ID: 1014613117

View in Genome Browser
Species Human (GRCh38)
Location 6:123568561-123568583
Sequence GCAGAGTGCAAGAGTTAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 1, 2: 10, 3: 73, 4: 311}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014613117_1014613122 22 Left 1014613117 6:123568561-123568583 CCTCTTTAACTCTTGCACTCTGC 0: 1
1: 1
2: 10
3: 73
4: 311
Right 1014613122 6:123568606-123568628 ATGAAAGGCACCAAGGCTTATGG No data
1014613117_1014613120 7 Left 1014613117 6:123568561-123568583 CCTCTTTAACTCTTGCACTCTGC 0: 1
1: 1
2: 10
3: 73
4: 311
Right 1014613120 6:123568591-123568613 CAGGCTTAACATCACATGAAAGG 0: 1
1: 3
2: 6
3: 26
4: 99
1014613117_1014613121 15 Left 1014613117 6:123568561-123568583 CCTCTTTAACTCTTGCACTCTGC 0: 1
1: 1
2: 10
3: 73
4: 311
Right 1014613121 6:123568599-123568621 ACATCACATGAAAGGCACCAAGG 0: 1
1: 3
2: 30
3: 275
4: 713

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014613117 Original CRISPR GCAGAGTGCAAGAGTTAAAG AGG (reversed) Intronic
901335272 1:8443850-8443872 ACAGAGTGCAAGAGTGATGGAGG + Intronic
902569900 1:17340598-17340620 GGAATGTGCAAGGGTTAAAGTGG + Intronic
906692798 1:47803874-47803896 GCAGAGTGCAGAAGTTGTAGGGG - Intronic
909364083 1:74799222-74799244 ACAGAATGCAAGAGTGAAAGAGG - Intergenic
909913863 1:81293681-81293703 GCAAAGTGCAAGAGTGAAGCAGG - Intergenic
910497154 1:87843165-87843187 CCAGAGTGCTAGAGTTACAAGGG + Intergenic
911256935 1:95644118-95644140 GCAGAGGGCCAGAGTCAAAGAGG - Intergenic
912590374 1:110812876-110812898 GCAGTGAACAAGAGTTTAAGTGG + Intergenic
913973348 1:143433777-143433799 ACAGAATTCAAGAGGTAAAGGGG - Intergenic
914067735 1:144259384-144259406 ACAGAATTCAAGAGGTAAAGGGG - Intergenic
914111420 1:144706970-144706992 ACAGAATTCAAGAGGTAAAGGGG + Intergenic
915927650 1:160036057-160036079 GCATAGTGTAAGAGTTAAGAAGG + Intergenic
916288022 1:163132345-163132367 GCAGAATGCAACAGTGAAGGAGG + Intronic
916442932 1:164845347-164845369 GGAGTATGCAAGAGTTGAAGTGG + Intronic
916507893 1:165444488-165444510 GAAAAGTGGAAGAGTTAACGGGG - Intronic
917002489 1:170375070-170375092 ACAGTGTGCAAGAGTAAATGAGG - Intergenic
917685565 1:177412297-177412319 GCAAAGTGGAAGAGGGAAAGGGG - Intergenic
918153400 1:181818746-181818768 GCAGAGTTCAAAAGCTCAAGGGG + Intergenic
918376888 1:183918305-183918327 GCAGAATGCAAGTGGTAATGAGG + Intronic
919055985 1:192570070-192570092 AGAGAGTGCAAGAGTGAATGAGG - Intergenic
919495963 1:198268351-198268373 CCAGAGTGCACGAGATAAACTGG - Intronic
920448656 1:206039897-206039919 GCTGAGTGCAACAGATTAAGGGG + Intronic
920900492 1:210105854-210105876 GAAGAGAGCAAGAGTGAGAGAGG - Intronic
921372981 1:214444619-214444641 GCAGATTGCAGGAGTCTAAGGGG + Intronic
921728870 1:218554417-218554439 GAAGAGTGCAAGAGAGAAAATGG - Intergenic
923097142 1:230784625-230784647 ACAGAGTGCAAGACTGAATGAGG + Intronic
923126246 1:231037109-231037131 GCAGACTGCAATGGTTAAATAGG + Intronic
923139831 1:231151771-231151793 ACAGAATGCAGGAGTTAAGGAGG - Intergenic
923425024 1:233860136-233860158 GCAGAGGGAAAGAGTGAAAATGG + Intergenic
924389466 1:243537082-243537104 GCATCGTGCCAGAGTTGAAGTGG - Intronic
1063679848 10:8176584-8176606 ACAGAGTGCAAGAGTTTAGAAGG - Intergenic
1064576076 10:16747673-16747695 GCAGAGGGCAAGGGTGGAAGTGG - Intronic
1066012629 10:31208944-31208966 GCAGGGTGCCAGAGTGAAATGGG + Intergenic
1066242113 10:33548091-33548113 GCAGAGTGCAGGTGGTAATGAGG + Intergenic
1066996672 10:42570531-42570553 ACAGAATGCAAGAGTGAATGAGG + Intergenic
1069380851 10:67842118-67842140 TCAGAATGCAAGAGTGAAGGAGG + Intergenic
1069665642 10:70155405-70155427 GCAGAGTTAAAGAGATAAAGAGG + Intronic
