ID: 1014612929

View in Genome Browser
Species Human (GRCh38)
Location 6:123567100-123567122
Sequence TTCAGTCAATGCAAGCTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 6, 3: 14, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014612925_1014612929 13 Left 1014612925 6:123567064-123567086 CCTATGTTACTGGCATTTCATCT 0: 1
1: 0
2: 1
3: 25
4: 185
Right 1014612929 6:123567100-123567122 TTCAGTCAATGCAAGCTCAAGGG 0: 1
1: 0
2: 6
3: 14
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014612929 Original CRISPR TTCAGTCAATGCAAGCTCAA GGG Intronic
900783075 1:4630536-4630558 TTCAGTCAATACATGCGCACTGG - Intergenic
904919574 1:33996547-33996569 TCCAGTCCATGCAAGCTCCTGGG - Intronic
908189042 1:61682217-61682239 TTCAGTCAACTCTATCTCAAAGG - Intronic
909971897 1:82000854-82000876 GTCAGTTTATGCAAGGTCAAAGG - Intergenic
912877668 1:113378476-113378498 TTCAGTCAATACTCCCTCAAAGG + Intergenic
913126399 1:115794353-115794375 CTCATACACTGCAAGCTCAATGG - Intergenic
917005069 1:170406015-170406037 TCCAGTCACTGCTGGCTCAAAGG + Intergenic
923040551 1:230317173-230317195 TTCAGTCATGGCACCCTCAAGGG + Intergenic
923749751 1:236736647-236736669 TTCAGTGAATTCAAGTGCAATGG + Intronic
923841252 1:237672967-237672989 TTCAGTCAAAGCCAGCACTAGGG + Intronic
1063778264 10:9289748-9289770 ATGAGTGAATGCATGCTCAATGG + Intergenic
1066389097 10:34964453-34964475 GTCAGTCAAAGCAAGCGCACTGG + Intergenic
1066756880 10:38720606-38720628 TTCAGTCAAGGCAGGGTCAAGGG + Intergenic
1067509346 10:46882455-46882477 TTCCCTCAATGTAAGCTCCAAGG - Intergenic
1067652907 10:48169400-48169422 TTCCCTCAATGTAAGCTCCAAGG + Intronic
1070879106 10:79843242-79843264 TTCAGTTATTGGGAGCTCAAAGG + Intronic
1071632213 10:87227332-87227354 TTCAGTCATTGGGAGCTCAAAGG + Intronic
1071645666 10:87359551-87359573 TTCAGTCATTGGGAGCTCAAAGG + Intronic
1074617362 10:115082754-115082776 TTGAGTCATTGCATCCTCAAAGG + Intergenic
1075386741 10:122060589-122060611 CTCAGTCCATGCACTCTCAATGG - Intronic
1078502518 11:11895451-11895473 TTAAGGAAATGCAAACTCAATGG - Intronic
1078793291 11:14566692-14566714 TTCAGTGAATGAAAGCTCAAAGG + Intronic
1086908942 11:92449970-92449992 TTCAGAAAAAGCAAGTTCAATGG - Intronic
1089073050 11:115716196-115716218 GTCAGTCAATGCCAGCTCCTGGG + Intergenic
1092025342 12:5234880-5234902 TTCAGTCTAGGGAATCTCAAAGG + Intergenic
1095874443 12:47065171-47065193 TTCAGTAAATGCCAGGTTAATGG - Intergenic
1099371876 12:81843556-81843578 TTTAGTTAATGCATGTTCAATGG - Intergenic
1101085328 12:101229949-101229971 TTCAGTAAATGGAAGGTCATAGG + Intergenic
1101698254 12:107147272-107147294 GTAAATCATTGCAAGCTCAATGG - Intergenic
