ID: 1014601801

View in Genome Browser
Species Human (GRCh38)
Location 6:123422166-123422188
Sequence ATAAGAGACCTGAACATCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 579
Summary {0: 1, 1: 1, 2: 15, 3: 97, 4: 465}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014601801 Original CRISPR ATAAGAGACCTGAACATCCT TGG Intronic
900551364 1:3257838-3257860 ATAAGAAACTTGAGCATCCTTGG + Intronic
900948675 1:5845344-5845366 ATAAGAGCACTGCACATCATGGG - Intergenic
901911149 1:12459357-12459379 GTAAGGGACTTGAGCATCCTAGG + Intronic
902131733 1:14267543-14267565 ATAAAAGAATTGAGCATCCTTGG + Intergenic
902683784 1:18062417-18062439 ATGAGAGATCTGATCATGCTGGG - Intergenic
903940758 1:26929560-26929582 ATAAGGGACTTGAGCATCCTCGG + Intronic
903966966 1:27096782-27096804 ATAAGGGACTTGAGCTTCCTTGG - Intergenic
904149115 1:28422442-28422464 ATAAGGGACTTAAACATCCATGG + Intronic
905082807 1:35339613-35339635 ATAAGAGACTTGAGCATCTGTGG + Intronic
905150140 1:35920758-35920780 ATAAGAGACTTGACCATCAAGGG - Exonic
905185171 1:36191022-36191044 ATCAGAGACTTGAGCATCCAAGG - Intergenic
905673854 1:39811424-39811446 ATAAGGGACTTGATCATCCATGG - Intergenic
907096126 1:51783010-51783032 GTAAGAGACTTCAGCATCCTCGG - Intronic
907167013 1:52421679-52421701 ATCAGGGACCTGAGCATCCTTGG - Intronic
907354967 1:53864682-53864704 ATTAGGGACCTTAACATTCTTGG + Intronic
908272256 1:62433486-62433508 ATATGGGACTTGAGCATCCTCGG + Intergenic
908410041 1:63854823-63854845 ATCAGAGACTTGAGCATCCAAGG - Intronic
909001607 1:70224182-70224204 ATAAGAGACTTGAGCATCTGTGG + Intronic
909067501 1:70953265-70953287 ATAAGGGATTTGAGCATCCTGGG + Intronic
910189125 1:84576682-84576704 ATAAGGGACTTGAGCATCCATGG + Intergenic
911028012 1:93455508-93455530 ATAAGGGACTTGAGCATCCATGG + Intronic
911804151 1:102184473-102184495 ATAAGGGACTTGAGCATCCATGG + Intergenic
912325274 1:108752483-108752505 ATAAGAGATTTGAGCATCCATGG + Intronic
913050248 1:115111178-115111200 ATAAGGGACTTGAGCATCCGTGG - Intergenic
913066549 1:115261162-115261184 ATAAGAGACCTGGACTTCCCGGG + Intergenic
916177272 1:162052955-162052977 ATATGAGACCTAAACATCAAAGG - Intergenic
917112492 1:171563226-171563248 ATATGAGACTTGAGCATCCCTGG - Intronic
917309740 1:173666440-173666462 ATAAGGCACTTGAACATCCATGG - Intronic
917549754 1:176013002-176013024 AAAAGAAACATGAACATCCGTGG - Intronic
917763849 1:178196675-178196697 ATAAGAGACTTAAGCATCCTTGG + Intronic
918031000 1:180810899-180810921 ATAAGGGACTTGAGCATCCACGG - Intronic
918197229 1:182233923-182233945 ATTAGGGACCTGGAGATCCTAGG - Intergenic
918402783 1:184180466-184180488 ATAAGGGACTTGAGCATCCATGG + Intergenic
918491818 1:185089383-185089405 ATAAGGGACTTGAGCATCCAAGG + Intronic
918525653 1:185461595-185461617 CTAAGAAACTTGTACATCCTGGG - Intergenic
918783955 1:188740155-188740177 ATCAGAGACTTGAGCATCCATGG + Intergenic
918960985 1:191277498-191277520 ATAAGGGACTTGAGCATGCTTGG - Intergenic
919166300 1:193898553-193898575 ATAAAGGACCTGAGCATCCATGG - Intergenic
919319310 1:196014759-196014781 ATAAGGGATTTGAACATCCATGG + Intergenic
919800229 1:201349578-201349600 ATAAGAGCCCTCAACTTCCTGGG + Intergenic
919964095 1:202503854-202503876 ATAGGAGACCTGGACATTCCAGG + Intronic
921006097 1:211094999-211095021 AAAGGATACCTGAATATCCTCGG - Intronic
921363607 1:214353205-214353227 ATAAAAGACTTGAACATCCATGG - Exonic
922630826 1:227108661-227108683 ATATGAGACTTGAGCATCCGTGG - Intronic
923037556 1:230295081-230295103 ATAACAGACCTTAATATCTTTGG - Intergenic
923713360 1:236404578-236404600 ATAAAAGACCTGACTAGCCTGGG + Intronic
923998301 1:239521933-239521955 ATAAGGGACATGAGCATCCAAGG + Intronic
924405568 1:243742128-243742150 ATAAGGGACTTGAGCATCCTTGG + Intronic
924409481 1:243788476-243788498 ATAAGAGACTTGAATATCTGTGG - Intronic
1062995857 10:1866185-1866207 ATAAGGGACTTGAGCATCCGAGG + Intergenic
1063121845 10:3110013-3110035 ATCACAGACCTGAATGTCCTTGG - Intronic
1064572188 10:16705297-16705319 ATGAGAGACTTGAGCATCCGTGG - Intronic
1065498204 10:26351456-26351478 ATAAGGGACTTCAACATCTTCGG - Intergenic
1065633722 10:27709374-27709396 ATAAGAGACTTGAGCATCTGTGG + Intronic
1066311691 10:34203475-34203497 ATAATAGACTTGCACATCCGTGG - Intronic
1066685497 10:37977424-37977446 ACCAGAGACTTGAACATCCCTGG + Intergenic
1067364329 10:45610976-45610998 ATAAGAGACTTGAGCATCCATGG - Intergenic
1068700151 10:60010981-60011003 ATAAGGGACTTGAACATCTGTGG - Intergenic
1068721813 10:60254052-60254074 ATAAGGGACTTGAGCATCCATGG - Intronic
1069264553 10:66442255-66442277 ATAAGGAACTTGAACATCCATGG + Intronic
1069650815 10:70046799-70046821 ATAAGGGACTTGAGCATCCTTGG - Intergenic
1070271025 10:74955057-74955079 ATAAGGGACTTGAGCATCCATGG - Intronic
1070659796 10:78296734-78296756 ATAAAAGACTTGAGCATCCACGG - Intergenic
1071917146 10:90306614-90306636 ATAAGATACCTGAAATACCTGGG - Intergenic
1072172564 10:92880142-92880164 ATAAGAGATTTCAACATCCATGG - Intronic
1072666491 10:97396697-97396719 ATAAGGGACCTGAGCATCCTCGG - Intronic
1072867361 10:99078345-99078367 ATTAGAGACTTGAGCATCCATGG - Intronic
1072977501 10:100071849-100071871 ATAAGGGACTTGAGCATCCAAGG + Intronic