1069805029 10:71116850-71116872 ACAGAATGCAAGAGTTAAGGAGG + Intergenic
1071054158 10:81489871-81489893 ACATAGTACAAGAGATAAAGAGG + Intergenic
1072203329 10:93180521-93180543 GCAGGGTGCTAGAGTCAATGCGG + Intergenic
1073049401 10:100657759-100657781 GCAGGGTGCAAGAATCACAGAGG + Intergenic
1073352769 10:102831617-102831639 CCAGAGTGGAAGAGGAAAAGTGG + Intronic
1074018433 10:109559572-109559594 GAAGAATGCAAGAGTTCTAGGGG - Intergenic
1074131513 10:110582618-110582640 GCAGGATGCAAGAGATAAAATGG + Exonic
1074927169 10:118085107-118085129 GCAGAATGCAACAGTGAAGGAGG - Intergenic
1076236551 10:128868093-128868115 GCAGAGGGCAAGAGGGAAGGTGG + Intergenic
1077353950 11:2106101-2106123 CCAGAGTGCAAGAGGAGAAGTGG - Intergenic
1077516626 11:3006000-3006022 GCAGAGTGGAAGAGTGGAATTGG + Intronic
1077545376 11:3166973-3166995 GCAGAGGTCAAAAGTCAAAGAGG + Intergenic
1077941538 11:6848603-6848625 ACACAGTACAAGAGTGAAAGAGG + Intergenic
1078263498 11:9734356-9734378 GCAGAGTTTAAAAGTTAAAAAGG - Intronic
1078388883 11:10917791-10917813 GCAGAATGTAAGAGTGAAGGAGG - Intergenic
1079772114 11:24475141-24475163 GCAGAAAGCAAGAGTAAAGGAGG - Intergenic
1080128926 11:28770399-28770421 GCAGAATGCAAGAGTTGTGGAGG + Intergenic
1081458211 11:43246364-43246386 CCAGAGTGCAAGAGTTGAGTTGG + Intergenic
1081970695 11:47196555-47196577 GCTGAGTGTAAGAATTAAACTGG + Intergenic
1082128116 11:48455920-48455942 ACAGAGTGCAAGAGTGAAGGTGG - Intergenic
1082249300 11:49961499-49961521 ACAGAGTGCAAGAGTGAAGGTGG + Intergenic
1082561664 11:54626848-54626870 ACAGAGTGCAAGAGTGAAGGTGG - Intergenic
1082663181 11:55940497-55940519 GCAAAGTCCAAGAATTAAATAGG - Intergenic
1082780501 11:57283990-57284012 GCAGAATGCAAGAGTGAAGGAGG + Intergenic
1082862372 11:57868440-57868462 GCAGAGTGCAAGAGTGAAGGAGG - Intergenic
1083099490 11:60288231-60288253 ACAGACTGCAAGAGTTGTAGGGG - Intronic
1084498681 11:69521376-69521398 GAATAGTGCAACAGTGAAAGAGG - Intergenic
1084925358 11:72507018-72507040 ACAGAGTGCAAGAGTGATTGAGG - Intergenic
1085851385 11:80124405-80124427 ACAGAGTGCAAGAGTTGTGGGGG + Intergenic
1085855742 11:80173699-80173721 GAAGACTGCAAGAGTGGAAGAGG - Intergenic
1086984367 11:93232375-93232397 GCAGAGAGCAAGAGGAAAACAGG + Intergenic
1087723109 11:101688915-101688937 GCAGAGTGAGTGAGTTAGAGTGG - Intronic
1088032024 11:105263127-105263149 GAAGAGTGGAAGAGATAATGTGG - Intergenic
1088528760 11:110785770-110785792 GCAGAGTACAACAGTGAAGGAGG + Intergenic
1089317881 11:117604657-117604679 GCAGAGAGCAAGATTCAACGAGG - Intronic
1089456687 11:118629906-118629928 GCAGCCTCCAAGACTTAAAGTGG - Intronic
1090319641 11:125831140-125831162 GCAGAATGCAAGAGTGAAGGAGG - Intergenic
1092061004 12:5550221-5550243 GGAGAGTGCAAGAGAGAGAGAGG - Intronic
1092886322 12:12927418-12927440 GCAGAATGCCAGAGTTTAACTGG + Intergenic
1093934578 12:24987175-24987197 GCAGAAAGCAAGAGTTGCAGAGG - Intergenic
1095838833 12:46669686-46669708 ACAGAATGCAAGAGTGAAGGAGG - Intergenic
1098904694 12:76149985-76150007 GCAGAGTGCAAGGGTTACAAAGG - Intergenic
1099990374 12:89714661-89714683 ACAGAGTGAAAGAGTGAAGGAGG - Intergenic
1100878944 12:98995006-98995028 TCTGAGTGAATGAGTTAAAGAGG + Intronic
1101573050 12:105972813-105972835 GCATAGTGCAGGTGTTAGAGGGG - Intergenic
1103235540 12:119369446-119369468 GCAGAGTGCCAGAGATTCAGAGG + Intronic
1103756766 12:123213873-123213895 GAAGTGTGCAAGAGTGGAAGTGG + Intronic
1104149710 12:126070874-126070896 GCTGAGGGCCAGAGGTAAAGAGG + Intergenic
1106470282 13:30048201-30048223 GCTGTGTGCTAGAGTTAAGGTGG - Intergenic
1106718458 13:32415839-32415861 TGGGAGTGCCAGAGTTAAAGTGG - Intronic
1107119546 13:36781522-36781544 TCAGAGTGCAAGAGTGAAGGCGG - Intergenic