1103318960 12:120079329-120079351 TTCAGACACTTCAAGATCAAGGG + Intronic
1104740330 12:131167293-131167315 TCCAGTCTCTGCAAGCTGAAGGG - Intergenic
1104791879 12:131488144-131488166 TCCAGTCTCTGCAAGCTGAAGGG + Intergenic
1105361028 13:19716461-19716483 TTGAGTGAATGCAATCTTAATGG + Intronic
1105877063 13:24565780-24565802 TTGAGTGAATGCAATCTTAATGG + Intergenic
1106916811 13:34524613-34524635 TTCAGTCATAGCAACCTCCAAGG + Intergenic
1107681895 13:42860665-42860687 TTCAGTCAAAGCAAAATGAAAGG - Intergenic
1109361085 13:61295661-61295683 TTCAGTCAGTTCTAGCTAAAAGG - Intergenic
1109743274 13:66584540-66584562 TTCAGTTACTTCAAGATCAATGG + Intronic
1110004681 13:70251201-70251223 TTCAATGAATGCAAGCCCCAGGG + Intergenic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1112560732 13:100511542-100511564 CTCAGTCAATACCAACTCAAGGG - Intronic
1118793815 14:69121184-69121206 TTCAGGCACTGTAGGCTCAATGG + Intronic
1120474087 14:84965007-84965029 ATAAGACAATGCAAGCTTAAGGG - Intergenic
1126132440 15:45354934-45354956 TTAACTCAATGCAAGAGCAAAGG - Intergenic
1126576921 15:50206373-50206395 TTCAGTCAGTTTAAACTCAAAGG + Intronic
1126718613 15:51551564-51551586 TTCACTCTAAGCAAACTCAAGGG + Intronic
1126960822 15:53992216-53992238 TTCAGTCAGTGCTACATCAATGG - Intergenic
1127625146 15:60773025-60773047 TTTAGTCAAAGAAAGCTAAATGG - Intronic
1128579333 15:68797892-68797914 TTCAGTAAATGCTTGCTGAATGG + Intronic
1130847944 15:87765031-87765053 TTTAGTCAGTGCAAACTCTAAGG + Intergenic
1136725699 16:32355524-32355546 TTCAGTCAAGGCAGGCTCGAGGG - Intergenic
1136844031 16:33561575-33561597 TTCAGTCAAGGCAGGCTCAAGGG - Intergenic
1203000731 16_KI270728v1_random:162230-162252 TTCAGTCAAGGCAGGCTCGAGGG + Intergenic
1203132334 16_KI270728v1_random:1698635-1698657 TTCAGTCAAGGCAGGCTCGAGGG + Intergenic
1203154196 16_KI270728v1_random:1861874-1861896 TTCAGTCAAGGCAGGCTCAAGGG - Intergenic
1146281019 17:31544611-31544633 TTTAGTCAAAGCAAGCCCCATGG + Intergenic
1149383168 17:56114776-56114798 GACAGCCAATGCAATCTCAAGGG + Intronic
1151093227 17:71466374-71466396 CTAACTCAATGAAAGCTCAATGG + Intergenic
1153916719 18:9752167-9752189 ATCAGTCAATGCAAGCACGGTGG - Intronic
1156737399 18:40277207-40277229 TTCAGTCAATTAAATCACAAAGG - Intergenic
1157136121 18:45057428-45057450 ATCAGCAAATACAAGCTCAATGG - Intronic
1157909434 18:51601546-51601568 ATCAGTTAATGAAAGCTAAAAGG - Intergenic
1158134059 18:54186800-54186822 TCCTGTCTATGCAAGCTAAAAGG + Intronic
1158851961 18:61503533-61503555 ATCAGTGAATGCATTCTCAATGG - Intronic
1164827354 19:31293457-31293479 ATCAATCAAGGCAAGATCAAAGG - Intronic
1166211815 19:41311311-41311333 TTAGGTCACTGCAATCTCAAAGG - Intronic
