ID: 1014627155

View in Genome Browser
Species Human (GRCh38)
Location 6:123740598-123740620
Sequence CAGGGGTACAACAGGGAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014627155_1014627164 12 Left 1014627155 6:123740598-123740620 CCCTATTCCCTGTTGTACCCCTG No data
Right 1014627164 6:123740633-123740655 GTTTATCATCTCTATAGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014627155 Original CRISPR CAGGGGTACAACAGGGAATA GGG (reversed) Intergenic
No off target data available for this crispr