ID: 1014601921

View in Genome Browser
Species Human (GRCh38)
Location 6:123423881-123423903
Sequence TCCATAGTCTTTAAGTAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 244}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014601921_1014601924 -1 Left 1014601921 6:123423881-123423903 CCTTTTTACTTAAAGACTATGGA 0: 1
1: 0
2: 0
3: 22
4: 244
Right 1014601924 6:123423903-123423925 ACAGCACTCTGGCCTAACTTGGG 0: 1
1: 0
2: 0
3: 8
4: 80
1014601921_1014601925 5 Left 1014601921 6:123423881-123423903 CCTTTTTACTTAAAGACTATGGA 0: 1
1: 0
2: 0
3: 22
4: 244
Right 1014601925 6:123423909-123423931 CTCTGGCCTAACTTGGGTCATGG No data
1014601921_1014601923 -2 Left 1014601921 6:123423881-123423903 CCTTTTTACTTAAAGACTATGGA 0: 1
1: 0
2: 0
3: 22
4: 244
Right 1014601923 6:123423902-123423924 GACAGCACTCTGGCCTAACTTGG No data
1014601921_1014601929 20 Left 1014601921 6:123423881-123423903 CCTTTTTACTTAAAGACTATGGA 0: 1
1: 0
2: 0
3: 22
4: 244
Right 1014601929 6:123423924-123423946 GGTCATGGGCCCACACTCATGGG No data
1014601921_1014601928 19 Left 1014601921 6:123423881-123423903 CCTTTTTACTTAAAGACTATGGA 0: 1
1: 0
2: 0
3: 22
4: 244
Right 1014601928 6:123423923-123423945 GGGTCATGGGCCCACACTCATGG 0: 1
1: 0
2: 0
3: 14
4: 157
1014601921_1014601926 6 Left 1014601921 6:123423881-123423903 CCTTTTTACTTAAAGACTATGGA 0: 1
1: 0
2: 0
3: 22
4: 244
Right 1014601926 6:123423910-123423932 TCTGGCCTAACTTGGGTCATGGG 0: 1
1: 0
2: 1
3: 7
4: 84
1014601921_1014601930 21 Left 1014601921 6:123423881-123423903 CCTTTTTACTTAAAGACTATGGA 0: 1
1: 0
2: 0
3: 22
4: 244
Right 1014601930 6:123423925-123423947 GTCATGGGCCCACACTCATGGGG 0: 1
1: 0
2: 0
3: 7
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014601921 Original CRISPR TCCATAGTCTTTAAGTAAAA AGG (reversed) Intronic
900007167 1:67919-67941 TCCAATGTCTTTAAGTAATTGGG - Intergenic
903465348 1:23548566-23548588 TTCATAGTCTTTAATAAAATGGG - Intergenic
904896182 1:33820129-33820151 CCCATAAACTTTAAGGAAAATGG + Intronic
905102479 1:35536961-35536983 TCCAGAGTCTTTTAGTCATAAGG - Intronic
907825577 1:58013677-58013699 TTCATATTATTCAAGTAAAATGG - Intronic
909113278 1:71505662-71505684 TCCCTAGTCCTAAAGTAGAAGGG - Intronic
909881049 1:80879200-80879222 TAGATAGTCTTTAAGCATAAGGG - Intergenic
910823289 1:91375014-91375036 TCCAGAGTGTTTAAGTAAGGTGG + Intronic
911443940 1:97967244-97967266 TCCATAGTCTTCAGACAAAAGGG - Intergenic
911543696 1:99189927-99189949 TCAATTGGCTTTAAGTAAAGAGG - Intergenic
911550716 1:99276400-99276422 TTCATAATATTTAAGTAAAATGG + Intronic
911858794 1:102918789-102918811 TACATAGGCTTTAAATTAAATGG + Intronic
913672866 1:121114727-121114749 TCCCTAATCCTTAAGAAAAAAGG + Intergenic
914024642 1:143902103-143902125 TCCCTAATCCTTAAGAAAAAAGG + Intergenic
914663127 1:149810123-149810145 TCCCTAATCCTTAAGAAAAAAGG + Intronic
914863125 1:151403043-151403065 TCCATTGTCTGTCAATAAAATGG + Exonic
916899558 1:169206050-169206072 TTTATAGTTTTTAAGTAGAATGG - Intronic