1073552666 10:104417579-104417601 ACAAGAGACATGACAATCCTTGG + Intronic
1074131334 10:110580200-110580222 ATAAGGGACTTGAGCATCCTTGG + Intronic
1074840009 10:117341533-117341555 ATTAGAGACTTGAGCATCCTGGG - Intronic
1075055903 10:119218158-119218180 ATAAGAGCCATGCACTTCCTTGG + Intronic
1075135407 10:119780890-119780912 ATGAGAGACTTGAGCATCCGTGG + Intronic
1075239622 10:120766112-120766134 ATCAGAGACTTGAGCATCCATGG + Intergenic
1076177755 10:128381425-128381447 ATAAGAGACTTGAGCATCTATGG - Intergenic
1077991563 11:7416711-7416733 ATAAGGGACCTGAGCATCCTTGG + Intronic
1078293943 11:10046134-10046156 ATAAAACATTTGAACATCCTCGG + Intronic
1078709849 11:13780469-13780491 ATAAGGGACTTGAGCATCCATGG - Intergenic
1079592775 11:22200981-22201003 ATAAGGGACTTGAGCATCCTTGG - Intronic
1080024773 11:27601599-27601621 ATAAAGGACTTGAGCATCCTAGG - Intergenic
1080930441 11:36804710-36804732 AGAAGAGACCAGAGAATCCTTGG + Intergenic
1082175929 11:49059354-49059376 ATAAGAGACTTGAACATCTTAGG - Intergenic
1083092750 11:60218097-60218119 ATAAGAGACCGGCACATCTGGGG - Intronic
1084362827 11:68680025-68680047 ATAAGGGACTTGAGCATCCACGG - Intergenic
1084424138 11:69075317-69075339 TTAAGAGACTTAAACATCCATGG - Intronic
1085231815 11:74978543-74978565 ATAAGGGACTTGAGCATCCTTGG - Exonic
1085951461 11:81337469-81337491 ACAAGAGAAGTAAACATCCTTGG + Intergenic
1086587500 11:88472170-88472192 ATAAGGGACTTGAACATCTGTGG - Intergenic
1086689819 11:89776717-89776739 ATAAGAGACTTGAACATCTTAGG + Intergenic
1086698852 11:89876260-89876282 ATAAGAGACTTGAACATCTTAGG - Intergenic
1086707319 11:89968239-89968261 ATAAGAGACTTGAACATCTTAGG + Intergenic
1086716036 11:90063239-90063261 ATAAGAGACTTGAACATCTTAGG - Intergenic
1087244183 11:95814880-95814902 ATAGGAGACTTGAGCATCCATGG - Intronic
1087778538 11:102278871-102278893 ATCAGGGACTTGAGCATCCTTGG + Intergenic
1088808281 11:113371215-113371237 ATAGGGGACCTGAGCATCCCAGG - Intronic
1088858142 11:113774625-113774647 GTAAGAGACTTGAGCATCCACGG - Intergenic
1089420297 11:118327614-118327636 ATAAGAGACCTGAGCATCCATGG + Intergenic
1089421437 11:118333958-118333980 ATAAGGGACTTGAGCATCCATGG - Intergenic
1089482741 11:118820453-118820475 ATAATAAACCTGAAGATTCTTGG + Intergenic
1090971230 11:131644860-131644882 ATAAAACACCTGAACATACATGG - Intronic
1091442020 12:518348-518370 ATAAGGGACCTGAGTATCCTCGG - Intronic
1091501806 12:1025037-1025059 ATCAGGGACTTGAGCATCCTGGG + Intronic
1091742420 12:2969367-2969389 ATGAGGGACTTGAGCATCCTCGG + Intronic
1092760693 12:11808614-11808636 ATAAGGGATTTGAGCATCCTTGG + Intronic
1093613554 12:21193344-21193366 ATAAGAGACTGGAGCATCCTTGG + Intronic
1094564580 12:31588649-31588671 ATAAGAGACTTCAGCATCCGAGG + Intronic
1094602935 12:31926209-31926231 ATAAGAGACTTAAGCATCCGTGG - Intergenic
1095410251 12:41913493-41913515 ATTAGAGACTTGAGCATCCTTGG - Intergenic
1096440720 12:51641260-51641282 ATAAGAGACTTGAGCATCTGGGG + Intronic
1097125848 12:56774282-56774304 ATAAGGGATTTGAGCATCCTCGG - Intronic
1097743692 12:63275065-63275087 ATAAGAGACTAGAAAATCCATGG - Intergenic
1097815955 12:64073528-64073550 ATAAGGGACTTGAGCATCTTCGG - Intronic
1098254014 12:68598314-68598336 ATAAGGGACTTGAGCATCCATGG + Intergenic
1098896687 12:76070741-76070763 ATAAGGGACTTGAACATCCCAGG - Intronic
1099052024 12:77791942-77791964 ATCAGAGACTTGAGCATCCATGG + Intergenic
1099617996 12:84963454-84963476 AGAAAAGACCCAAACATCCTTGG + Intergenic
1099638096 12:85242486-85242508 ATAAGGGACATGAGCATCCATGG + Intronic
1100016848 12:90021677-90021699 ATATTAGACCTGAACAACCAAGG - Intergenic
1100111741 12:91253030-91253052 ATCAGAGACTTGATCATCCTTGG + Intergenic
1100502906 12:95191666-95191688 ATAAGGGACTTGAGCATCCATGG - Intronic
1100506125 12:95222014-95222036 ATAAGGGACTTGAGCATCCATGG + Intronic
1100847506 12:98675704-98675726 GTAAGAGACTTGAGCATCCATGG + Intronic
1101096046 12:101342070-101342092 ATAAGGGACTTAAACATCCTTGG + Intronic
1101180881 12:102216809-102216831 ATAAGGGACATGAGCATCCCTGG - Intergenic
1101589214 12:106111364-106111386 ATAAGACACCAGGACACCCTGGG - Intronic
1101666539 12:106821489-106821511 ATAAGAGACCTAAATATACAAGG + Intronic
1101983717 12:109429593-109429615 ATTAGAGACTTGAACATCCGTGG + Intronic
1102488471 12:113274025-113274047 ATAAGGGACTTGAACATCTGTGG - Intronic
1102582967 12:113903176-113903198 AGAAGGGACTTGAGCATCCTTGG - Intronic
1103192587 12:119014770-119014792 ATAAGAGACCAGCTCATCCCTGG + Intronic
1104307915 12:127626534-127626556 ATGAGGGACTTGAACATCCTTGG + Intergenic
1104798349 12:131535836-131535858 GTAAGGGACTTGAACATCCATGG + Intergenic
1104871701 12:132003402-132003424 ATAAGGGACTTGAGCATCCTTGG + Intronic
1105709140 13:22989333-22989355 ATGAGAGACTTGAGCATCCATGG - Intergenic
1106175955 13:27331888-27331910 ATCAGGGACTTGAGCATCCTTGG + Intergenic
1107096019 13:36536628-36536650 ATAAGATACCTGAACATGTAGGG - Intergenic
1107387632 13:39929542-39929564 ATCAGAGACCAGATGATCCTCGG + Intergenic
1107653909 13:42572961-42572983 TTAAGAAACTTGAACATCCATGG - Intronic
1108017874 13:46095183-46095205 ATAATTGACATGAACATACTAGG + Intronic
1109447930 13:62469708-62469730 ATAAGAAGCTTGAACATCCCTGG + Intergenic