1108494389 13:51009308-51009330 TAAGAGTGCAGCAGTTAAAGGGG + Intergenic
1108921219 13:55676678-55676700 GCTGAGTGTGAGAGTTCAAGAGG + Intergenic
1110635811 13:77766120-77766142 ACAGAATGCAAGAGTGAAGGAGG - Intergenic
1110920252 13:81075336-81075358 TCAGTGTGCAACAGTTAAATTGG + Intergenic
1112067878 13:95813980-95814002 GCAGAGTGCAAGAGTGAATGAGG + Intronic
1114082192 14:19210902-19210924 GCAAAGTGCAAGAGTGAAGGAGG + Intergenic
1114431623 14:22666407-22666429 ACAGAATGCAAGAGTAAAGGAGG - Intergenic
1114495803 14:23131352-23131374 GCAGACTGCAAGGGTAACAGGGG + Intronic
1114619113 14:24084447-24084469 ACAGAGAGCAGGTGTTAAAGAGG + Intronic
1114688217 14:24555193-24555215 GCAGAGTGCAAGAACGAAGGAGG + Intergenic
1114756024 14:25261059-25261081 GTAGATTGTAAGAGTTAAAGTGG + Intergenic
1114927522 14:27422327-27422349 ACAGAGTGCAAGAATGAAGGAGG - Intergenic
1115889648 14:38012412-38012434 ACAAAATGCAAGAGTAAAAGAGG + Intronic
1116439848 14:44939028-44939050 GCAGACTACAAGAGTTATGGGGG - Intronic
1116702757 14:48261264-48261286 GCAGAGTGAAATATTTTAAGTGG + Intergenic
1117157218 14:52952195-52952217 ACAGAGTACAACAGTTAATGGGG - Intronic
1117209560 14:53481470-53481492 GCAGAGTGCCAGAGTGAAGGAGG - Intergenic
1118554907 14:67007518-67007540 GCACAGTTCAAGAGTTCAAAGGG + Intronic
1118755272 14:68838577-68838599 ACAGAGTGCAAAAGTAAAGGAGG + Intergenic
1119027909 14:71168309-71168331 GCAAAGAGCAAGTGTGAAAGGGG - Intergenic
1120437044 14:84495054-84495076 ACAGAGTGCAGGAGTTAAGGAGG + Intergenic
1120950787 14:90039999-90040021 GCTAAGTTCTAGAGTTAAAGAGG + Intronic
1121424170 14:93836474-93836496 GCAGAGTGAAAGAGTGAAGCAGG + Intergenic
1121596472 14:95167281-95167303 ACAGAATGCAAGAGTGAAGGAGG + Intergenic
1121629117 14:95409772-95409794 GCAGAGGCCCAGAGTCAAAGAGG - Intronic
1121840520 14:97130112-97130134 GCAGAGGGCAAGAGAGAGAGAGG - Intergenic
1122309480 14:100785465-100785487 GGTGATTGCAACAGTTAAAGGGG - Intergenic
1122335756 14:100980506-100980528 GCAGAAAGCAAGAATTATAGAGG + Intergenic
1123073920 14:105656814-105656836 CCAGAATGCAAGAGTGAAGGAGG + Intergenic
1123099691 14:105788311-105788333 GCAGAATACAAGAGTGAAGGAGG + Intergenic
1123161419 14:106282030-106282052 GCAGAATGCAAGAGTGAAGGAGG + Intergenic
1123177169 14:106430960-106430982 GCAGAATGCAACAGTGAAGGAGG - Intergenic
1123179402 14:106454212-106454234 GCAGAATGCAAGAGTGAAGGAGG - Intergenic
1124663171 15:31567899-31567921 GTAGAATGCAAGAGTGAATGAGG + Intronic
1126400712 15:48266905-48266927 GAAGAGTGGAAGAGATTAAGAGG - Intronic
1127692983 15:61415696-61415718 GCAGAGTGCAATAGTAAAGGAGG - Intergenic
1129204830 15:74030849-74030871 GCACACTTCAAGAGTTAAAATGG - Intronic
1130393463 15:83480194-83480216 GAAGGGTGATAGAGTTAAAGAGG - Intronic
1130405389 15:83596118-83596140 GAAGAAACCAAGAGTTAAAGAGG - Intronic
1131459877 15:92610494-92610516 TCAGACTGAAAGAGTGAAAGGGG + Intergenic
1136296912 16:29309047-29309069 GCAGAGGGCATGAGCTGAAGGGG - Intergenic
1137952339 16:52795682-52795704 CCAGGGTACAAGAGTGAAAGGGG + Intergenic
1138530784 16:57633230-57633252 GCACAGTGCATGACTTCAAGAGG + Intronic
1139242204 16:65404575-65404597 TCAGAGTGCAAGAGGTGAAATGG - Intergenic
1140274323 16:73495297-73495319 GCAGAGGGCATGATTTAAAATGG - Intergenic
1143778079 17:9212592-9212614 CCAGGGTGAAAGAGTTTAAGGGG - Intronic
1144368821 17:14570538-14570560 TCAGAATGCAAGAGTAAATGAGG - Intergenic
1144717918 17:17447109-17447131 TCAGAGGGCAAGAGAGAAAGAGG + Intergenic
1144751803 17:17653869-17653891 ACAGAGTGCAAGAGTGAAGGAGG - Intergenic
1145024980 17:19461464-19461486 GCAGAGTACAACAGTGAATGAGG + Intergenic
1145036574 17:19544929-19544951 GCAGGTTGCAACAGTGAAAGAGG + Intronic