917020780 1:170583796-170583818 TCCATGGTTTTTAAGGAATAAGG + Intergenic
917050932 1:170922377-170922399 TCCCTAGACTTTAGGTAAAAAGG + Intergenic
919510923 1:198462949-198462971 TTCATATTCATTAAGTATAATGG + Intergenic
919590562 1:199496454-199496476 TCTATAGACTGAAAGTAAAAGGG + Intergenic
920336253 1:205247361-205247383 TCCATAGACTTTGCATAAAATGG - Intronic
920543800 1:206799067-206799089 TCCAGAGTCTTGAAATAAACTGG - Intronic
920578443 1:207081560-207081582 TCCAAATTCTTTAAGTTCAAGGG + Intronic
923359565 1:233197362-233197384 TCCACTGTCTTTTGGTAAAATGG - Intronic
1063352926 10:5373237-5373259 GCCATGGTCTTTAAGCAACAGGG + Intronic
1066342169 10:34545865-34545887 TACATAGGTTTTAATTAAAATGG - Intronic
1066615853 10:37294158-37294180 TCCATAGTCTTTTAAGAAGATGG + Intronic
1068865558 10:61891745-61891767 TCAATAATTTTTAAGTGAAAAGG + Intergenic
1069003248 10:63289696-63289718 TCCAGAAACTTTAAGTAATATGG - Intronic
1072951620 10:99851572-99851594 TCCTTAGCCATAAAGTAAAAGGG - Exonic
1074744046 10:116513705-116513727 TCCATAGTCTGTAAGGAATCAGG - Intergenic
1076267696 10:129121667-129121689 TCTTTGGTCTTTAGGTAAAATGG - Intergenic
1079507854 11:21174413-21174435 TACATAGTCAATAACTAAAAAGG + Intronic
1081391017 11:42528900-42528922 TTCAGAGTCTTTAAGAGAAATGG - Intergenic
1085918186 11:80917593-80917615 TCAAAAGTCTTTGTGTAAAAAGG - Intergenic
1086233967 11:84604872-84604894 TCGATAGATTTAAAGTAAAAGGG + Intronic
1088029601 11:105230342-105230364 ACCATAGTATTTAAGGTAAAAGG - Intergenic
1092352721 12:7768969-7768991 TTAATCGTCTTCAAGTAAAAGGG + Intronic
1093859018 12:24140451-24140473 ACCATAGTCTTTACTTATAATGG - Intergenic
1097765065 12:63516833-63516855 TCTACAGTCTTTAAGTTATAAGG - Intergenic
1098596421 12:72277176-72277198 ACTATAGTCTCCAAGTAAAATGG + Intronic
1098803347 12:74989305-74989327 TACATAATCTAGAAGTAAAATGG - Intergenic
1098931241 12:76417434-76417456 TAAAAAGTCTTTAAGTATAATGG - Intronic
1099013561 12:77320117-77320139 TCCATAGTTTTTTAGGGAAAAGG + Intergenic
1101776330 12:107797670-107797692 GTAATAGTCTTTGAGTAAAATGG + Intergenic
1102086695 12:110147116-110147138 TCTATAGTCTTAAAGTGAGAAGG + Intronic
1105709494 13:22992952-22992974 TCTCTAGTCCTTAAGGAAAACGG - Intergenic
1105891095 13:24682811-24682833 TCCATTTCCTTTATGTAAAATGG + Intronic
1106328545 13:28717771-28717793 TCCATAGTATTTAATAAAATGGG - Intronic
1107372106 13:39763703-39763725 TCCATATTAAGTAAGTAAAAGGG - Intronic
1110306467 13:73993268-73993290 TCAAAAGTCTTTAAGGAGAAAGG - Intronic
1110853836 13:80276090-80276112 TCCTTATTCTTTAGCTAAAAAGG + Intergenic
1110989139 13:82014797-82014819 TTCATATTCTTTAAGGAATAGGG + Intergenic
1111466589 13:88621142-88621164 ACTTTAGACTTTAAGTAAAATGG - Intergenic
1111793604 13:92889730-92889752 TCCATAGTTTTTAAAATAAAGGG - Intergenic
1112120578 13:96405972-96405994 TCCAAAGTCTTAATGGAAAAAGG - Intronic
1114207681 14:20588506-20588528 TCTAAAGTCTTTAAGGGAAATGG + Intronic