1109818262 13:67617079-67617101 ATAAGGGACTTGAACATCCATGG + Intergenic
1110161301 13:72381613-72381635 ATAAGAGACTTGAGCATACATGG - Intergenic
1110272171 13:73603205-73603227 ATAAGGGACTTGAGCATCCATGG - Intergenic
1110348271 13:74475066-74475088 ATAAGGGACTTGAGCATCCTTGG + Intergenic
1110454226 13:75672086-75672108 ATAAGGAACTTGAACATCCAGGG - Intronic
1111436244 13:88212165-88212187 ATCAGAGACTCGAACATCCGTGG - Intergenic
1111588635 13:90314008-90314030 ATAAGGGACCTGAGCATCTATGG - Intergenic
1111744905 13:92255126-92255148 ATATGAGACTTGAGCATCCACGG + Intronic
1112656637 13:101458624-101458646 ATGAGAGACTGGAACATCCTTGG - Intronic
1113061527 13:106327325-106327347 GAAAGAGACCTGAATATTCTAGG - Intergenic
1113862865 13:113501435-113501457 ATCAGAGACTTGAGCATCCGAGG + Intronic
1114033221 14:18594525-18594547 ATAAGGGACTTGAACATCCCAGG - Intergenic
1114078014 14:19173722-19173744 ATAAGGGACTTGAACATTCCAGG - Intergenic
1114125720 14:19723240-19723262 ATAAGGGACTTGAACATCCCAGG + Intronic
1114174536 14:20308390-20308412 AAAAGTGACATGAACATCCAAGG - Intergenic
1115874982 14:37851389-37851411 ATTTGAGAACTGAAAATCCTTGG + Intronic
1115958277 14:38806958-38806980 TTAATAGACTTGAGCATCCTTGG - Intergenic
1116011058 14:39352600-39352622 ATAAGAGACTTGAGCATCCATGG - Intronic
1117423123 14:55567409-55567431 ATAAGGGACTTGAACATCTGCGG - Intronic
1117862415 14:60106231-60106253 ATCAGAGACTTGAACATCCTTGG - Intronic
1118417901 14:65563526-65563548 ATCAGTGACCTAAACATCTTAGG + Intronic
1119544889 14:75464561-75464583 GTAAGAAACTTGAGCATCCTCGG + Intronic
1120417375 14:84236805-84236827 ATAAGGGGCTTGAGCATCCTTGG - Intergenic
1120425660 14:84344402-84344424 ATAAGGGACTTGAGCATCCGTGG - Intergenic
1120629181 14:86867880-86867902 ATAAGTGACTTGAGCATCCATGG + Intergenic
1121140414 14:91536790-91536812 ATAAGGGACTTGAGCATCCATGG - Intergenic
1121166973 14:91811792-91811814 ATAAGGGACTTGAGCATCCATGG - Intronic
1121182100 14:91936991-91937013 ATAAGAGGCCTGGAGATCGTGGG + Exonic
1121460977 14:94078219-94078241 ATCAGAGACTTGAGCATCCCTGG + Intronic
1121632804 14:95433230-95433252 ATCTGGGACCTGCACATCCTTGG + Intronic
1121745947 14:96292845-96292867 ATAAGGGACTTGAACATCAAGGG - Intronic
1122505459 14:102229090-102229112 ATATTAGCCCAGAACATCCTAGG + Exonic
1123568961 15:21582539-21582561 ATAAGGGACTTGAACATCCCAGG + Intergenic
1123605070 15:22017860-22017882 ATAAGGGACTTGAACATCCCAGG + Intergenic
1123764244 15:23460212-23460234 ATAAAAGACTTGAGCATCCATGG + Intergenic
1123927961 15:25137054-25137076 ATAAGGGACTTGAACATCCATGG + Intergenic
1124225625 15:27891486-27891508 ATAAGGGACCTGAACATCTATGG - Intronic
1124270702 15:28277888-28277910 ATCAGGGACTTGAGCATCCTAGG - Intronic
1124457408 15:29857056-29857078 ATAAGGAACTTGAACATCCATGG + Intronic
1126142210 15:45448052-45448074 AGAAGTGACATGAACATCCAAGG - Intronic
1126413153 15:48392903-48392925 ACAGGAGACCCGAACATCCCCGG - Intergenic
1126461859 15:48923198-48923220 ATAACAGAAATGTACATCCTAGG - Intronic
1127877050 15:63120555-63120577 CCAAGAGACCAGAATATCCTAGG - Intergenic
1127964723 15:63915006-63915028 ATAAGGGACTTGAGCATCCATGG - Intronic
1129002333 15:72345103-72345125 ATAAGGGACTTGAGCATCCTTGG - Intronic
1129568017 15:76645199-76645221 ATCAGGGACTTGAACATCCCTGG + Intronic
1129858831 15:78844396-78844418 ACCAGGGCCCTGAACATCCTGGG - Intronic
1130539099 15:84809130-84809152 ATAACAGAGCTGAATATTCTTGG + Intergenic
1130628219 15:85538278-85538300 AAAAGAGATCTGATCATCTTTGG + Intronic
1131234884 15:90687322-90687344 ATCAGAGACTTGAGCATCCATGG - Intergenic
1131244701 15:90780923-90780945 ATCAGGGACTTGAGCATCCTTGG + Intronic
1132166723 15:99599982-99600004 ATAAGAGACTTGAGTGTCCTAGG + Intronic
1202977315 15_KI270727v1_random:309629-309651 ATAAGGGACTTGAACATCCCAGG + Intergenic
1133465937 16:6027062-6027084 AAAAGAGACATCAACATCTTGGG - Intronic
1134198352 16:12176665-12176687 ATAAGGGACTTGAGCACCCTTGG + Intronic
1135352768 16:21743273-21743295 ATAAGGGACTTGAATATCCATGG + Intronic
1135451255 16:22559395-22559417 ATAAGGGACTTGAATATCCATGG + Intergenic
1136085112 16:27879304-27879326 ATCAGGGACTTGAGCATCCTTGG - Intronic
1136534863 16:30893564-30893586 ATCAGAGCCCTGCAGATCCTGGG + Intronic
1137744230 16:50809232-50809254 AAAAGAGACCTGGCCATCCTGGG + Intergenic
1139036831 16:62957046-62957068 ATCAGATACCTGAGCATCCGTGG + Intergenic
1139076505 16:63456537-63456559 ATAAGGGACATGAACATCCACGG + Intergenic
1139944392 16:70629476-70629498 ATAAGGGACCTGAGCGTCCATGG - Intronic
1140161075 16:72495136-72495158 ATAAGGGACTTGAGCATCCATGG - Intergenic
1141087321 16:81105555-81105577 ATCAGAGACTTGACCATCCGAGG - Intergenic
1141349952 16:83285686-83285708 ATAAGAGACTTGAGCATTCCAGG + Intronic
1141706308 16:85667043-85667065 ATCAGGGACTTGAACATCCCTGG + Intronic
1142627286 17:1200446-1200468 ATAAGAGACTTGGGCGTCCTGGG + Intronic
1143425084 17:6829370-6829392 ATAAAAGACTTGAGCATCCATGG - Intronic
1143718235 17:8791273-8791295 AGAAGGGACTTGAGCATCCTTGG + Intergenic
1144144591 17:12384920-12384942 ACCAGGGACATGAACATCCTTGG + Intergenic
1144149189 17:12427234-12427256 ATAAGGGACCTGAGCATCTGTGG + Intergenic
1145182584 17:20766312-20766334 ATTAGGGACCTGAGCATCCATGG - Intergenic