1145224154 17:21114008-21114030 GCAGATGGCAAGAGTGCAAGAGG - Intergenic
1147037878 17:37695312-37695334 ACAGAATGCAAGAGTGAAGGAGG + Intronic
1147198711 17:38785045-38785067 AAAGAGTGCCTGAGTTAAAGAGG + Intronic
1149175727 17:53867970-53867992 GCAGAATGCAAGAGTGAATCAGG - Intergenic
1151902032 17:77022669-77022691 ATAGAGTGCAAGAGTGAAGGAGG + Intergenic
1153206884 18:2712731-2712753 GAGCAGTGCAAGAGTGAAAGAGG - Intronic
1155939834 18:31792135-31792157 GCAGAGTGGAAGCATTAGAGTGG - Intergenic
1156154705 18:34287862-34287884 ACAGAGTGCAAAAGTAAAGGAGG - Intergenic
1156736244 18:40263212-40263234 ACAGAATGCAAGAGTGAAGGAGG + Intergenic
1157034343 18:43953240-43953262 ACAGAATACAAGAGTGAAAGAGG + Intergenic
1159601069 18:70429358-70429380 GCAGAGTTCAAAAGCTGAAGCGG - Intergenic
1159960229 18:74549941-74549963 ACAGAGTGCAAGAGTAAGGGAGG + Intronic
1160822396 19:1064619-1064641 GTAGAGTGCAAGGGCGAAAGAGG + Intronic
1163549806 19:17959758-17959780 CCCGAGTGAAAGAGTTCAAGAGG + Intronic
1164382912 19:27750588-27750610 GCAGAGTGAGAGAATTAAAAAGG - Intergenic
1164500466 19:28815240-28815262 GCAGAATGCAAGAGCTACGGAGG - Intergenic
1164552490 19:29223319-29223341 GGAGAGTGGAAGAGTTAGAGAGG - Intergenic
1164850915 19:31483471-31483493 ACAGAATGCAAGAGTGAAGGAGG - Intergenic
1165529503 19:36386321-36386343 GCAGAATGCAAGAGTCACGGGGG + Intronic
1166619714 19:44285273-44285295 GCTGAGTGAAGGAGTTTAAGAGG - Intronic
1166867772 19:45851168-45851190 GCTGAGTGCAAGAGTGGAAGCGG + Intronic
1167602936 19:50465083-50465105 CCAGAGTCCAAGGGTGAAAGTGG - Intronic
1168275736 19:55277368-55277390 CCAGAGTACAAGAGGGAAAGTGG - Intronic
925122504 2:1430333-1430355 ACAGAATGCAGGAGTTAAGGAGG + Intronic
925693702 2:6551897-6551919 GCAAAGTGCAAGAGCTGTAGAGG + Intergenic
926014033 2:9433095-9433117 GTGGACTGCAAGAGTGAAAGGGG + Intronic
926563682 2:14445642-14445664 ACAGAATGCAAGAGTGAAAGAGG - Intergenic
926618191 2:15020648-15020670 CCTGAGAGCAAGAGTGAAAGAGG + Intergenic
927822044 2:26275577-26275599 GCAAAGGGCAAGTGTAAAAGGGG - Intronic
928696328 2:33853433-33853455 ACAGAGTGCAAGAGTGAATAAGG - Intergenic
928852295 2:35763554-35763576 GTTGAGTGAAATAGTTAAAGAGG + Intergenic
931439472 2:62278066-62278088 ACAGAGTGCAAGAGTGAATGAGG + Intergenic
931871489 2:66465487-66465509 TCAGAGTGCTATAGTTAAGGTGG + Intronic
932160583 2:69455839-69455861 GCAGGTTGCAAGAATTACAGCGG + Intergenic
932513911 2:72325431-72325453 CCAGAATGAATGAGTTAAAGAGG - Intronic
932659349 2:73639123-73639145 GCAGAACGCAAGAGTGAAGGAGG + Intergenic
932665910 2:73698796-73698818 GCAGAATGCAAGAGTGAAGGAGG + Intergenic
933639888 2:84747828-84747850 GCAGAATGCAAGAGTGAAGGAGG - Intronic
934178040 2:89594744-89594766 ACAGAATTCAAGAGGTAAAGGGG - Intergenic
934288341 2:91669035-91669057 ACAGAATTCAAGAGGTAAAGGGG - Intergenic
935571126 2:104661037-104661059 ACAAGGTGCAAGAGTTAAGGTGG + Intergenic
935765530 2:106363715-106363737 CCACAGTGCAAGAGTTAATATGG + Intergenic
936721133 2:115254031-115254053 GCAGAGTACAAGAGTTAAGAAGG - Intronic
936732919 2:115405652-115405674 GCAGAATGCAAGAGTGGAGGAGG - Intronic
937054670 2:118923811-118923833 ACAGACTGTAAGAGTTAAAGAGG - Intergenic
938494391 2:131785697-131785719 GCAAAGTGCAAGAGTGAAGGAGG - Intergenic
939117319 2:138075317-138075339 GCAGTGTGAAAGAATTAAGGTGG + Intergenic
939453058 2:142398590-142398612 ACAGAATGCAAGAGTAAAGGAGG + Intergenic
940001017 2:148966192-148966214 GCAGTCTCCACGAGTTAAAGAGG + Intronic
942728547 2:179037326-179037348 GCACAGGGAAAGAGATAAAGTGG + Intronic
943603000 2:189943382-189943404 ATAGAGTGCAAGAGTGAATGAGG + Intronic