1114737196 14:25054284-25054306 TCCATATTTTTAAAGTAAAAGGG - Intergenic
1115016663 14:28623718-28623740 TCCATATCATTTAAGTAGAAGGG - Intergenic
1115140911 14:30169863-30169885 TGCATAGTTTATAAGAAAAAAGG + Intronic
1115598322 14:34930823-34930845 TACCTAGTTTTTAAATAAAAAGG + Intergenic
1115788249 14:36850499-36850521 TCCATGGTCTCTTAGAAAAAAGG + Intronic
1115898181 14:38114489-38114511 TCCATAGTTTTGATTTAAAAAGG + Intergenic
1116510490 14:45739713-45739735 TTGATATTATTTAAGTAAAAAGG + Intergenic
1116970790 14:51062978-51063000 TCCATAGTTTAAAAGAAAAAAGG + Intronic
1118287873 14:64493349-64493371 TCCATATTTTATAAGTGAAATGG - Intronic
1126124094 15:45279663-45279685 TCCATACACATTAAGCAAAAAGG - Intergenic
1127029167 15:54842619-54842641 TTCTTGGTCTTTATGTAAAATGG - Intergenic
1128597742 15:68966822-68966844 TCCACAGGCTCAAAGTAAAAGGG - Intronic
1128845510 15:70891503-70891525 TCCAGAGTTTTTAAATAGAAAGG - Intronic
1129633727 15:77291598-77291620 TCCATATTCCTTAAGTCAGAAGG - Intronic
1131758239 15:95589618-95589640 TCCAAAGTCATTGAGTAAATGGG - Intergenic
1135159840 16:20084207-20084229 TCCCTAGTGTTTAAGAAATAGGG + Intergenic
1139333579 16:66214000-66214022 TCCGTAGTCTTGAATTTAAATGG - Intergenic
1140337842 16:74127350-74127372 TACATTTTTTTTAAGTAAAAAGG + Intergenic
1144084293 17:11794701-11794723 ACTATAGTCTTTAAGAAAAGGGG - Intronic
1144405057 17:14944443-14944465 TCTATAGTTTTTAATTAAAATGG + Intergenic
1146027125 17:29331188-29331210 TCCAAAATCTTTAAGATAAATGG + Intergenic
1146032554 17:29378445-29378467 TTCATAGAGTTTAAGTAAATTGG - Intergenic
1149009809 17:51844564-51844586 TCCATTGTCATTAAATAACATGG + Intronic
1149541170 17:57469259-57469281 TCCATGGTCTGTAAGCATAAAGG + Intronic
1149566010 17:57641110-57641132 TCCACAGTCTAGCAGTAAAAGGG + Intronic
1149576395 17:57716333-57716355 TCCAAAGACTATAAGTAAAAGGG - Intergenic
1150272971 17:63878529-63878551 TCCATAGGCATTAAGAAAAGTGG + Intronic
1150278633 17:63915828-63915850 TCCATAGGCATTAAGGAAAGTGG + Intronic
1150279732 17:63922447-63922469 TCCATAGGCATTAAGGAAAGTGG + Intergenic
1156046399 18:32882377-32882399 TCCATAGTCAACATGTAAAAGGG - Intergenic
1156751239 18:40458379-40458401 TTAATAGTGTTTAAGGAAAATGG + Intergenic
1157107617 18:44789556-44789578 TCAACAGTATTTAAGTTAAATGG - Intronic
1157881322 18:51323618-51323640 TCAATTGTCTTTAAGGAAAATGG - Intergenic
1158232041 18:55267693-55267715 TGCATAATCTTTAAGGAAATAGG - Intronic
1158412482 18:57220456-57220478 TTTAAAGTCTTAAAGTAAAAAGG - Intergenic
1158808559 18:61004261-61004283 TGCATATTCATTAAATAAAAAGG - Intergenic
1159403912 18:67975507-67975529 TCCATAGACTTAAAGTAAAGGGG - Intergenic
1159830608 18:73273897-73273919 TCCATATACTTTAAGTATATGGG - Intergenic
1160638921 19:109507-109529 TCCAATGTCTTTAAGTAATTGGG - Intronic
1164011645 19:21208359-21208381 TCCATAGTCACTAAATAAATTGG - Intergenic
927582248 2:24262564-24262586 TCCTTAGTGTTTAAGGAACAAGG - Intronic
928897849 2:36285076-36285098 TGCATTGTCTTCAAGTAAAGGGG + Intergenic
