCGGGACCAGGAGGGCCTGG - Exonic
1112146433 13:96705531-96705553 GAAGAGGGACACTGAGAGGCTGG - Intronic
1120770923 14:88379817-88379839 GAGGCGGGACAAAGAGGGAGAGG + Intergenic
1121327738 14:93031272-93031294 GACGGGGGACAAAGAGGTGGGGG + Intronic
1122609118 14:102969285-102969307 GTGGCGGGGCAAGGAGGGGCAGG + Intronic
1122693563 14:103542478-103542500 CACGCGGTGGAATGAGGGGCTGG - Intergenic
1122873078 14:104650444-104650466 GACGGGGGAGGAGGAGGGGCAGG - Intergenic
1122957363 14:105076916-105076938 GGCGGGGGAGGATGAGGGGCAGG + Intergenic
1123682181 15:22770714-22770736 GATGCGGGAGCAGGAGGGGCAGG - Intergenic
1124037744 15:26071706-26071728 GAAGCAGGACAAGCAGGGGCTGG + Intergenic
1124341194 15:28890086-28890108 GACGCGGGAAAAGGAGGCACAGG - Intronic
1124940080 15:34209950-34209972 GCCGCGGTACCATGAGGCGCCGG - Exonic
1125757420 15:42072888-42072910 GAAGAGGGACGATGAGGGGGAGG - Intronic
1128511651 15:68317237-68317259 GACTGGGGACAATGTGGGGGAGG - Intronic
1129251922 15:74313954-74313976 GACACGCGGCAAGGAGGGGCTGG - Intronic
1129760510 15:78126572-78126594 GACGCAGGACATGGAGTGGCTGG - Intronic
1129799928 15:78406025-78406047 GACTTTGGACAATGAGGGGTCGG + Intergenic
1130554162 15:84911133-84911155 GACGCGGGCCAGTGGTGGGCGGG - Intronic
1132546051 16:533957-533979 GACGCGGCACAGAGAGGGCCTGG + Exonic
1137696127 16:50463333-50463355 GCCTCAGGACAATGGGGGGCAGG + Intergenic
1139028519 16:62850233-62850255 GATGAGGGACAAGGAGGGGAGGG + Intergenic
1142956715 17:3527768-3527790 GACAAGGGACACTGAGTGGCTGG + Intronic
1147375135 17:40018679-40018701 GAGGCGGGGGGATGAGGGGCCGG - Intergenic
1148808113 17:50274359-50274381 GACTCGGGGCAGGGAGGGGCTGG - Intronic
1149629434 17:58110144-58110166 GACCCGGGACAAGGAGGAGAAGG + Intergenic
1151829336 17:76540441-76540463 GTGGAGGGACAGTGAGGGGCTGG + Intronic
1151842142 17:76626341-76626363 CACCCGGGACTATGAGTGGCTGG - Exonic
1152375223 17:79915421-79915443 GAGGCAGCACAAGGAGGGGCTGG + Intergenic
1152606778 17:81295363-81295385 GACGCGAGCCAATGAGAGGCGGG + Intronic
1152635534 17:81429176-81429198 GAGGCGGGACAAGGGGGTGCAGG + Intronic
1155461727 18:26090912-26090934 GCCGCGGGAGAAGGAGAGGCTGG + Intronic
1155972275 18:32093028-32093050 GCCCCGGGACTCTGAGGGGCGGG - Intronic
1156311461 18:35926322-35926344 GGGGAGGGACAATTAGGGGCAGG - Intergenic
1159904058 18:74074866-74074888 GAGGCGGGAGAAGGAAGGGCTGG - Intronic
1160926924 19:1550902-1550924 CACGGGGGACACTGAGGGGCAGG - Intergenic
1162337631 19:10071427-10071449 GCCCAGGGACAAGGAGGGGCAGG + Intergenic
1162861153 19:13506470-13506492 GACCCCGGAGAAGGAGGGGCGGG + Intronic
1166098440 19:40556059-40556081 GAAGGGGGACATGGAGGGGCAGG - Intronic
1168056744 19:53868691-53868713 GAGGGAGGACACTGAGGGGCTGG + Intronic
925989056 2:9239022-9239044 GCCACGGGACAGAGAGGGGCTGG - Intronic
926049958 2:9738349-9738371 GACACGGGACAGTGGGGGTCAGG - Intergenic
928295968 2:30084438-30084460 GAAGCGGGAGAATGATGGGAGGG + Intergenic
928436874 2:31260481-31260503 GCAGAGGGACAATCAGGGGCTGG - Intronic
930752731 2:54948524-54948546 GAAGCCTGACCATGAGGGGCGGG - Intronic
938639919 2:133267083-133267105 GAAGCTGGAGAGTGAGGGGCGGG + Intronic
942458949 2:176156635-176156657 GGCGCGGAAGAAGGAGGGGCAGG - Intronic
946435046 2:219645906-219645928 GAGGAGGGACAAAGAGGGGGTGG + Intergenic
1171013801 20:21522615-21522637 GACTCGGGATAAAGAGCGGCCGG - Intergenic
1172457948 20:35092587-35092609 GAGGCTGGACCAGGAGGGGCGGG - Intronic
