ID: 1014623272

View in Genome Browser
Species Human (GRCh38)
Location 6:123695694-123695716
Sequence TTCTTCAGCTTGAAGATCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014623272_1014623276 11 Left 1014623272 6:123695694-123695716 CCTTAGATCTTCAAGCTGAAGAA No data
Right 1014623276 6:123695728-123695750 TCAACTTTTCTACTTATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014623272 Original CRISPR TTCTTCAGCTTGAAGATCTA AGG (reversed) Intergenic
No off target data available for this crispr