1145759247 17:27416564-27416586 ATCAGAGACTTGAGCATCCATGG - Intergenic
1145799746 17:27675471-27675493 ATCAGAGACTTGAGCATCCATGG + Intergenic
1145823043 17:27855202-27855224 ATAAGGGACTTGAGCATCCTAGG + Intronic
1146845110 17:36177668-36177690 ATCAGAGACTTGAGCATCCATGG + Intronic
1146873331 17:36389517-36389539 ATCAGAGACTTGAGCATCCATGG + Intronic
1146880685 17:36440599-36440621 ATCAGAGACTTGAGCATCCATGG + Intergenic
1147066059 17:37923356-37923378 ATCAGAGACTTGAGCATCCATGG - Intergenic
1147859599 17:43510436-43510458 ATAAGAGACTTGAGCATACTTGG - Intronic
1148728382 17:49813770-49813792 ATACGAGACTTGAGCATCCATGG + Intronic
1148919828 17:51020776-51020798 ATAAGGGACCTGAGCATCCATGG - Intronic
1149090895 17:52777351-52777373 ATAAGAGACTAGAGCATCCATGG - Intergenic
1149147541 17:53514201-53514223 ATAAGGGACTTGAATATCCATGG - Intergenic
1149699814 17:58645836-58645858 ATAAGGGACTTGAGCATCTTTGG - Intronic
1149842103 17:59974491-59974513 ATAAGGGACCGGAGCATCCATGG - Intergenic
1149888883 17:60368024-60368046 ATAAGAAACATGAGCATCCTTGG + Intronic
1150360223 17:64525706-64525728 ATAAGAAACATGAACTTTCTGGG - Intronic
1152965928 18:113373-113395 ATAAGAGCCTTGAGCATACTTGG + Intergenic
1153128599 18:1827983-1828005 ATCAGACACCTCAACCTCCTGGG + Intergenic
1153876469 18:9377063-9377085 ATAAGAGACTTGAGCATCTGTGG + Intronic
1154200976 18:12300577-12300599 ATAAGGGACTTGAGCATCCTTGG + Intergenic
1154928041 18:20958680-20958702 ATAAGAGCCTTGAGCATACTTGG - Intronic
1155690115 18:28610118-28610140 ATAAGGGACGTGAGCATCCATGG + Intergenic
1156235020 18:35194793-35194815 ATAAGGGACTTGAGCATCCTTGG - Intergenic
1156440121 18:37177111-37177133 ATAAAAGACCTGAAGATCCAAGG - Intronic
1156935679 18:42703986-42704008 AAAACAGACATAAACATCCTTGG - Intergenic
1157278252 18:46327630-46327652 GTAAGGGACTTGAACATCCTTGG - Intronic
1157353476 18:46912247-46912269 GTAAGAGACTTGAGCATTCTTGG - Intronic
1158772410 18:60535420-60535442 ATAAGGGACTTGAGCATCCACGG - Intergenic
1160325949 18:77948440-77948462 ATAAGAGACCTGAATCCCCCAGG - Intergenic
1160616314 18:80132429-80132451 ATAAGAGACTTGAGCAGTCTTGG + Intronic
1160905844 19:1451446-1451468 ACTGGAGACCTGAACAGCCTTGG + Exonic
1162576523 19:11502417-11502439 ACAAGAGTCATGAACCTCCTTGG + Intronic
1162828932 19:13272137-13272159 ATTGGAGACCTGAACAGCTTGGG + Intronic
1162896394 19:13766945-13766967 ATCAGAGACTTGAGCATCCATGG - Intronic
1164429642 19:28175829-28175851 ATCAGAGACCTGAACATTGGTGG + Intergenic
1166261226 19:41642774-41642796 ATGAGAGATATGGACATCCTGGG + Intronic
1166364795 19:42272919-42272941 CTTAGAGACCTCAGCATCCTCGG - Intronic
1166594068 19:44028883-44028905 AGAAGGGACTTGAGCATCCTTGG - Intronic
1166626770 19:44364801-44364823 ATAACAGACTTGAACATCCGCGG + Intronic
1168255679 19:55163607-55163629 ATAAGGGACTTGAGCATCCTTGG + Intronic
1168297961 19:55386913-55386935 AAAAAGGACCTGAACTTCCTCGG + Intronic
928502841 2:31915243-31915265 GTAAGATTTCTGAACATCCTGGG + Intronic
928714720 2:34047181-34047203 ATAAGATTCCAGAACATTCTGGG - Intergenic
928934580 2:36662050-36662072 ATGAGGGACTTGAGCATCCTCGG - Intergenic
929809209 2:45174798-45174820 ATAAGGGACTTGAACATCTGTGG + Intergenic
930125099 2:47789673-47789695 ATAAGGGACTTGGACATCCAAGG - Intronic
930644390 2:53889265-53889287 ATAACAGACTTGAACATCTGTGG - Intronic
930705905 2:54504660-54504682 ATAAGGGACCTGAGCGTCCATGG + Intronic
930857970 2:56039430-56039452 CCAAAAGACTTGAACATCCTGGG + Intergenic
931618017 2:64181236-64181258 ATAACACACCTGAATATTCTGGG + Intergenic
932005788 2:67925843-67925865 ATAAGGAACTTGAGCATCCTTGG + Intergenic
932030084 2:68174599-68174621 GTAAGAGACTTGAGCATCCAAGG + Intronic
933037544 2:77419385-77419407 ATAAGGGACTTGAACATCCATGG - Intronic
933586412 2:84184276-84184298 ATAAGAGGCTTGAGCATCCTTGG - Intergenic
933621385 2:84546239-84546261 ATAAGGGACTTGAGCATCCGTGG - Intronic
933872811 2:86586018-86586040 ATCAGAGACTTGAGCATCCGTGG - Intronic
933975541 2:87506457-87506479 ATCAGAGACTTGAGCATCCTTGG - Intergenic
934724080 2:96603880-96603902 ATAAGGGACTTGAGCATCCATGG + Intronic
934932711 2:98441189-98441211 ATAAGGGACATGAGCATCCATGG - Intergenic
935435905 2:103032015-103032037 ATAAGAGACTTGAAAATATTTGG + Intergenic
935647997 2:105357505-105357527 ATATGAGACTTGAGCATCCATGG - Intergenic
936318284 2:111444356-111444378 ATCAGAGACTTGAGCATCCTTGG + Intergenic
936584212 2:113739188-113739210 ATAAGGGACTTGAGCATCTTTGG - Intronic
936615362 2:114042780-114042802 ATAAGAAACTTGAACATCTGTGG + Intergenic
936805126 2:116322486-116322508 ATAAGAGACTTAGGCATCCTTGG + Intergenic
937110274 2:119361629-119361651 ATAAGGGACTTGAGCATCCATGG + Intronic
938193319 2:129302044-129302066 CTATGTGACCCGAACATCCTTGG + Intergenic
938546712 2:132339577-132339599 ATAACAGACTTGAGCATCCACGG - Intergenic
938752579 2:134347714-134347736 ATAAGGGACTTGAGTATCCTTGG + Intronic
939313509 2:140516436-140516458 ATAAGGGACTTGAGCATCCATGG + Intronic
939931147 2:148235028-148235050 ATAAGGGACTTGAACATTCCTGG - Intronic
940119663 2:150250205-150250227 ATATGGGACCTGATCATTCTTGG + Intergenic
940320727 2:152373516-152373538 ATCAGAGACTTGAACACCCATGG - Intronic
