ID: 1014612943

View in Genome Browser
Species Human (GRCh38)
Location 6:123567358-123567380
Sequence GCCAGCATACCATTGGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 53}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014612943_1014612945 7 Left 1014612943 6:123567358-123567380 CCAGCTACCAATGGTATGCTGGC 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1014612945 6:123567388-123567410 ACTCAATCACACCTTGTATTAGG No data
1014612943_1014612946 16 Left 1014612943 6:123567358-123567380 CCAGCTACCAATGGTATGCTGGC 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1014612946 6:123567397-123567419 CACCTTGTATTAGGTTGTTCCGG 0: 1
1: 0
2: 0
3: 20
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014612943 Original CRISPR GCCAGCATACCATTGGTAGC TGG (reversed) Intronic
900533236 1:3164988-3165010 GCCAGCCTACCATTGGAACACGG - Intronic
902328604 1:15719055-15719077 GCCAGCATCCCATTTGTACAGGG - Intronic
904643808 1:31950704-31950726 GCTTGGATACCTTTGGTAGCTGG - Intergenic
904765902 1:32846328-32846350 GAGAGCATATAATTGGTAGCTGG + Intronic
904778788 1:32929150-32929172 GCCAGCAAACCATCAGAAGCTGG - Intergenic
910164342 1:84308398-84308420 GCTGGCATATCATTGGTAGAAGG - Intronic
915845128 1:159254815-159254837 GACAGCATACCATTGGCATTAGG - Intergenic
916945855 1:169726773-169726795 TCCAACATTCCCTTGGTAGCTGG - Exonic
917960129 1:180135829-180135851 TCCAGCACACCATTGGTAAGTGG + Intergenic
919453371 1:197797153-197797175 GACAGCATACCATTGGGTCCTGG + Intergenic
924660484 1:246011947-246011969 ACCAGCAAGCAATTGGTAGCTGG - Intronic
924660489 1:246012000-246012022 ACCAGCAAGCAATTGGTAGCTGG - Intronic
1070619177 10:77993909-77993931 GCCACCATAGCATTGCTGGCTGG - Intronic
1073882705 10:108001975-108001997 GCCAGCAACCCAGTGGAAGCTGG - Intergenic
1075289730 10:121218213-121218235 GCCAGCATCACACTGATAGCAGG + Intergenic
1075899923 10:126033276-126033298 GCCAGCATACCATTGGCTAATGG + Intronic
1089161963 11:116445249-116445271 GCCAGCAGCCCAGAGGTAGCAGG - Intergenic
1097030883 12:56088473-56088495 GCAAGGGTTCCATTGGTAGCTGG + Intronic
1099184595 12:79503731-79503753 GCCAGAAAACGATGGGTAGCTGG - Intergenic
1106969212 13:35116255-35116277 ACCAGCATACCAATGGTTGACGG + Intronic
1114447303 14:22798861-22798883 GGCAGCATACCAGAGGTGGCAGG - Intronic
1114846260 14:26326290-26326312 GACAACATCCCATGGGTAGCAGG + Intergenic
1119430604 14:74565926-74565948 GCTAGCAGACAAGTGGTAGCAGG - Intronic
1119651885 14:76389664-76389686 TCCAGCACACCATTGGGACCAGG - Intronic
1129331171 15:74828109-74828131 GCCAGCTTACCTTGGGTAGCCGG - Exonic
1134830896 16:17321850-17321872 GCCACCATACCATTTGGGGCTGG - Intronic
1141581662 16:85003643-85003665 GCCAGCATATCATTGAGATCTGG - Intronic
1150480593 17:65506014-65506036 ACCAGCATACCACTGGTATCAGG - Intergenic
1159588055 18:70301120-70301142 GCCAGCATCCAACTGGTAGCTGG - Intronic
1165601379 19:37057942-37057964 GCCAGCATTCCAGTGACAGCAGG - Intronic
928605967 2:32945924-32945946 GCTAGTAGACAATTGGTAGCAGG - Intergenic
936033448 2:109090198-109090220 GACAGAGTACCATTGGCAGCAGG - Intergenic
936466033 2:112751235-112751257 GTCAGCATAACATTGGTACTAGG + Intronic
1168779045 20:473263-473285 GTCAGCTTACCATTGGCAGGTGG + Intergenic
1181120451 22:20664426-20664448 ACCAGCACATCATTGGTTGCTGG + Intergenic
954457429 3:50607481-50607503 GCCTGCATACCTCTGGCAGCTGG - Exonic
967332493 3:188305329-188305351 GTGAGCTTAACATTGGTAGCAGG + Intronic
984706410 4:182850333-182850355 GCCAGCAAGCCATGGGAAGCCGG + Intergenic
985910175 5:2873182-2873204 GCTAACATAGCATTGGAAGCTGG - Intergenic
986168675 5:5297665-5297687 GCCAGCATGCCATTTTTACCAGG - Intronic
994723215 5:103404089-103404111 GCCAGCCTGCCATTCATAGCAGG - Intergenic
996867216 5:128138674-128138696 GCCAGAATACCAGTTGCAGCAGG - Exonic
996951239 5:129128375-129128397 GCTACCATAGCTTTGGTAGCAGG - Intergenic
997669239 5:135656811-135656833 GCCAGCAAAACACTGGAAGCTGG + Intergenic
998169291 5:139863026-139863048 CCCCGCATACCAGTTGTAGCTGG + Intronic
1001192122 5:169641003-169641025 GCCAGCAAACCACTGGCAGCTGG - Intronic
1005252897 6:23967661-23967683 GCCAGCAGTCCATTTGTATCTGG - Intergenic
1013186589 6:107764631-107764653 GCCAGTATTCCATGGGTACCAGG + Intronic
1014612943 6:123567358-123567380 GCCAGCATACCATTGGTAGCTGG - Intronic
1015170100 6:130242850-130242872 GCCGGCATCCCTTTGATAGCTGG + Intronic
1015350067 6:132208130-132208152 GCTATCATAACATTGTTAGCTGG + Intergenic
1023752297 7:43384338-43384360 TCCAGCAACCCATGGGTAGCAGG + Intronic
1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG + Intergenic
1037578926 8:20233270-20233292 GCCAGCAAACCACTGGAATCTGG + Intergenic
1044079436 8:87865568-87865590 ACCAGCACACCATTGACAGCAGG + Intergenic
1049349255 8:142155199-142155221 GCCTGCACACCGTTGGTAGTTGG + Intergenic
1053241608 9:36500130-36500152 GCCAGCAAACCACTAGGAGCAGG - Intergenic
1057057450 9:91974560-91974582 GCCAGCAAACCACTAGAAGCTGG + Intergenic