931757717 2:65388825-65388847 GCCCTATTCTTTAATTAAAATGG + Intronic
935871316 2:107453138-107453160 TTCAAAGACTTTAACTAAAAAGG - Intergenic
936433117 2:112481740-112481762 TCCGTAGTCGTTAAGCAAAGAGG + Intergenic
937205895 2:120237003-120237025 TGCTTAGTCTTCAAGTAAAGGGG - Intergenic
939139013 2:138331078-138331100 TGCAGAGTCTTTAAGGAAACTGG + Intergenic
939285824 2:140128109-140128131 GCCATAGTCTGTCAGCAAAAAGG - Intergenic
940718847 2:157259317-157259339 TCCACTGTCTTCAGGTAAAAGGG - Exonic
940781775 2:157940935-157940957 TCCATTGTCTTCAAGCAAGAAGG - Intronic
940820473 2:158349957-158349979 TCCCTTGTCTTTAATGAAAATGG - Intronic
941264548 2:163344196-163344218 TCAATAGACTTTTAGTAATATGG + Intergenic
942786450 2:179707455-179707477 TCCATAGTCTGTAATTACAAAGG - Intronic
945260692 2:207840614-207840636 TGCATATTCTTTCAGTAAATTGG + Intronic
946667165 2:222062908-222062930 TCCAAATTTTTTAAGTAATATGG - Intergenic
948424866 2:237880786-237880808 TCAGTTGTCTTTAAGTAAAGGGG - Intronic
1169500511 20:6156050-6156072 TCCACAGGCTCAAAGTAAAAGGG - Intergenic
1170876032 20:20251039-20251061 GCTATATTCTTGAAGTAAAATGG + Intronic
1176701302 21:10054396-10054418 TGCAAAGTATTTTAGTAAAAGGG + Intergenic
1177921077 21:27153321-27153343 TGCATTGTCTTTAAGCAAGAGGG + Intergenic
1178176590 21:30106495-30106517 TCCAAAGTCTATACATAAAAAGG + Intergenic
1178191772 21:30290793-30290815 TCCATAGTATTCAAGTAAGCAGG - Intergenic
1178211522 21:30539220-30539242 TCTATAATCATTAACTAAAATGG + Intergenic
1185196747 22:49476287-49476309 TCCACATTCATTAAGTAAAATGG + Intronic
1185253517 22:49818569-49818591 TCTTTAGTCTTAAAGGAAAAGGG - Intronic
949204123 3:1417554-1417576 TCCATAGTTTTGTTGTAAAAAGG + Intergenic
951998601 3:28758907-28758929 TCCAAGGGCTTTAAGTAAAGAGG - Intergenic
953935406 3:47037488-47037510 TCCATGGTGTATATGTAAAAAGG + Intronic
957616237 3:82531206-82531228 GCCATAGTCAAAAAGTAAAAGGG - Intergenic
959355241 3:105319175-105319197 TCAATAATTTTTAAGTAAAAGGG + Intergenic
960449375 3:117787967-117787989 TATATATTCTTTAGGTAAAAAGG + Intergenic
960809673 3:121615717-121615739 AACATTATCTTTAAGTAAAAAGG + Intronic
961994686 3:131229579-131229601 TGCATAGTCTTTATTAAAAATGG - Intronic
962490121 3:135885394-135885416 TCTTTAGTCTTTAAGAAACATGG + Intergenic
963235429 3:142951281-142951303 TCCATAATGTTTACTTAAAATGG - Intronic
963524217 3:146395908-146395930 TCCAGAGTCAATAACTAAAATGG + Intronic
964287403 3:155133477-155133499 TCTATAGTCTTTAAATACATCGG + Intronic
965484645 3:169263660-169263682 TTCATTGTCTTAAAGTAAATAGG + Intronic
966412855 3:179661169-179661191 CCCAGAGTCTTTAAGTAATTTGG - Intronic
968574468 4:1358706-1358728 TCCATAATTTCTAATTAAAATGG - Intronic
969025577 4:4169569-4169591 TCAATAGTCTTTCTGCAAAAGGG + Intergenic
970930415 4:21504862-21504884 TCTATTGATTTTAAGTAAAATGG - Intronic
971631015 4:28993999-28994021 CCCATAGTCTTTAGGCAAAGGGG - Intergenic
972519749 4:39842427-39842449 TCCATAGTGTTCTACTAAAAAGG + Intronic