943889749 2:193271558-193271580 ACATAGTGCAAGACTAAAAGAGG - Intergenic
944160334 2:196652842-196652864 GCAGAATGCAAGAATGAAGGAGG - Intronic
944416507 2:199484617-199484639 ACAGAGTGACAGAGTCAAAGTGG - Intergenic
945410249 2:209498631-209498653 ACAGAGTGCAAGAGTGAATGAGG - Intronic
946055838 2:216901202-216901224 GCAGGGTGTAAGAGTAAAGGAGG - Intergenic
946452510 2:219793035-219793057 ACACAGTGCCAGAGTTAGAGGGG - Intergenic
946515007 2:220402339-220402361 GCAGAATGTAAGAGTGAATGAGG + Intergenic
946556631 2:220865819-220865841 GCAGACTGGAAGAGTTATTGAGG + Intergenic
946628240 2:221638095-221638117 GCAGGGTGCAAAATTTAAAGCGG - Intergenic
947183352 2:227432226-227432248 ACATAATGCAAGAGTAAAAGAGG - Intergenic
947594143 2:231400259-231400281 GCTGAGTGCTAGGATTAAAGTGG + Exonic
947889640 2:233605616-233605638 GCAGAATGCAAGAGTGAAGGAGG - Intergenic
948209880 2:236185095-236185117 ACAGAATGCAAGAGTGAAGGAGG + Intergenic
1170318630 20:15069718-15069740 GCAGAATGCAAGAGTGAAGGAGG + Intronic
1171433668 20:25103484-25103506 GAGAAGTGTAAGAGTTAAAGAGG - Intergenic
1173314524 20:41931327-41931349 GCACAATGCAAGAGTGAAGGAGG - Intergenic
1174459430 20:50672319-50672341 GCAGAGTCCTACAGTAAAAGGGG + Intronic
1174542439 20:51300306-51300328 ACAGGCTGTAAGAGTTAAAGAGG + Intergenic
1175556067 20:59857841-59857863 ATAGAGTGCAAGAGTGAATGAGG + Intergenic
1175702666 20:61151495-61151517 TCAGAGTGCAAGAGCTATGGGGG - Intergenic
1176711651 21:10155203-10155225 GCAAAGTGCAAGAGTGAAGGAGG - Intergenic
1177206589 21:18017559-18017581 GCAGATTGCAAGAGTGAGTGAGG + Intronic
1177773643 21:25544560-25544582 ACAGAATGCAAGAGTGAAGGAGG - Intergenic
1179370437 21:40801793-40801815 GCAGAAAGCAAGAGTTGTAGAGG + Intronic
1180498583 22:15911768-15911790 GCAAAGTGCAAGAGTGAAGGAGG - Intergenic
1181795854 22:25309907-25309929 CCTGAGGGAAAGAGTTAAAGAGG + Intergenic
1181836384 22:25613436-25613458 CCTGAGGGAAAGAGTTAAAGAGG + Intronic
1182866765 22:33610991-33611013 GGAGAGTGCAAGAGTGAAGGAGG + Intronic
949911497 3:8913278-8913300 GCAGAATGCCAGAGCTAAAAAGG + Intronic
952807984 3:37375264-37375286 GCACAGTGCAAGAGGGAATGAGG - Intergenic
953235190 3:41100270-41100292 CCAGAGTGCAAGAGCAAGAGGGG + Intergenic
953336900 3:42101169-42101191 GCAGAGGACAAGAGCTCAAGAGG + Intronic
956560197 3:70566470-70566492 GCAGAGAGCAGGAGAGAAAGAGG + Intergenic
957809955 3:85208631-85208653 GCAGAATGACAGAGGTAAAGAGG + Intronic
957909995 3:86608085-86608107 GCAGAATGCATGAGTGAAGGAGG - Intergenic
958063632 3:88514344-88514366 CCAAAGTGCAAAAGTAAAAGTGG - Intergenic
958582950 3:96050814-96050836 CCAAAGTGCAAGAGTGAAGGAGG - Intergenic
958841425 3:99209729-99209751 ACAGAAAGCAAGAGTGAAAGAGG - Intergenic
959310506 3:104729825-104729847 GCAGAGTGCAAGAGTTGTGGGGG - Intergenic
959935305 3:112022780-112022802 ACAGAGTTCAAGAGTGAAGGAGG + Intergenic
962005314 3:131343644-131343666 ACAGAATGCAAGAGTGAAAGTGG - Intronic
963521165 3:146361356-146361378 ACAGAATGCAAGAGTGAAGGAGG + Intergenic
963640710 3:147858380-147858402 ACAGAATGCAAGAGTAAAGGAGG - Intergenic
964341982 3:155717505-155717527 GCAGAGTGCAAGAGTGAATGAGG - Intronic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
965142265 3:164853956-164853978 GGAGAGTGTAAGAATTAAATTGG + Intergenic
965298377 3:166977740-166977762 GCAGAGTTCAAGTGTGAAAGAGG + Intergenic
965342051 3:167503198-167503220 ACAGAGTGCAAGAGTGAAGGAGG + Intronic
967787681 3:193514960-193514982 GCAGAGTGAAGGAGTTGAGGAGG + Intronic
969385830 4:6846668-6846690 GCAGCAGGCAATAGTTAAAGAGG - Intronic
970247770 4:14081211-14081233 GCAGAGTGCTAGCTTTAAAGAGG + Intergenic
972751050 4:41989880-41989902 GCAGAGAGAAACAGTTAACGTGG + Intergenic
