ID: 1014627559

View in Genome Browser
Species Human (GRCh38)
Location 6:123747092-123747114
Sequence GGCTAGGAAAGAGTGATGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014627550_1014627559 17 Left 1014627550 6:123747052-123747074 CCTGTCCATGATAACGCCCTCTC No data
Right 1014627559 6:123747092-123747114 GGCTAGGAAAGAGTGATGGTTGG No data
1014627553_1014627559 0 Left 1014627553 6:123747069-123747091 CCTCTCCACAGCTAGCCACTGAT No data
Right 1014627559 6:123747092-123747114 GGCTAGGAAAGAGTGATGGTTGG No data
1014627551_1014627559 12 Left 1014627551 6:123747057-123747079 CCATGATAACGCCCTCTCCACAG No data
Right 1014627559 6:123747092-123747114 GGCTAGGAAAGAGTGATGGTTGG No data
1014627549_1014627559 18 Left 1014627549 6:123747051-123747073 CCCTGTCCATGATAACGCCCTCT No data
Right 1014627559 6:123747092-123747114 GGCTAGGAAAGAGTGATGGTTGG No data
1014627555_1014627559 -5 Left 1014627555 6:123747074-123747096 CCACAGCTAGCCACTGATGGCTA No data
Right 1014627559 6:123747092-123747114 GGCTAGGAAAGAGTGATGGTTGG No data
1014627552_1014627559 1 Left 1014627552 6:123747068-123747090 CCCTCTCCACAGCTAGCCACTGA No data
Right 1014627559 6:123747092-123747114 GGCTAGGAAAGAGTGATGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014627559 Original CRISPR GGCTAGGAAAGAGTGATGGT TGG Intergenic
No off target data available for this crispr