1168546279 19:57253109-57253131 TTCAGACAAGGCTAGCTCACAGG - Exonic
927406095 2:22769332-22769354 TTCATTCAAAAGAAGCTCAAAGG + Intergenic
928142175 2:28739341-28739363 TTCTGGCAATCCCAGCTCAAAGG + Intergenic
930666588 2:54105215-54105237 TTCAGTCAAGGCAAGGAGAAAGG - Intronic
932455555 2:71847327-71847349 TTCAGTCAAAGCAAGCCACATGG - Intergenic
934320184 2:91965050-91965072 TTCAGTCAAGGCAGGCTCAAGGG + Intergenic
937028607 2:118719658-118719680 GTCAGAAAATCCAAGCTCAATGG + Intergenic
941975002 2:171394031-171394053 TCCAGTAAATGCAAGCTCTTTGG + Intronic
942003190 2:171671299-171671321 TGCAGTCAATGAAATCACAAGGG + Intergenic
947280502 2:228447569-228447591 TGCAGACAATGCTAGCTCAGAGG + Intergenic
1170904929 20:20505621-20505643 CTCAGTAAATGTAAGCTCAGTGG - Intronic
1171157305 20:22887831-22887853 TTGAGTCAGTCCAAGCTCTAAGG - Intergenic
1174104272 20:48151066-48151088 TTCTGTAAATGAAAGCTCGAAGG - Intergenic
1177299837 21:19228480-19228502 TTAAGTGAATGCAATCTCAGTGG + Intergenic
1177583260 21:23055734-23055756 TTTACTCAAAGCAAGATCAAAGG - Intergenic
1179350547 21:40606707-40606729 TTCATTCCATGGAAGCTAAAAGG - Intronic
1180308436 22:11149104-11149126 TTCAGTCAAGGCAGGCTCAAGGG + Intergenic
1180546913 22:16510917-16510939 TTCAGTCAAGGCAGGCTCAAGGG + Intergenic
1183724813 22:39582666-39582688 TTCAGTAAATGTTAGCTCCAGGG - Intronic
1184313474 22:43664312-43664334 TTCATTCAATACATGCTCACTGG + Intronic
949228986 3:1728560-1728582 TTCATTAAATGTTAGCTCAAAGG + Intergenic
953017540 3:39092573-39092595 TTTAGTCACTGCACGCTCTATGG - Intronic
955479929 3:59379307-59379329 TTCAGTCTTTGCAAAGTCAAAGG + Intergenic
969169163 4:5345962-5345984 ATCAGTTCATGCAAACTCAATGG - Intronic
970118474 4:12725896-12725918 TTCAGAGAATGCAAACTCATAGG - Intergenic
971695430 4:29896236-29896258 TTGAGTCTATGCAAGTTCCAAGG - Intergenic
971871586 4:32247095-32247117 TTCACTCAATCCTAGCTAAAAGG - Intergenic
972199485 4:36696857-36696879 TTCAGTCAAAGGAAGCAGAATGG - Intergenic
972701226 4:41496005-41496027 TTCAGTGGATGCAAGCTCAGTGG + Intronic
974846930 4:67362918-67362940 TTCAGTCAATGTTTGGTCAAAGG + Intergenic
976840102 4:89422410-89422432 TTCTGTTAATGCAAGCAGAAAGG + Intergenic
976894361 4:90090690-90090712 CTCATTCATTGAAAGCTCAAAGG + Intergenic
978711566 4:111788718-111788740 TTCAGGAAATGCAAGTGCAAAGG + Intergenic
979292742 4:118996238-118996260 TTCAGTCACTGCAACCAGAAAGG - Intronic
981451555 4:144904136-144904158 TTCAGTCATTGGGAGCTCCATGG - Intergenic
982472863 4:155815247-155815269 TGCAGTCACTGCAAGTTCAATGG + Intergenic
982622351 4:157724020-157724042 TTCAGAGGATGCAAGCTCCAAGG + Intergenic
983669477 4:170218754-170218776 TTCAGGTACTGGAAGCTCAAAGG + Intergenic