972911511 4:43822629-43822651 GTAGAGTGCAAGAGTGAAGGAGG - Intergenic
972991977 4:44831626-44831648 GGAGAGGGTAAGAGTTAAATAGG - Intergenic
973542263 4:51946400-51946422 TCAGAGTGCAAGAATGAAGGAGG + Intergenic
973665335 4:53153308-53153330 GCAGAGTGCATGAGTGAAGCAGG - Intronic
973932517 4:55807286-55807308 ACAGAGTTAAAGAGTCAAAGAGG - Intergenic
974198715 4:58611293-58611315 GCAGAGTGCAAGAGCTGTGGAGG + Intergenic
974457396 4:62145722-62145744 ACAGAGTGCAAGAGTTAAGAAGG + Intergenic
975435283 4:74344288-74344310 ACAGAGTGCATGAGTAAAGGAGG - Intergenic
975512452 4:75208856-75208878 ACAGAGAGCAAGAGTCAAATTGG + Intergenic
975872930 4:78801645-78801667 GCAGAGGGCAAGAAATAAAATGG - Intronic
976542067 4:86289428-86289450 GCAGAGAGCAACAGTTAAGCAGG + Intronic
976798247 4:88958551-88958573 ACAGAATACAAGAGTTAAGGAGG + Intronic
977499531 4:97821673-97821695 ACAGAGTGCAAGAGTGAGGGAGG - Intronic
977874139 4:102129374-102129396 TCAGAATGCAAGATTTAAGGAGG + Intergenic
978374706 4:108062486-108062508 GCAGAGAGCAAGAGTGACTGGGG + Intronic
978408651 4:108405724-108405746 ACAGAATGCAAGAGTGAAGGAGG - Intergenic
979207540 4:118057936-118057958 GTAGAGTCCAAGAGTTAGATAGG + Intronic
980441029 4:132845211-132845233 GCAGAATGCAAGAGTGAAGGAGG - Intergenic
980462859 4:133139411-133139433 CCAGAATGCAAGAGTTTAAGTGG - Intergenic
981240123 4:142466967-142466989 ACAGAATGCAAGAGTGAAGGAGG + Intronic
982057092 4:151562374-151562396 GGAGAGTGCTAGAGATAAAAGGG - Intronic
982210190 4:153028477-153028499 ACAGAATGCAAGAGTGAAGGAGG - Intergenic
982708867 4:158739685-158739707 GCAGAGATCAAGAGCGAAAGAGG + Intergenic
982843323 4:160219982-160220004 CCAGAATACAAGAGTGAAAGAGG - Intergenic
983464712 4:168072958-168072980 GCTGAGTTGGAGAGTTAAAGTGG - Intergenic
983732392 4:171011839-171011861 ACAGAATGCAAGAGTGAAGGAGG + Intergenic
984116174 4:175683658-175683680 GGAGAGAGAGAGAGTTAAAGGGG - Intronic
987460031 5:18198133-18198155 GCAGAATGCAAGAGTGATGGAGG + Intergenic
988320336 5:29686544-29686566 ACAGAGTGCAAAAGTTGTAGGGG - Intergenic
988876955 5:35457362-35457384 GCAGAGTGCAAGAGGGAAGAAGG + Intergenic
989393286 5:40924680-40924702 ACATAGTGCAAGAGTGAAGGAGG - Intronic
990931894 5:61101069-61101091 GAAGAGTGTAAAAGTTACAGTGG - Intronic
991182979 5:63776283-63776305 GAAGAATTAAAGAGTTAAAGAGG - Intergenic
991600670 5:68348827-68348849 GCAGAATTCAAGAGTGAAGGAGG + Intergenic
993198542 5:84782200-84782222 ACATAGTGTAAGAGTTAAGGAGG - Intergenic
993816262 5:92549702-92549724 GCATTGTGGAAGAGTTAAAGGGG + Intergenic
994420171 5:99521771-99521793 GCAGAGTGGGAGGGTTAGAGGGG + Intergenic
995058177 5:107785844-107785866 CCAGGGTGCAAAATTTAAAGAGG + Intergenic
995390396 5:111634434-111634456 GGAAAGTGGTAGAGTTAAAGAGG - Intergenic
997246590 5:132355264-132355286 GCAGACTGTAAGAGTGAAGGAGG + Intergenic
997720591 5:136075535-136075557 GCAGAGTGCAAGTGTCTTAGAGG + Intergenic
999434140 5:151550121-151550143 GTAGGGTGCAAAATTTAAAGAGG + Intronic
999755872 5:154663915-154663937 ACAGAATGCAAGAGTGAAGGAGG - Intergenic
999864355 5:155684512-155684534 GCAGAGTCCAAGGGCTGAAGAGG + Intergenic
1000546552 5:162610419-162610441 ACAGAATGCAAGAGTAAAAGAGG + Intergenic
1000825456 5:166038535-166038557 GCAGAATGCAAGAGTGAAGGAGG - Intergenic
1002679042 5:180946606-180946628 GCAGAGGGCAAGAGAGAATGGGG + Intronic
1003069296 6:2932071-2932093 GCAGAGTGCATGGGTCAGAGTGG + Intergenic
1003403061 6:5806798-5806820 ACAGAGTTCAAGAGTGAAGGAGG + Intergenic
1003439239 6:6123957-6123979 GCAGAATGCAAGAGTGAAGAAGG + Intergenic
1004063339 6:12219377-12219399 GCATGGTGGAAGAGTGAAAGGGG - Intergenic
1004468764 6:15909575-15909597 GCAGAATGAGATAGTTAAAGAGG + Intergenic
