ID: 1014627560

View in Genome Browser
Species Human (GRCh38)
Location 6:123747111-123747133
Sequence TTGGAGCTACTAAAGCACGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014627553_1014627560 19 Left 1014627553 6:123747069-123747091 CCTCTCCACAGCTAGCCACTGAT No data
Right 1014627560 6:123747111-123747133 TTGGAGCTACTAAAGCACGTAGG No data
1014627555_1014627560 14 Left 1014627555 6:123747074-123747096 CCACAGCTAGCCACTGATGGCTA No data
Right 1014627560 6:123747111-123747133 TTGGAGCTACTAAAGCACGTAGG No data
1014627557_1014627560 4 Left 1014627557 6:123747084-123747106 CCACTGATGGCTAGGAAAGAGTG No data
Right 1014627560 6:123747111-123747133 TTGGAGCTACTAAAGCACGTAGG No data
1014627552_1014627560 20 Left 1014627552 6:123747068-123747090 CCCTCTCCACAGCTAGCCACTGA No data
Right 1014627560 6:123747111-123747133 TTGGAGCTACTAAAGCACGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014627560 Original CRISPR TTGGAGCTACTAAAGCACGT AGG Intergenic
No off target data available for this crispr