940355419 2:152736895-152736917 ATAAGGGACTTGAACATTCATGG + Intronic
940749197 2:157605582-157605604 ATAGGAGACTTGCACATCCATGG - Intronic
941719461 2:168797963-168797985 ATAAGGGACTTGAATATCTTTGG - Intronic
942016010 2:171816403-171816425 ATAAGGGACATGAGCATCCATGG - Intronic
942311656 2:174662098-174662120 ATAAGGGACTTGAACACCCAAGG - Intronic
942383444 2:175417801-175417823 ATCAGGGACTTGAACATCCACGG - Intergenic
942932150 2:181507596-181507618 ATAAGGGACTTGAGGATCCTTGG - Intronic
945092918 2:206192842-206192864 ATCAGGGACTTGAGCATCCTTGG - Intronic
945438993 2:209855420-209855442 GTAACAAACCTGCACATCCTGGG + Intronic
946171189 2:217896744-217896766 GTAAGAGACCTGAGCACCCATGG - Intronic
946603759 2:221379315-221379337 ATAAGAGACTTGATCATTCATGG - Intergenic
946908676 2:224440108-224440130 ATAAGGGACTTGAGTATCCTTGG + Intergenic
948291809 2:236831215-236831237 ACAAGAGACCTAGACTTCCTGGG - Intergenic
948417753 2:237826892-237826914 ATAAGGGACTTGAGCATCCTTGG + Intronic
948473487 2:238202266-238202288 ATCACAAGCCTGAACATCCTTGG + Intronic
1169580397 20:7016427-7016449 ATAAAAGACCAGCACATCCCCGG - Intergenic
1169937589 20:10901089-10901111 ATAAGGGACTTGAGCATCCATGG - Intergenic
1171478492 20:25433376-25433398 ATAAGGGACTTGAGCATCCATGG - Intronic
1171875574 20:30572303-30572325 ATAACAGACTTGAGCATCCACGG - Intergenic
1173414223 20:42841277-42841299 ATTACACAGCTGAACATCCTTGG + Intronic
1174033046 20:47646087-47646109 ATAAGGGACTTGAGCATCCATGG - Intronic
1174802105 20:53573057-53573079 ATTAGGGACCTGAGCATCCATGG - Intronic
1174879640 20:54265000-54265022 ATAAGGGACTTGAGCATCTTGGG + Intergenic
1175088528 20:56482232-56482254 ATCAGAGACCTGAGCATCCATGG - Intronic
1175643004 20:60647220-60647242 ATAAGATACCCGGAAATCCTTGG + Intergenic
1176006291 20:62865055-62865077 ATAAGGGACTTGAACATTCGTGG + Intergenic
1176176860 20:63731964-63731986 ATAAGGGACTTGAGCATCCTTGG + Intronic
1177162602 21:17564178-17564200 ATCAGGGACTTGAGCATCCTTGG - Intronic
1177258985 21:18703882-18703904 ATAAGGGACTTGAGCATCCATGG - Intergenic
1177431343 21:20996203-20996225 ATAAGGGACTTGAGCATCCAAGG - Intergenic
1177481247 21:21692149-21692171 ATAATAAACCTGAATATCCATGG - Intergenic
1177515302 21:22142410-22142432 ATAAGAGATTTGAGCATCCATGG - Intergenic
1178162726 21:29938627-29938649 ATCAGAGCCCTGAATCTCCTAGG + Intronic
1178406983 21:32332783-32332805 CCAAGAGACCTGACCAGCCTGGG + Intronic
1179406498 21:41130763-41130785 ATAAGGGATTTGAGCATCCTTGG - Intergenic
1180457335 22:15521580-15521602 ATAAGGGACTTGAACATCCCAGG - Intergenic
1180900361 22:19367294-19367316 ATACGGGACTTGAGCATCCTTGG - Intronic
1181835241 22:25600672-25600694 ATAAGGGACTTGAGCATCCTAGG + Intronic
1182862746 22:33574254-33574276 ATCAGAGACTTGAGCATCTTTGG - Intronic
1184072936 22:42157260-42157282 ATAAGGAACCTGAGCATCCTTGG - Intergenic
1184575267 22:45359181-45359203 ATAAGAGATTTCAGCATCCTCGG + Intronic
949103884 3:180125-180147 GTAACAGAACTGCACATCCTTGG + Intergenic
949149098 3:742908-742930 GTAAGGGACTTGAACATCCATGG + Intergenic
949288523 3:2435269-2435291 ATAAGGGACTTGAGCATCCATGG - Intronic
949698744 3:6730637-6730659 ATCAGGGACTTGAGCATCCTTGG + Intergenic
950974966 3:17230834-17230856 ATAAGAGACTATAGCATCCTTGG - Intronic
951293374 3:20901729-20901751 GTAAGGGACCTGAGCATCTTCGG - Intergenic
953154138 3:40353600-40353622 ATAAGGGACTTGAGCATCCATGG + Intergenic
953710794 3:45268664-45268686 AGAAGGGACTTGAGCATCCTCGG - Intergenic
953855509 3:46496887-46496909 ATAAGGGACCTGAGCATCTGAGG + Intergenic
955425829 3:58788793-58788815 ATAAGAGAACTGACCCTACTGGG + Intronic
955676868 3:61457962-61457984 ATAAGGGACTTGAGCATCCATGG - Intergenic
955749473 3:62173057-62173079 ATAAGGGACTTGAGCATCCAAGG - Intronic
956660340 3:71591273-71591295 ATAAGCCCCCTAAACATCCTGGG + Intergenic
956991630 3:74773031-74773053 ATCAGAGACTTGAGCATCCATGG - Intergenic
957212760 3:77281597-77281619 ATCAGAGACTTGAGCATCCATGG - Intronic
957550957 3:81703937-81703959 ACAAGAGACTTAAGCATCCTTGG + Intronic
957594600 3:82246335-82246357 ATAAGAGACTTAAGCATCCACGG - Intergenic
958423722 3:93957735-93957757 ATAAGTGATTTGAGCATCCTTGG - Intronic
958955573 3:100462742-100462764 ATAAGAGATATGAACATCATCGG + Intergenic
959260553 3:104074358-104074380 ATAAGGGACTTCAGCATCCTTGG + Intergenic
959287857 3:104439885-104439907 ATGAGGGACTTGAGCATCCTAGG - Intergenic
959361313 3:105396350-105396372 AGAAGAGACCTGAATATCTGTGG + Intronic
959639195 3:108612588-108612610 ATAAGAGACTTGGGCATCCTTGG - Intronic
960311829 3:116126254-116126276 ATATGAGACATGACCACCCTAGG + Intronic
960494396 3:118357896-118357918 ATAAGAAACATGAACAACCAAGG - Intergenic
960797547 3:121503671-121503693 ATCAGAGACTTGAGCATCCATGG - Intronic
960883851 3:122374391-122374413 ATCAGGGACTTGAGCATCCTTGG - Intronic
961055270 3:123782515-123782537 AGAAGGAATCTGAACATCCTGGG + Intronic
962207328 3:133445789-133445811 ATAAGAGACTTGAGCATCCGTGG + Intronic
962593801 3:136918503-136918525 ATAAGAGACTTGAGCATCTCTGG + Intronic
962917877 3:139922969-139922991 ATAAGGGACTTGAGCATCCATGG - Intergenic
963750790 3:149177466-149177488 ATAAGGGACTTGAGCATCCATGG - Intronic
