ID: 1014627555 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:123747074-123747096 |
| Sequence | TAGCCATCAGTGGCTAGCTG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1014627555_1014627560 | 14 | Left | 1014627555 | 6:123747074-123747096 | CCACAGCTAGCCACTGATGGCTA | No data | ||
| Right | 1014627560 | 6:123747111-123747133 | TTGGAGCTACTAAAGCACGTAGG | No data | ||||
| 1014627555_1014627559 | -5 | Left | 1014627555 | 6:123747074-123747096 | CCACAGCTAGCCACTGATGGCTA | No data | ||
| Right | 1014627559 | 6:123747092-123747114 | GGCTAGGAAAGAGTGATGGTTGG | No data | ||||
| 1014627555_1014627558 | -9 | Left | 1014627555 | 6:123747074-123747096 | CCACAGCTAGCCACTGATGGCTA | No data | ||
| Right | 1014627558 | 6:123747088-123747110 | TGATGGCTAGGAAAGAGTGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1014627555 | Original CRISPR | TAGCCATCAGTGGCTAGCTG TGG (reversed) | Intergenic | ||