1172486907 20:35303927-35303949 GACGAGGGACTTTGATGGGCTGG - Exonic
1173660403 20:44729323-44729345 GATGCAGGACAAGGAAGGGCAGG + Intergenic
1175266987 20:57709277-57709299 GCCGCGGGACAAAGCCGGGCCGG + Intronic
1180732312 22:17991260-17991282 GTAGGGGGACAAAGAGGGGCAGG + Intronic
1181412994 22:22738016-22738038 GAGGCGGGGCAGGGAGGGGCTGG + Intronic
1181517001 22:23420262-23420284 GTAGGGGGACAAAGAGGGGCAGG + Intergenic
1183712764 22:39515407-39515429 GACGCTGGAGGATGAAGGGCTGG - Exonic
1184292048 22:43502579-43502601 GGCGTGGGGCAGTGAGGGGCTGG + Intronic
1184556313 22:45235133-45235155 GACCCAGGACAGTGAGGGGACGG + Intronic
1184723463 22:46329414-46329436 GAGGAAGGTCAATGAGGGGCTGG - Exonic
949934220 3:9104565-9104587 GACAAGGGACCAGGAGGGGCAGG - Intronic
952172169 3:30819081-30819103 GACGTGGGAGATTGAGGGGGAGG + Intronic
954668911 3:52277702-52277724 GCCGCGGGAAGCTGAGGGGCAGG + Intronic
961523895 3:127484364-127484386 AACACAGGACAATGAGGAGCCGG + Intergenic
967201306 3:187074736-187074758 GAGGTGGGAAAATGAGGAGCGGG + Intronic
968434097 4:576164-576186 GACGCGGGAGGATGAGGAGGAGG - Intergenic
968502267 4:956246-956268 GACTAGGGACTAGGAGGGGCTGG - Intronic
968832635 4:2940984-2941006 GGTGCGGGCCAATAAGGGGCAGG + Intronic
969028273 4:4191608-4191630 GAGGTGAGACAAGGAGGGGCTGG - Intronic
973867190 4:55125632-55125654 GAGGCGGGGCCATGCGGGGCGGG + Intergenic
982347150 4:154372183-154372205 AACACGGGACAATGGGGGGATGG + Intronic
984866960 4:184289079-184289101 GACTCGGGACAATCAGTGCCTGG + Intergenic
993095059 5:83471862-83471884 GATGCGGGAGGATGCGGGGCTGG - Exonic
997584175 5:135034777-135034799 GAGGCTGGAGAAGGAGGGGCAGG - Intronic
999397823 5:151241493-151241515 GAGGCTGGACAATGGGGAGCAGG - Intronic
1001245796 5:170105184-170105206 GAGGAGGGAGAATGAGGGGATGG + Intergenic
1004063489 6:12220824-12220846 GGAGCAGGACAATGAGGGGGAGG - Intergenic
1006414127 6:33893280-33893302 GACGCGGGATGATGCGGGGCCGG + Intergenic
1014599719 6:123395593-123395615 GACGCGGGACAATGAGGGGCAGG - Intronic
1016678746 6:146803723-146803745 GCCGCGGTACCATGAGGCGCCGG - Intronic
1022923216 7:35037045-35037067 GACGCGGAACTTTGAGGCGCTGG - Intronic
1026879946 7:73901812-73901834 GAGGCGGGACAGTGAGGAGGAGG - Intergenic
1028385155 7:90245523-90245545 GACGGAGGACGATGAGGCGCAGG + Exonic
1029737308 7:102472015-102472037 GACTCGGGACACTCAGGTGCTGG + Intronic
1032341940 7:131082057-131082079 GAGGTGGGAGGATGAGGGGCTGG - Intergenic
1039436615 8:37563898-37563920 CCTGCGGGACAGTGAGGGGCTGG + Intergenic
1047313176 8:123709198-123709220 AACGAGGGCCAATGAGGTGCTGG + Intronic
1060215502 9:121736304-121736326 GCCGCGGGCAAGTGAGGGGCTGG + Intronic
1061258707 9:129467479-129467501 GACACAGGAGAATGAGGGGGTGG + Intergenic
1062307962 9:135920281-135920303 GAGCAGGGACAATGGGGGGCTGG + Intergenic
1062583490 9:137238359-137238381 GAGGCGGGATAGTGTGGGGCAGG - Intergenic
1185791274 X:2929383-2929405 GACGCGGATGAAGGAGGGGCGGG - Intergenic
1186435962 X:9543451-9543473 GAGGAGGGAGAAGGAGGGGCGGG - Intronic
1187493891 X:19777725-19777747 GAAGAGGGGCAATGAGGGGTGGG + Intronic
1188758056 X:33988285-33988307 AACGAGGGGCAATGATGGGCTGG + Intergenic
1189843298 X:45105570-45105592 GAGGAGGGACAAAGAGGAGCAGG + Intronic
1190076709 X:47322333-47322355 TACAAGGGACAATGAGGGTCAGG + Intergenic
1198799349 X:140433172-140433194 GAGTCGGGAGAATGAGGGGTGGG - Intergenic
1200050346 X:153426175-153426197 GATGGGGGACAGTGAGGAGCAGG - Intergenic