964215441 3:154275168-154275190 ATAAAAGACTTGAGCATCCATGG - Exonic
964246116 3:154655870-154655892 ATCAGAGACCTGGAGCTCCTAGG - Intergenic
964579321 3:158214162-158214184 GTAAGGGACTTGAGCATCCTTGG + Intronic
964905699 3:161717512-161717534 TTAAGAGACTTGGATATCCTTGG + Intergenic
965330898 3:167373286-167373308 ATAAGGAACCTGAGCATCCTAGG + Intronic
966890290 3:184402468-184402490 ATCAGAGACTTGAACATCCTTGG - Intronic
967001088 3:185335617-185335639 ATAAGGAATCTGAACATCCTTGG - Intronic
967074332 3:185988667-185988689 ATCAGGGACCTGAAAATCCTAGG + Intergenic
967471789 3:189870489-189870511 ATAAGGGACTTGAGCAACCTAGG + Intronic
968446056 4:652750-652772 ATCCGGGACTTGAACATCCTCGG + Intronic
969238742 4:5886379-5886401 ACAGGACTCCTGAACATCCTAGG - Intronic
969937761 4:10699398-10699420 GTAAGGGACTTGAACATCCATGG - Intergenic
970617794 4:17783549-17783571 GTAAGTGACTTGAACATCCATGG - Intergenic
971843805 4:31892716-31892738 ATAAGGGACTTGAACATCCGTGG + Intergenic
972635025 4:40876571-40876593 ATAAGAGGCTTGAGCATCGTTGG - Intronic
972640818 4:40923510-40923532 ATCACAGAACTGAACAGCCTCGG - Intronic
973998603 4:56486007-56486029 ATAAGGGACTTGAGCATCCTTGG + Intronic
974257080 4:59471675-59471697 ATAAGGGACTTGAGCATCCATGG + Intergenic
974859753 4:67505489-67505511 ATAAGGGACTTGAGCATCCTTGG - Intronic
975039926 4:69734220-69734242 ATATGAGACTGAAACATCCTTGG + Exonic
975547307 4:75573194-75573216 ATAAGGGTTCTGAACATCTTTGG - Intergenic
975636549 4:76455926-76455948 ATAAGAGACTTAAGCATCCATGG - Intronic
975641654 4:76506453-76506475 ATAAGGGACTTGAGCATCCATGG + Intronic
975699646 4:77050973-77050995 ATAAGAGACTTGAGCATGTTGGG - Intronic
975876795 4:78849868-78849890 ATAATAGACCTAAACACTCTTGG - Intronic
976173324 4:82326833-82326855 ATAAAAGTCTTGAGCATCCTTGG + Intergenic
976403051 4:84629563-84629585 ATAAGGGACTTGAGCATCCATGG + Intronic
977000053 4:91486752-91486774 ATAAGGGACTTGAACATCAGTGG + Intronic
977373643 4:96171885-96171907 GTAAGCGACTTGAGCATCCTCGG + Intergenic
977663527 4:99618220-99618242 ATAAGGGACTTGAGCACCCTTGG + Intronic
977775399 4:100913698-100913720 ATAAGAGACTTGAGCATTGTAGG - Intergenic
978361368 4:107933672-107933694 ATCAGGGACTTGAGCATCCTAGG - Intronic
979304156 4:119122927-119122949 ATAAGAGACTTGAACATATATGG - Intergenic
979661555 4:123261559-123261581 ATAAGGGACTTCAGCATCCTTGG + Intronic
980124255 4:128758497-128758519 ATAAGAAAGCTGCACATCCAGGG - Intergenic
981513925 4:145586942-145586964 ATAAGGGACTTGAACATCTGGGG - Intergenic
982166430 4:152617695-152617717 ATAAGAGCCGTGAAAATGCTAGG - Intergenic
982259839 4:153485328-153485350 ATAAAATACCTGAACAAACTGGG - Intronic
982313093 4:154005573-154005595 ATGGGAGACCTGACCATCCTGGG + Intergenic
983090805 4:163499580-163499602 ATAAGGGACCTGAGCATCCATGG - Intronic
983335143 4:166382103-166382125 ATAAGAGACTTGAGCATTCCTGG + Intergenic
983564933 4:169139878-169139900 AAAAGAGACCTAAAAATCATTGG - Intronic
984367165 4:178814064-178814086 AAATGAGACCTGAAAATACTTGG + Intergenic
984792180 4:183625038-183625060 ATCAGGGACTTGAGCATCCTTGG - Intergenic
986308075 5:6530285-6530307 ATATGACACTTGAGCATCCTTGG - Intergenic
986396701 5:7337841-7337863 ATAGGAGACCAGCACATACTGGG + Intergenic
986611046 5:9567415-9567437 ATAAGAGACTTGAGCCTCCATGG - Intergenic
987306686 5:16644098-16644120 ATCAGGGACTTGAGCATCCTTGG + Intergenic
987718427 5:21603199-21603221 ATTAGAAACTTGAACATCCATGG + Intergenic
987953889 5:24712397-24712419 ATAAAGGACTTGAGCATCCTTGG + Intergenic
988439008 5:31210634-31210656 ATAAGGGACTTGAGCATCCTTGG - Intronic
988963815 5:36395128-36395150 ATCAGAGACTTGAGCATCCTTGG - Intergenic
989160400 5:38385321-38385343 ATAAGAGACTTGAGCATCTTTGG - Intronic
989280578 5:39638151-39638173 ATAAGGGATTTGAGCATCCTTGG - Intergenic
989514471 5:42326043-42326065 ATAAGGGACTTGAGCATCCATGG + Intergenic
989774359 5:45184890-45184912 ATAATAGACTTGAGCATCCATGG - Intergenic
990964179 5:61427253-61427275 ATAAGGGACTTAAGCATCCTAGG - Intronic
991264405 5:64700337-64700359 ATCAGAGACTTGAACATCTGAGG - Intronic
991561004 5:67952632-67952654 ATCAGAGACCTGAATATCAAAGG - Intergenic
991606242 5:68404164-68404186 ATTAGAGACTTGAACATGCAAGG - Intergenic
991638934 5:68734336-68734358 ATCAGAGACTTGAACATCCATGG + Intergenic
991913099 5:71581013-71581035 ATAAAGGACTTGAGCATCCTGGG - Intergenic
992461518 5:76965171-76965193 ATAAGGGACTTGAACATCTGTGG + Intronic
992985936 5:82229792-82229814 ATAAGGGACTTGAACATCCATGG + Intronic
993044835 5:82855178-82855200 GTTAGAGACTTGAACCTCCTAGG - Intergenic
993209087 5:84924514-84924536 ATTAGAGACTTGAGCATCCATGG + Intergenic
993539244 5:89128237-89128259 AGAAGAGACCAGATCTTCCTGGG - Intergenic
994794159 5:104272530-104272552 ATAAGAGGCTTGAGCATCATTGG - Intergenic
995363786 5:111330670-111330692 ATAAGGGACTTGAGCATCCATGG + Intronic
996037501 5:118774660-118774682 AGAAGAGACCTGAACTGCCAAGG - Intergenic
996090850 5:119350388-119350410 ATATGAGACTTGAGCATCTTCGG + Intronic
997555974 5:134799083-134799105 ATAAGGGACTTGAGCATCCTAGG + Intronic
997559158 5:134830355-134830377 ATAAGAGGCTTGAACATCCATGG + Intronic
998449988 5:142226845-142226867 ATAAGAAAGGTGAACATCCCTGG + Intergenic
