ID: 1014627552

View in Genome Browser
Species Human (GRCh38)
Location 6:123747068-123747090
Sequence TCAGTGGCTAGCTGTGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014627552_1014627559 1 Left 1014627552 6:123747068-123747090 CCCTCTCCACAGCTAGCCACTGA No data
Right 1014627559 6:123747092-123747114 GGCTAGGAAAGAGTGATGGTTGG No data
1014627552_1014627560 20 Left 1014627552 6:123747068-123747090 CCCTCTCCACAGCTAGCCACTGA No data
Right 1014627560 6:123747111-123747133 TTGGAGCTACTAAAGCACGTAGG No data
1014627552_1014627558 -3 Left 1014627552 6:123747068-123747090 CCCTCTCCACAGCTAGCCACTGA No data
Right 1014627558 6:123747088-123747110 TGATGGCTAGGAAAGAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014627552 Original CRISPR TCAGTGGCTAGCTGTGGAGA GGG (reversed) Intergenic