974297711 4:60023785-60023807 TGCAGAGGCTTAAAGTAAAAGGG - Intergenic
976516668 4:85976079-85976101 TACATTCTCCTTAAGTAAAAGGG + Intronic
976817595 4:89167305-89167327 TCCATAGTGTATTAGTAAAAAGG - Intergenic
977021507 4:91765933-91765955 TACATAGTTTTTAAATACAAAGG + Intergenic
977738685 4:100449409-100449431 TTCATCTTCTTTCAGTAAAATGG + Intronic
977831366 4:101597520-101597542 TCCATAGTTTAGAGGTAAAAGGG + Intronic
979537844 4:121843855-121843877 TCTATAGACTTTAATCAAAATGG + Intronic
979692100 4:123570642-123570664 TCCATACTGTTTATGTATAATGG + Intergenic
979957709 4:126975109-126975131 TCCTTATTCTTTCAGTATAATGG - Intergenic
980373452 4:131910652-131910674 TGCAAAGTATTTTAGTAAAAGGG + Intergenic
980671653 4:136017045-136017067 TACATAAACTCTAAGTAAAATGG + Intergenic
980817338 4:137965634-137965656 TGCATGGTCTTTGAGTAAAGGGG - Intergenic
981003640 4:139853172-139853194 TCCTTAGTCTGTATGTATAAGGG - Intronic
981761844 4:148203057-148203079 TACAAAGTATTTAAATAAAAGGG + Intronic
982463618 4:155702864-155702886 TAAATAGTTTTTAAGGAAAAAGG + Intronic
983217701 4:165017355-165017377 TTCAGAGTCTTGAAGTTAAAGGG + Intergenic
983553511 4:169039694-169039716 TCCAGAGACTGTAATTAAAACGG + Intergenic
983612909 4:169669807-169669829 TCAAAAAGCTTTAAGTAAAAAGG - Intronic
983908319 4:173207415-173207437 AACATACTTTTTAAGTAAAATGG + Intronic
986178450 5:5371814-5371836 TACATAGTGGTTAGGTAAAATGG - Intergenic
986911399 5:12562894-12562916 TATATAGTCTCTAAGTAACATGG - Intergenic
988241263 5:28612403-28612425 TCCAGAGTCTGAGAGTAAAATGG + Intergenic
988812596 5:34800261-34800283 TAGATAGCCTTTAAGTAAAAGGG + Intronic
989544069 5:42651945-42651967 TGCATGATCTTAAAGTAAAATGG - Intronic
990789551 5:59461829-59461851 TCCATAGGCTCTCAGTAGAAAGG + Intronic
992588503 5:78268315-78268337 TACATAGTCATTAAGTAAATAGG - Intronic
993110089 5:83646114-83646136 TCCTTAGCCTTTAAAGAAAATGG - Intronic
993128790 5:83870016-83870038 ATCAAAGACTTTAAGTAAAATGG + Intergenic
993560352 5:89399361-89399383 TACATAGATTTTAAGAAAAAAGG + Intergenic
993957920 5:94259555-94259577 TCTATAGTCTATTAGTAAACTGG + Intronic
994232339 5:97322354-97322376 TACTTAGTCTTTCATTAAAAGGG - Intergenic
995075619 5:107979870-107979892 TTCATATACTTTAAGTAAACAGG - Intronic
995100468 5:108295428-108295450 TCCCTAGCCCTTCAGTAAAATGG - Intronic
995168757 5:109080892-109080914 GCCACAGTCTTGAAGTAAAGAGG + Intronic
996299372 5:121962774-121962796 TCCAAAGTCTTAAAGTAAGCTGG + Intronic
996518228 5:124397347-124397369 TCCATTGTCTTCATTTAAAAGGG + Intergenic
996579662 5:125017376-125017398 TCAATAGACTTTCAGCAAAAAGG + Intergenic
996622585 5:125526337-125526359 TCCCTGGTCTTTAAGGATAAAGG + Intergenic
999028873 5:148267727-148267749 TCCAGAATTTTAAAGTAAAAGGG + Intergenic
1000866048 5:166516039-166516061 TCCCAAATCTTCAAGTAAAATGG + Intergenic
1000972504 5:167729492-167729514 TCCATAATTTTTAATAAAAATGG - Intronic
1002593743 5:180308422-180308444 TCAACAGTCTTTTATTAAAAAGG - Intronic