1002513532 5:179739821-179739843 GTAAGGGACTTGAGCATCCTTGG + Intronic
1002560733 5:180080281-180080303 ATAAGGGTCCTGGATATCCTAGG - Intergenic
1002958014 6:1887787-1887809 ATAAGGGAGTTGAGCATCCTTGG - Intronic
1003609870 6:7602241-7602263 ATCAGAGACTTGAGCATCCATGG + Intronic
1003678259 6:8227093-8227115 ATAAGGGACTTGAGCATCCTTGG + Intergenic
1003753839 6:9093410-9093432 GTGATAGAGCTGAACATCCTGGG - Intergenic
1004595210 6:17093181-17093203 ATAAGGGACTTGAGCATCCATGG - Intergenic
1004596584 6:17105155-17105177 ATAAAGGACTTGAACATCCATGG + Intronic
1004719924 6:18260108-18260130 ATAAGGGACTTGAGCATCCATGG - Intronic
1005202838 6:23366292-23366314 ATAAGGGACTTGAGCATCCCTGG - Intergenic
1005506330 6:26471976-26471998 ATAACAGTCCTGAATATCATTGG + Intronic
1005983725 6:30857018-30857040 ATAAGTAACCTGAGCATCCCTGG + Intergenic
1006064187 6:31450459-31450481 ATATGGGACCTGAGCATCCATGG - Intergenic
1006567249 6:34970494-34970516 ATAAGGGACTTGAGCATCCTTGG - Intronic
1006775551 6:36589726-36589748 ATAAGGGACTTGAGCATCCTTGG - Intergenic
1006853251 6:37114719-37114741 ATAAGAGACTTGCACACCCAAGG + Intergenic
1006955306 6:37864859-37864881 ATCAGGGACTTGAGCATCCTCGG - Intronic
1007600766 6:43079517-43079539 ATAAGAGACTTGAGCACCCTTGG - Intronic
1009481125 6:64159101-64159123 ATCAGGGACTTGAACATCCAGGG - Intronic
1009840421 6:69066041-69066063 ATAAGATACTTGAGCATCCATGG + Intronic
1009844009 6:69113121-69113143 ATAAGAAACTTGAGCATCTTTGG + Intronic
1009913969 6:69969705-69969727 ATAAGGGACTTGAGCATCCATGG + Intronic
1010047253 6:71459875-71459897 GTCAGAGACCTGAACATCAATGG + Intergenic
1010535559 6:77025231-77025253 AGAAGAGACCTGAACTCCCGGGG - Intergenic
1010624862 6:78125583-78125605 ATAAGAGACCTGAGCACCTGTGG - Intergenic
1010696367 6:78979094-78979116 ATAAGAGACTTGAACATCCCTGG + Intronic
1010720548 6:79278488-79278510 ATAAGGGACTTGAGCATCCAAGG - Intergenic
1010748289 6:79589000-79589022 ATAAGGAACTTGAATATCCTTGG - Intergenic
1010753622 6:79642355-79642377 ATAAGGGACTTGAGCATCCAAGG + Intronic
1011261439 6:85474113-85474135 ATAAGGGACTTGAGCATCCATGG - Intronic
1011688231 6:89841438-89841460 CTAAGAGACCTGGTAATCCTGGG - Intronic
1011888875 6:92131760-92131782 AAAAGAGACCTCACAATCCTGGG + Intergenic
1012105467 6:95152091-95152113 ATAAGAAACTTGAATATCCGTGG + Intergenic
1012645209 6:101670492-101670514 TTAAGAGACTTGAAAATACTTGG + Intronic
1014601801 6:123422166-123422188 ATAAGAGACCTGAACATCCTTGG + Intronic
1014607845 6:123499942-123499964 ATAAAAGACTTGAACATCTGTGG + Intronic
1015078754 6:129196937-129196959 TAAAGAAACCTGAACATCATGGG + Intronic
1016160425 6:140872702-140872724 ATGAGAGACTTGAGCATCTTGGG + Intergenic
1016604572 6:145905501-145905523 ATAAGGGCCTTGAGCATCCTGGG - Intronic
1017475281 6:154784726-154784748 ATAAGGGACGTGAGCATCCTCGG + Intronic
1017757417 6:157541386-157541408 ATCAGAGACCTGAACAGCAGTGG + Intronic
1017773016 6:157657651-157657673 GTAAGAAATCTCAACATCCTGGG + Intronic
1018775020 6:167006661-167006683 ATAAGAGACTTGAGCATCCTTGG + Intronic
1020354078 7:7257916-7257938 ATAAGAGATTTAAACATCCATGG + Intergenic
1021964762 7:25906432-25906454 ATCAGTGACTTGAACATCCATGG - Intergenic
1022321831 7:29295012-29295034 ATAAGAGACTTGAGCATCCATGG - Intronic
1022598608 7:31735878-31735900 ATAAGAGACTTGAGCATCCTTGG - Intergenic
1022631661 7:32091322-32091344 ATAAAAGACATGAACATAATAGG + Intronic
1022714481 7:32886558-32886580 ATCAGAGACCTGAGTGTCCTTGG + Intronic
1023114707 7:36851349-36851371 ATAAGGGACTTGAGCATCCTGGG + Intergenic
1023506669 7:40906695-40906717 ATAAAGGACTCGAACATCCTTGG + Intergenic
1023732498 7:43205779-43205801 GTAAGGGACCTGAAGATCTTGGG - Intronic
1024238103 7:47413556-47413578 AAAACACACTTGAACATCCTCGG + Intronic
1026519570 7:71104793-71104815 ATAAGAGACTTGAGCATCCCTGG - Intergenic
1026548946 7:71350681-71350703 ACAAGGGACTTGAGCATCCTTGG + Intronic
1027358363 7:77382425-77382447 ATATGAGACCTGGAATTCCTTGG - Intronic
1028520026 7:91719869-91719891 ATAAGGGACTTGAGCATCCATGG + Intronic
1028771848 7:94634111-94634133 AAGAGAGACCTAAACATACTGGG - Intronic
1030737961 7:113072376-113072398 ATCTGAGACATGAACACCCTAGG - Intergenic
1030821664 7:114099718-114099740 ATCAGAGACTTGAGCATCCTTGG - Intronic
1030875805 7:114811855-114811877 ATCAAAGACTTGAACATCCATGG + Intergenic
1031337596 7:120555086-120555108 ATAAAAGACCTGCAGATCCCTGG - Intronic
1032309942 7:130775891-130775913 ATAAGGGACTTGAGCATCCATGG + Intergenic
1034097404 7:148422825-148422847 ATAAGGGACGTGAGCATCCATGG + Intergenic
1034153533 7:148935869-148935891 ATAAAGGACTTGAACATCCATGG - Intergenic
1034178543 7:149119938-149119960 ATAAGGGACTTGAGCATCCATGG + Intronic
1035131095 7:156654377-156654399 ATCAGGGACTTGAGCATCCTTGG + Intronic
1035718826 8:1775292-1775314 ATAAGGGACTTGAGCATCCGTGG + Intronic
1036909062 8:12737562-12737584 ATCAGGGACTTGAGCATCCTTGG + Intronic
1037431747 8:18820442-18820464 ATCAGGGACTTGAACATCCATGG - Intronic
1038185532 8:25270824-25270846 ATCAGAGACTTGAGCATCCATGG - Intronic
1038734983 8:30160769-30160791 ATCAGAGACTTGAACATCTGAGG + Intronic
1038831739 8:31069650-31069672 ATAAGAGACTTGATCATCTATGG + Intronic