1004755763 6:18608613-18608635 ACAGAGTGCAAGAGTGAAGGAGG - Intergenic
1004774127 6:18823279-18823301 GCAGAGTGCAAAAGTGAAAAAGG + Intergenic
1005113701 6:22313738-22313760 GCAGAGTACAAGAGTGAAGGCGG - Intergenic
1005597614 6:27394447-27394469 GCACAGTGCAAGAGTGAAGGAGG + Intronic
1008226192 6:48919933-48919955 ACAGAATGCAAGAGTGAAGGAGG + Intergenic
1009173479 6:60429783-60429805 GCAGGGTGCAAAAGTTAGATGGG + Intergenic
1009194778 6:60670384-60670406 GCAGAGGGCAAGAGAAAAGGAGG - Intergenic
1010087693 6:71939657-71939679 TGAGAGTGCAAGAGACAAAGAGG + Intronic
1011919845 6:92559802-92559824 CGAGAGGGCAAGAGTGAAAGGGG + Intergenic
1012964419 6:105657780-105657802 GCAGAATGCAAGAGGTATACAGG + Intergenic
1013005412 6:106068551-106068573 GGAAAGTGCAGGAGTTACAGTGG - Intergenic
1014520714 6:122439104-122439126 GGAGAGTGCAAGGGTGAAGGAGG + Intergenic
1014613117 6:123568561-123568583 GCAGAGTGCAAGAGTTAAAGAGG - Intronic
1015617547 6:135093182-135093204 GCACACTGCATGAGCTAAAGTGG - Intronic
1016927051 6:149361304-149361326 GCACAGTGCAAGAGTGAAGGAGG - Intronic
1017392741 6:153958847-153958869 ACAGAGTGCAAAAGTGAAAGAGG - Intergenic
1018032663 6:159854626-159854648 GAACAGTGCAAGATTTAAAAAGG + Intergenic
1019063431 6:169275121-169275143 ACAGAGTGCAAGAGTAAATCAGG + Intergenic
1019089715 6:169518396-169518418 GCAGAGTGCAAGAGTGAAGGAGG - Intronic
1019107186 6:169677906-169677928 ACAGAGTACAAGAGTAAAGGAGG + Intronic
1020456502 7:8379537-8379559 GGAGAGTGCATGAATCAAAGAGG - Intergenic
1020484004 7:8698079-8698101 GCAGAGAGCAAGAGTAGAAGAGG + Intronic
1023640131 7:42249212-42249234 GCAGAGCGCAATAGTTCATGTGG - Intergenic
1024403387 7:48950161-48950183 GCAGAGTGCAAGACTGAAGGAGG - Intergenic
1024860536 7:53835061-53835083 ACAGATTGCAAGAGTAAATGAGG + Intergenic
1027513247 7:79109854-79109876 ACAGAGTGCAAGAGTGAAGAAGG - Intronic
1027816994 7:82987858-82987880 ACACAGAACAAGAGTTAAAGGGG + Intronic
1028014255 7:85687046-85687068 GCACAATGCAAGAGTGAAGGAGG + Intergenic
1030533270 7:110736159-110736181 GCAGAGTACAAGAGCTATGGGGG + Intronic
1030724041 7:112903659-112903681 GCAGAGAGCAAGAGAGAAAAAGG + Intronic
1030750573 7:113227163-113227185 CCAGAATGCAAGAGTGAAGGAGG + Intergenic
1030834513 7:114265763-114265785 ACAGAGTGCAAGAGTTAAGGAGG - Intronic
1031284170 7:119843196-119843218 AGAGAGTGCAAGAGTGAATGAGG + Intergenic
1032330504 7:130974906-130974928 ACAGAGTGTAAGAGTGAATGAGG + Intergenic
1032642125 7:133781513-133781535 GCAGAGTGCAAGAATTGGAATGG + Intronic
1033616665 7:143023084-143023106 GCACAGTGGAAGAGCTACAGAGG + Intergenic
1033991108 7:147288023-147288045 CCAGAGTGCAAAAGGTAAGGGGG - Intronic
1034365190 7:150540181-150540203 ACAGAATGCAAGACTGAAAGAGG - Intergenic
1034502005 7:151456726-151456748 ACAGAGTGCAAAAGTGAAGGAGG - Intergenic
1034710386 7:153185869-153185891 GCAGAGTGCAAGAGTAAACGAGG - Intergenic
1036049395 8:5179243-5179265 GCAGAATGCAAGAGCTATGGAGG + Intergenic
1037464510 8:19146902-19146924 ACAGAGTGCAAAATTTAAGGAGG - Intergenic
1037509721 8:19570489-19570511 ACAGAGAGCAAGAGGTAATGAGG + Intronic
1041549030 8:59079582-59079604 ACAGAGTGCAAGAGTGAATGAGG + Intronic
1043334018 8:79151104-79151126 GCAGAATGCAAGAGTAATGGAGG + Intergenic
1045437005 8:102173657-102173679 ACAGAGTGCAAGAATGAAGGAGG - Intergenic
1046406262 8:113776383-113776405 GCAAAGAGCAAAAGGTAAAGAGG - Intergenic
1046529353 8:115423101-115423123 ACAGAGGGCAAGAGTGAAGGAGG + Intronic
1047674131 8:127181684-127181706 GCAGTGTCCAACAGATAAAGTGG - Intergenic
1048096456 8:131300568-131300590 GCAGAGTGCATGAATTAAGGAGG - Intergenic
1049033971 8:140060470-140060492 GCAGAGTGCAGGAGGCCAAGGGG - Intronic
