ID: 1014601929

View in Genome Browser
Species Human (GRCh38)
Location 6:123423924-123423946
Sequence GGTCATGGGCCCACACTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014601921_1014601929 20 Left 1014601921 6:123423881-123423903 CCTTTTTACTTAAAGACTATGGA 0: 1
1: 0
2: 0
3: 22
4: 244
Right 1014601929 6:123423924-123423946 GGTCATGGGCCCACACTCATGGG No data
1014601919_1014601929 28 Left 1014601919 6:123423873-123423895 CCTTTTTTCCTTTTTACTTAAAG 0: 1
1: 0
2: 15
3: 130
4: 1311
Right 1014601929 6:123423924-123423946 GGTCATGGGCCCACACTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014601929 Original CRISPR GGTCATGGGCCCACACTCAT GGG Intronic
No off target data available for this crispr