1004073858 6:12327521-12327543 TCCAAACTCCTTAAGCAAAAGGG + Intergenic
1004102728 6:12631107-12631129 TTCATAGACCTGAAGTAAAAAGG - Intergenic
1004751664 6:18568093-18568115 TCCATAGTGTTTAGTTAGAATGG + Intergenic
1005053259 6:21705364-21705386 TACATAGTCTTTATATAATAGGG + Intergenic
1006479691 6:34281952-34281974 TCCAAAGTGCTGAAGTAAAAAGG - Exonic
1006998540 6:38285878-38285900 TCCAGATTTTTAAAGTAAAAAGG + Intronic
1008072853 6:47115030-47115052 GGCATAGTCTTCAAGGAAAAGGG + Intergenic
1008368959 6:50712290-50712312 AACTTAATCTTTAAGTAAAAGGG - Intergenic
1009331098 6:62421222-62421244 TCCATATTATTCAAATAAAATGG + Intergenic
1009551412 6:65098259-65098281 TGCATTTTCTTTGAGTAAAAGGG + Intronic
1009958390 6:70486275-70486297 TTCATACTTTTTAATTAAAAGGG - Intronic
1010771657 6:79839165-79839187 TCTATAGTATTAAAGTAAAAAGG + Intergenic
1012103359 6:95120929-95120951 ACCAGACTCTTTAAATAAAATGG - Intergenic
1012114632 6:95280817-95280839 TCCCAGGTCTTTCAGTAAAAAGG - Intergenic
1013685034 6:112570671-112570693 TCCATTTTCTGTTAGTAAAACGG - Intergenic
1014601921 6:123423881-123423903 TCCATAGTCTTTAAGTAAAAAGG - Intronic
1015690900 6:135921622-135921644 TCCATTTTCTTTAAGAAACAAGG + Intronic
1015974202 6:138773087-138773109 TCCAGAGGCTTTAAGTATAGTGG + Intronic
1016649338 6:146446422-146446444 TCCAAAGGTTTTAAATAAAAAGG + Intergenic
1017368942 6:153681707-153681729 GCAATAGTCTTTAACTGAAATGG + Intergenic
1017859916 6:158386672-158386694 ACCATAGTGTTTAAGTACAGAGG + Intronic
1018281691 6:162192997-162193019 TCACTACTCTTTAAGAAAAAGGG - Intronic
1020363012 7:7350042-7350064 TCCATATTCTTTAAGATAAAGGG - Intergenic
1020547333 7:9549577-9549599 TCAATAGTCTTTAAGTTCAATGG + Intergenic
1020553518 7:9639315-9639337 TAAATGGTTTTTAAGTAAAAAGG + Intergenic
1020983629 7:15104377-15104399 TTCATATCCTATAAGTAAAAAGG - Intergenic
1026327357 7:69322343-69322365 ACCATATTCTTAAAGTCAAAAGG + Intergenic
1026328360 7:69330647-69330669 TCCTCAGTCTTTAACTTAAAAGG + Intergenic
1027482866 7:78720706-78720728 TCCATGGACTTTGAATAAAATGG - Intronic
1027714810 7:81656804-81656826 TCCACATTCTTTAAGTTAATTGG - Intergenic
1027848917 7:83424049-83424071 ACCATTCTCTTTATGTAAAAAGG + Intronic
1028362707 7:89988191-89988213 TCCAAACTCTTTATGTAAAAGGG + Intergenic
1028799848 7:94950005-94950027 TTCATAATTTTTAGGTAAAAGGG - Intronic
1030678617 7:112410455-112410477 TCTTTAGTATTTAAGAAAAAGGG - Intergenic
1031161699 7:118176588-118176610 TCCATAGTCTGAAAGAAAAAGGG + Intergenic
1031382298 7:121102067-121102089 TACATAGTTTTTAAGTGAAGGGG - Intronic
1031884185 7:127228741-127228763 TCCATGGTTTTCAAATAAAATGG - Intronic
1033509570 7:142041560-142041582 TCCAAAGTCTTTCATTAATAGGG + Intronic
1033512411 7:142072157-142072179 TCCAAAGTCTTTCATTAATAGGG + Intronic
1033846396 7:145437777-145437799 TCATTAGTCTTTATTTAAAATGG - Intergenic
1033862847 7:145650107-145650129 CCACTAGACTTTAAGTAAAATGG - Intergenic