1049922299 9:376595-376617 GCAAAGTGGCAGAGTTACAGAGG - Intronic
1052193421 9:25683863-25683885 ACAGAATGCAACAGTTAAGGAGG + Intergenic
1053042254 9:34884813-34884835 GCTGAGTGCAGAAGTGAAAGTGG - Intergenic
1053648642 9:40140894-40140916 GCAAAGTGCAAGAGTGAAGGAGG - Intergenic
1053757104 9:41322948-41322970 GCAAAGTGCAAGAGTGAAGGAGG + Intergenic
1054329625 9:63738839-63738861 GCAAAGTGCAAGAGTGAAGGAGG - Intergenic
1054535941 9:66235276-66235298 GCAAAGTGCAAGAGTGAAGGAGG + Intergenic
1054992823 9:71349762-71349784 GCAGAGTGTAAGAATTCACGTGG - Intronic
1055272894 9:74581639-74581661 GGAGAGTAGAAGATTTAAAGAGG - Intronic
1055813412 9:80178025-80178047 GCAGAGTGCAAGAGTGAAGGAGG - Intergenic
1056021272 9:82440806-82440828 ACAGAGTGCAAGAGTGAAAAAGG + Intergenic
1056312357 9:85353204-85353226 GCAGACTGCAAGAATGAAGGAGG - Intergenic
1056397293 9:86193483-86193505 TCAGAATGCAAGAGTAAAGGAGG + Intergenic
1057899966 9:98941075-98941097 GCAGAGTGCAACTGTGATAGGGG + Intergenic
1058104823 9:100957714-100957736 GCAACCTGCAGGAGTTAAAGAGG + Intergenic
1059885087 9:118736792-118736814 ACAAAGTGCAAGAGTGAAGGGGG + Intergenic
1059944026 9:119387958-119387980 GCAGAGTACAAGAGATAAAGGGG + Intergenic
1060798082 9:126526200-126526222 GGAGACAGCAAGAGTGAAAGAGG - Intergenic
1202796406 9_KI270719v1_random:124192-124214 GCAAAGTGCAAGAGTGAAGGAGG - Intergenic
1188957375 X:36449251-36449273 ACAGAGTGCAAGAGTGAATGAGG - Intergenic
1189038005 X:37512608-37512630 ACACAGAGCAAGAGTTGAAGAGG - Intronic
1189070426 X:37857390-37857412 GCAGAGTGCAAGAGTTAAGGAGG - Intronic
1189127341 X:38462244-38462266 CCAGAATGCAAGAGTAAAGGAGG - Intronic
1189553356 X:42115642-42115664 GTAGAGAGCAAGACTTAAAGAGG + Intergenic
1189594382 X:42548542-42548564 ACAGAGTGCAAGAGTAAATGAGG - Intergenic
1190160817 X:48030277-48030299 GGAGAGTGGAAGAGGTAAGGGGG - Intronic
1190425250 X:50329390-50329412 ACAGAGTGCAAGAGTGAAGGAGG - Intronic
1190512881 X:51192075-51192097 ACAGAGTGCCAGAGTGAAGGAGG - Intergenic
1190575487 X:51832450-51832472 GCAGAGAGGGAGAGATAAAGTGG - Intronic
1192320897 X:70089773-70089795 GGAGAGAGCAAGAGTGAGAGTGG - Intergenic
1193967516 X:88006701-88006723 GGAGAATGCAAGAGTTAAGGGGG - Intergenic
1193998734 X:88400321-88400343 ACAGAATGCAAGAGTGAAGGAGG + Intergenic
1194019497 X:88669217-88669239 GCTGAGTGCAAGAGTAAAGGAGG - Intergenic
1194031954 X:88828521-88828543 GCAGAGTGCATGAGCTATGGAGG + Intergenic
1194168892 X:90557327-90557349 GCAGAGTGCAAGAGTAAAGGAGG + Intergenic
1194347562 X:92785078-92785100 GCAGAGTGCAAGAATGAAGGAGG - Intergenic
1194878407 X:99219303-99219325 GCAGAGTGCAAGAGCTGTGGAGG - Intergenic
1194922256 X:99780598-99780620 GCAAAGTGCAACAGTTAAGGAGG - Intergenic
1195866579 X:109439029-109439051 TCAGAGTGCAAGAGGTATGGAGG - Intronic
1196029046 X:111075500-111075522 ACAGAATGCAAGAGTGAAGGAGG + Intronic
1197443297 X:126516133-126516155 GCAGAATGCAGGAGTAAAAATGG + Intergenic
1197472668 X:126882608-126882630 ACAGAATGCAAGAGTAAAGGAGG + Intergenic
1197719159 X:129733285-129733307 GCAAAGTGCAAGAGTGAAGGAGG + Intergenic
1198222794 X:134618154-134618176 GCAGAGTACAAGTGTTGAACAGG + Intronic
1199038234 X:143078776-143078798 GCAGTGTGCAAGACTGAAGGAGG - Intergenic
1199091800 X:143701819-143701841 ACCGAGTGCAAGAGTGAATGAGG + Intergenic
1199226898 X:145386670-145386692 GCTGATTGCAAGAGAGAAAGAGG - Intergenic
1199261427 X:145779860-145779882 ACAGAGTGCAAGAGTGAATGAGG + Intergenic
1199603323 X:149556519-149556541 ACAGAATGCAAGAGTGAAAAAGG + Intergenic
1199647065 X:149922956-149922978 ACAGAATGCAAGAGTGAAAAAGG - Intergenic
1200515135 Y:4135112-4135134 GCAGAGTGCAAGAGTAAAGGAGG + Intergenic