ID: 1014602026

View in Genome Browser
Species Human (GRCh38)
Location 6:123425075-123425097
Sequence ATTTCAAAGGTGAAAGTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014602022_1014602026 30 Left 1014602022 6:123425022-123425044 CCAGAACTGAGGTGGTTCATAAA 0: 1
1: 0
2: 3
3: 6
4: 93
Right 1014602026 6:123425075-123425097 ATTTCAAAGGTGAAAGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014602026 Original CRISPR ATTTCAAAGGTGAAAGTGAG AGG Intronic
No off target data available for this crispr