988172100 5:27671590-27671612 TTCATAAAATGCAAGCTCACTGG + Intergenic
989396511 5:40962887-40962909 TTCAGTGAATGCATGTTCAAGGG - Intronic
990348165 5:54889467-54889489 GTCAGTCCATGCAGGCTCCATGG + Intergenic
991624648 5:68587576-68587598 TTCTTTCAATGGAAGCTCCATGG + Intergenic
992869809 5:80994673-80994695 ATCAGTGAATACAAGCTCAGAGG - Intronic
997043145 5:130280795-130280817 TTCTGTCACTGCAACCTGAATGG + Intergenic
1002125128 5:177037373-177037395 GTCAGTCACTTGAAGCTCAAGGG - Intronic
1004287533 6:14336234-14336256 TTCTGTGAATGGAAGCTCCATGG - Intergenic
1013591876 6:111625751-111625773 TTCAGTCAATGAATGCTGACTGG + Intergenic
1014612929 6:123567100-123567122 TTCAGTCAATGCAAGCTCAAGGG + Intronic
1016492144 6:144617617-144617639 TTCACTCAATGCAATCCCAAGGG - Intronic
1016572876 6:145534579-145534601 TTCAGTCAATGCAAGCACGGGGG + Intronic
1017787355 6:157767647-157767669 TGCATTCAATGCAAGTTAAACGG + Intronic
1023966498 7:44965588-44965610 TTCAGTGGATGCCAGCTGAATGG + Intronic
1027989614 7:85341016-85341038 TTCAGTAGATGCAAGCTCAGTGG - Intergenic
1028994421 7:97084638-97084660 TTCACTAAATACAAGCTAAATGG - Intergenic
1034029803 7:147748275-147748297 TTAAGTCACTCCAAGGTCAATGG + Intronic
1038458531 8:27695341-27695363 TACAGTCAAGACAAGTTCAAGGG + Intergenic
1039790489 8:40872112-40872134 CTCAGTCAGTGCAACCTCAGAGG - Intronic
1041188562 8:55328747-55328769 TGCAGGCAGTGCAAGCACAAGGG - Intronic
1041497678 8:58504755-58504777 TTGAATGAATGCTAGCTCAATGG + Intergenic
1041531274 8:58870475-58870497 TAGAGTCAATGCAATCTCAATGG + Intronic
1042996996 8:74711645-74711667 TCCAGTCAATGAGAGCTCATGGG + Intronic
1044869057 8:96600733-96600755 TTCAGTCACTGCAAGGTCACAGG + Intronic
1047366337 8:124215161-124215183 TGAAGCCAGTGCAAGCTCAAAGG - Intergenic
1047578758 8:126188883-126188905 TTCGGTCAGTGCAAGGTCTAAGG - Intergenic
1048116891 8:131533274-131533296 TTCAGTCAAAGTATGCTCACAGG + Intergenic
1052380947 9:27770383-27770405 TTCAGTTAATGAAAACTCATGGG + Intergenic
1052951392 9:34215840-34215862 TTCAGTCTCTCAAAGCTCAAAGG - Intronic
1055385339 9:75756103-75756125 TTCAGTCATTGCCACCTCCAAGG + Intergenic
1056231909 9:84555372-84555394 TTGAGTTAATGAAAGCTGAAAGG - Intergenic
1057355390 9:94327471-94327493 TTCAGTTACTGGGAGCTCAAAGG - Intronic
1057652365 9:96930151-96930173 TTCAGTTACTGGGAGCTCAAAGG + Intronic
1059738082 9:117122329-117122351 TTAGGTCCAAGCAAGCTCAAGGG + Intronic
1062311509 9:135940202-135940224 GTCAGTAAGTGCAATCTCAACGG + Intronic
1186154252 X:6709170-6709192 CACAGGCAATGCAATCTCAATGG - Intergenic
1187192991 X:17054464-17054486 TTCAGTAAATGCAGGCTGCATGG - Intronic
1189263851 X:39698720-39698742 TTTAGTAAATGGCAGCTCAAAGG + Intergenic