1034325740 7:150230449-150230471 TCCATGGCCTGTTAGTAAAAGGG + Intergenic
1034767465 7:153738810-153738832 TCCATGGCCTGTTAGTAAAAGGG - Intergenic
1037398132 8:18464990-18465012 TCAATATTCTTAAAATAAAATGG - Intergenic
1041544955 8:59032650-59032672 TCCATGAGCTTTAAGTGAAATGG - Intronic
1043186179 8:77152915-77152937 TCTGTAGTCTTTGAGTAAAAGGG - Intergenic
1044480788 8:92685489-92685511 ACCATAGTCTTAAAAGAAAAAGG - Intergenic
1045384726 8:101660964-101660986 TAAATATTCTTGAAGTAAAAAGG - Intronic
1046342922 8:112882164-112882186 CCCAGAGTCTTTATGTCAAAAGG + Intronic
1046368366 8:113268645-113268667 TCCACAGTTTTAAAGTAAATGGG + Intronic
1047360666 8:124165928-124165950 TCTTTGGTCCTTAAGTAAAATGG + Intergenic
1050719581 9:8570952-8570974 TCAAGAGTGTTTAAGTATAATGG - Intronic
1051311667 9:15780879-15780901 TCTTTATTATTTAAGTAAAATGG - Intronic
1051379374 9:16439783-16439805 CACATATTCTTTATGTAAAATGG - Intronic
1051876656 9:21801486-21801508 TCTATACTGTTTAAGTAAATAGG + Intergenic
1052130689 9:24843129-24843151 TCCAGAGTCTTTAATTTAAAAGG - Intergenic
1052287036 9:26797803-26797825 GCCATAGTCTTAAAGTAGCAAGG + Intergenic
1053449114 9:38178769-38178791 TCCATGGACTTTGAGTAAAGCGG - Intergenic
1053638445 9:40040938-40040960 TGCAAAGTATTTTAGTAAAAGGG + Intergenic
1053767636 9:41424258-41424280 TGCAAAGTATTTTAGTAAAAGGG - Intergenic
1054319241 9:63637477-63637499 TGCAAAGTATTTTAGTAAAAGGG + Intergenic
1054546306 9:66335774-66335796 TGCAAAGTATTTTAGTAAAAGGG - Intergenic
1056170172 9:83978248-83978270 TCCATATTCTTTTATTAAACGGG + Exonic
1056263902 9:84877156-84877178 TCCTGAGTTTTTAAGTAAAGTGG + Intronic
1056290461 9:85138153-85138175 TCCTAAGTCTTCAAGTGAAATGG + Intergenic
1058312518 9:103521948-103521970 CCAATAGTCATTAAGTAGAATGG - Intergenic
1058998574 9:110324583-110324605 CTCAATGTCTTTAAGTAAAAAGG - Intronic
1059672472 9:116504440-116504462 TCAATGTCCTTTAAGTAAAATGG - Intronic
1059719453 9:116945418-116945440 TTCATAGCCTTTAGGTTAAAAGG - Intronic
1059739896 9:117139932-117139954 TACATAGTCGTTAAGTTAAAAGG + Intronic
1060350825 9:122858230-122858252 TCCATACACTTAAAATAAAAAGG + Intronic
1202786319 9_KI270719v1_random:24474-24496 TGCAAAGTATTTTAGTAAAAGGG + Intergenic
1186830549 X:13385871-13385893 TTCATAGTCTTTAAAAAATATGG - Intergenic
1187322107 X:18249204-18249226 TCCAAAGTGTTTAAGAAAAATGG + Intronic
1189252154 X:39609488-39609510 TCCAAAGGCTTCAAGTAAAGGGG + Intergenic
1191840122 X:65507348-65507370 TGCATAGTCTTCAACTGAAATGG + Exonic
1192246237 X:69373948-69373970 CACATAGTCTATAAGCAAAAGGG - Intergenic
1194104112 X:89747204-89747226 TCTATAGTCTTTAGGGAAATAGG + Intergenic
1196491688 X:116274838-116274860 TCTATTGTTTTTAAATAAAAAGG - Intergenic
1197088814 X:122511529-122511551 TCCATGGTCTTTAAAGTAAATGG + Intergenic
1197570082 X:128138905-128138927 TCAATATTCTTTAAGAAAATAGG - Intergenic
1198303849 X:135360298-135360320 TACATAGTCTTTTTGCAAAATGG - Exonic
1200456068 Y:3395013-3395035 TCTATAGTCTTTAGGGAAATAGG + Intergenic