1039014525 8:33131030-33131052 ATCAGAGACTTGAGCATCCATGG - Intergenic
1040731349 8:50451330-50451352 ATAAGGGACTTGAGCATCCACGG + Intronic
1041033852 8:53766677-53766699 ATAAGAGACAGGTACACCCTGGG - Intronic
1041137557 8:54776499-54776521 ATAAGGGACTTGAGCATCTTTGG + Intergenic
1041742784 8:61175029-61175051 CTATTAGACCTCAACATCCTAGG - Intronic
1043097933 8:75999401-75999423 ATGAGATAATTGAACATCCTTGG - Intergenic
1043460018 8:80450153-80450175 ATAAGGGACTTGAACATCCATGG - Intergenic
1044249293 8:89987738-89987760 ATAATTGAAATGAACATCCTTGG - Intronic
1044641563 8:94387874-94387896 TTAAGAGACCTGCCAATCCTAGG - Intronic
1044653214 8:94520705-94520727 ATCAGAGACTGGAGCATCCTTGG + Intronic
1045185366 8:99831821-99831843 ATAAGGGACTTGAGCATCCGTGG + Intronic
1045192264 8:99894539-99894561 ATAAGAGGCCTGAAAAACGTTGG - Intergenic
1045543156 8:103105188-103105210 ACAAAACCCCTGAACATCCTAGG - Intergenic
1046738574 8:117804497-117804519 ATAGGAGAGCTTTACATCCTTGG + Intronic
1046837788 8:118822082-118822104 ATTAGGGACTTGAGCATCCTTGG - Intergenic
1047362274 8:124179895-124179917 AACAGATGCCTGAACATCCTAGG + Intergenic
1048052855 8:130835660-130835682 ATAAGGGACTTGAACATGCATGG - Intronic
1048595001 8:135857378-135857400 ATAAGAGACTTGAGCATCCTTGG + Intergenic
1049150716 8:141033882-141033904 GTAAGCAACTTGAACATCCTTGG + Intergenic
1050188421 9:2999249-2999271 ATAAGGGACTTGAGCATCCAAGG - Intergenic
1050649445 9:7759454-7759476 ATCAGAGACTTGAGCATCCATGG - Intergenic
1051083900 9:13324811-13324833 ATAAGAGACTGGAGCATCCATGG + Intergenic
1051851278 9:21511896-21511918 CTAAGAGGCAAGAACATCCTAGG + Intergenic
1052932130 9:34064318-34064340 ATAAGGGACTTGAACATCTGTGG - Intergenic
1053151026 9:35743099-35743121 ATCAAAGACTTGAGCATCCTCGG + Intronic
1053448966 9:38177324-38177346 ATAAGGAACTTGAACATCCGTGG - Intergenic
1054727478 9:68666814-68666836 ATAAGGGACTTGAGCATCCATGG + Intergenic
1054819240 9:69505407-69505429 ATAAGAGAACTGGAAATCCTGGG + Intronic
1055783528 9:79846015-79846037 ATAAGAGAGTTGAGCATCCCTGG + Intergenic
1055851444 9:80635546-80635568 ATAATAGAGCAGAACATCCAAGG - Intergenic
1056120292 9:83480846-83480868 ATAAGGGACTTGAGCATCCTCGG + Intronic
1056384372 9:86083170-86083192 ATAAGAGACTTGAACATCCTTGG - Intronic
1056466689 9:86863096-86863118 ATCAGAGACTTGAGCATCCTCGG + Intergenic
1056644807 9:88401464-88401486 ATAAGAAACTTGAGCATCCATGG - Intronic
1056725759 9:89114590-89114612 ATAAGAGATCTGAGCATCTATGG + Intronic
1056878896 9:90369316-90369338 ATTAGGGCCCTGATCATCCTTGG + Intergenic
1056903524 9:90624334-90624356 AAAAGAGACTTAAACATCCATGG + Intronic
1057555109 9:96081864-96081886 ATCAGCAACCTGCACATCCTTGG - Intergenic
1058125348 9:101187324-101187346 ATTAGAGAGCTGAAAATCTTCGG - Intronic
1058404201 9:104653323-104653345 ATAAGGAACTTGAACATCCATGG - Intergenic
1058618016 9:106855659-106855681 ATAAGAGACTTGAGCATCCATGG - Intergenic
1059944589 9:119396141-119396163 ATAAGTGACTTGAGCATCCGAGG - Intergenic
1060159886 9:121352133-121352155 ATAAGAGACTTGAGCATCCTTGG - Intronic
1060338096 9:122745896-122745918 ATAACAAACCTGCACATTCTAGG - Intergenic
1061529910 9:131202641-131202663 TTAAGAGACCAGACCAGCCTGGG - Intronic
1061756787 9:132819356-132819378 ATCAGAGACTGGAACATCCTCGG + Intronic
1061763839 9:132869242-132869264 ATAAGAGTCCTGCACAGGCTGGG + Intronic
1185783505 X:2869319-2869341 ATCAGAGACTTGAGCATCCGTGG + Intronic
1186555245 X:10551026-10551048 ATAAGGGACCTGAGCATCTGTGG - Intronic
1186662391 X:11682056-11682078 ATAAGGGACTTGAGCATCCATGG - Intergenic
1186930108 X:14379940-14379962 ATAAGGGACTTGAGCATCCTTGG - Intergenic
1187381836 X:18809199-18809221 ATAAGTGACTTGAGCATCCAGGG - Intronic
1188032599 X:25281513-25281535 ATAAGGGACTTGAGAATCCTTGG + Intergenic
1188130593 X:26426703-26426725 ATAAGAGACTTGAGCATCCATGG + Intergenic
1189221954 X:39380078-39380100 ATAAGAGACTTGAGCATCCAAGG + Intergenic
1189577145 X:42366110-42366132 ATAAGGGACTTGAGCATCCATGG + Intergenic
1190194069 X:48302252-48302274 ACAAGAGATCTGAAAATCCAGGG - Intergenic
1190513078 X:51194117-51194139 ATGAGAGACTTGAGCATCCATGG + Intergenic
1190811409 X:53887894-53887916 ATAACAGACTTGAGCATCCGTGG + Intergenic
1190832858 X:54074896-54074918 ATAAGAAAACTGAAGCTCCTAGG + Intronic
1190960177 X:55239177-55239199 ATAAAAAGCCTGAAGATCCTAGG + Intronic
1190983413 X:55478878-55478900 GTAAGAGACCTGAGCATCCAAGG + Intergenic
1190985286 X:55494305-55494327 GTAAGAGACCTGAGCATCCAAGG - Intergenic
1192242318 X:69342454-69342476 ATAAGGGACTTGAGCATCCATGG - Intergenic
1194403484 X:93466481-93466503 ATTAGAGACTTGAGCATCCGTGG + Intergenic
1194962040 X:100247067-100247089 TTAACAGACCTGAAGCTCCTGGG + Intergenic
1195437443 X:104861669-104861691 ATAAGGGACCTGAGCATCGGTGG - Intronic
1195939218 X:110153613-110153635 ATTAGGGACTTGAGCATCCTTGG - Intronic
1196388196 X:115182092-115182114 ATAAGAGACTTGAGCATTCGTGG + Intronic
1197669584 X:129261436-129261458 ATCAGGGACTTGAGCATCCTTGG - Intergenic
1197793280 X:130276641-130276663 ATAAGTGGCCTGATCATCCTTGG - Intergenic
1198244752 X:134819587-134819609 AGAAGAGACTTAAACAGCCTGGG + Intronic
1201918778 Y:19211712-19211734 ATAAGGGCCTTGAACATCCTTGG - Intergenic