ID: 1014633049

View in Genome Browser
Species Human (GRCh38)
Location 6:123811066-123811088
Sequence GAATATGTGTCTTCACCTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014633047_1014633049 2 Left 1014633047 6:123811041-123811063 CCAAATTTTGAGAACTACTGGCC 0: 1
1: 0
2: 16
3: 150
4: 579
Right 1014633049 6:123811066-123811088 GAATATGTGTCTTCACCTAATGG 0: 1
1: 0
2: 0
3: 14
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014633049 Original CRISPR GAATATGTGTCTTCACCTAA TGG Intronic
908630684 1:66103164-66103186 CACTATGAGTCTTCACCGAAAGG + Intronic
913582142 1:120236782-120236804 GAATTTATTTCTCCACCTAATGG + Intergenic
913626032 1:120661602-120661624 GAATTTATTTCTCCACCTAATGG - Intergenic
914564075 1:148848260-148848282 GAATTTATTTCTCCACCTAATGG + Intronic
914608751 1:149281979-149282001 GAATTTATTTCTCCACCTAATGG - Intergenic
918986939 1:191643259-191643281 GAAAACGTATATTCACCTAATGG - Intergenic
920115154 1:203615538-203615560 GAAAAAGTGTGTTCACATAAGGG + Intergenic
1064072937 10:12246176-12246198 GAATCTGTGACTTCACCAAATGG - Exonic
1068419224 10:56767880-56767902 GAATATTGGTCTTCTCCTTAAGG - Intergenic
1068947648 10:62745412-62745434 GAATGTGTGTCTCCTCCTGAGGG + Intergenic
1074540146 10:114358421-114358443 GAGTCTGTTTCTTCATCTAAGGG - Intronic
1075017207 10:118918701-118918723 CCATATGTGTCTTTCCCTAAGGG - Intergenic
1075666691 10:124235897-124235919 GCATGTGTGTCTACACATAAGGG - Intergenic
1082591309 11:55014366-55014388 TGATGTGTGTCTTCACCTTACGG + Intergenic
1090281196 11:125457559-125457581 TAAAATGTGTCTCCATCTAATGG + Intronic
1092666997 12:10812672-10812694 GAATATATGGCTTCTGCTAATGG - Intergenic
1094293677 12:28879905-28879927 CAATGTGTTTTTTCACCTAATGG + Intergenic
1095063863 12:37740205-37740227 TGATATGTGTTTTCTCCTAACGG + Intergenic
1097054623 12:56242242-56242264 TAATTTGTTTCTTCCCCTAAAGG + Exonic
1098607269 12:72406534-72406556 GAATTTTTTTCTTCTCCTAAGGG + Intronic
1102777045 12:115529142-115529164 CCATATGTGTATTAACCTAAAGG - Intergenic
1104615618 12:130265791-130265813 GAATATGGCTCTTCACCCAGAGG - Intergenic
1107689789 13:42941831-42941853 GAATATGTGTTTTCATATATTGG + Intronic
1109648542 13:65293128-65293150 GAATATAAGTCTGGACCTAAAGG + Intergenic
1112625783 13:101101861-101101883 GAATTTGTGCCTTTCCCTAATGG - Intronic
1120337749 14:83179774-83179796 GAATCTGTGACTTTACTTAATGG - Intergenic
1120693373 14:87618077-87618099 TGATAAGTGTCTTCTCCTAAAGG + Intergenic
1122463172 14:101912535-101912557 GAATATATGTCTTCACCATGGGG + Intronic
1126263177 15:46718529-46718551 GAATATGAGTCTTCCCCTTATGG + Intergenic
1126479968 15:49108079-49108101 GAACATGTGTGTTCACATAGTGG - Intronic
1126752684 15:51893334-51893356 AAATATGTGTCAACACATAAAGG + Intronic
1135871251 16:26152562-26152584 CAATATGTATCTGCCCCTAAAGG + Intergenic
1136427188 16:30176755-30176777 GAATTTGTTGCTTCACATAATGG + Intergenic
1137761775 16:50946958-50946980 GAGTCTGTGTCTCCACCCAAGGG - Intergenic
1137991201 16:53157650-53157672 AAATATGTATGTTCACTTAATGG - Intronic
1138820295 16:60251612-60251634 GAGTATGTGTATTCTGCTAAAGG - Intergenic
1141566956 16:84909034-84909056 GAATATTTGTCTTCAGAAAATGG + Exonic
1142711586 17:1726645-1726667 GAATGTGTGTCTGCACCTGGTGG + Exonic
1149367407 17:55959677-55959699 CCATATGTGTTTTCAACTAAAGG - Intergenic
1151006173 17:70438598-70438620 ATATATGTGTCTTCTCCTAGTGG + Intergenic
1151055673 17:71028163-71028185 AAATTTGTGTTTTCACCTTAAGG - Intergenic
1153755396 18:8277521-8277543 AAATATGTGTGATCACATAAAGG + Intronic
1154558341 18:15791151-15791173 TGATATGTGTCCTCAGCTAAAGG + Intergenic
1154621818 18:16661569-16661591 TGATGTGTGTCTTCAACTAAAGG + Intergenic
1154635850 18:16854075-16854097 TGATATGTGTCCTCAACTAAAGG + Intergenic
1154687764 18:17565492-17565514 TGATGTGTGTCCTCACCTAAAGG + Intergenic
1154706114 18:17816743-17816765 TGATATGTGTCCTCAGCTAAAGG + Intergenic
1154758552 18:18535742-18535764 TGATGTGTGTCTTCAACTAAAGG + Intergenic
1154759484 18:18548630-18548652 TGATATGTGTCCTCAACTAAAGG + Intergenic
1154766960 18:18651220-18651242 TGATGTGTGTCCTCACCTAAAGG + Intergenic
1154791403 18:18987034-18987056 GCATGTGTGTCCTCAACTAAAGG + Intergenic
1154830681 18:19528233-19528255 TGATATGTGTCCTCAACTAAAGG + Intergenic
1154832061 18:19547061-19547083 TAATGTGTGTCCTCAACTAAAGG + Intergenic
1154853406 18:19840802-19840824 TGATGTGTGTCTTCAACTAAAGG + Intergenic
1154857677 18:19899981-19900003 TGATGTGTGTCCTCACCTAAAGG + Intergenic
1154884226 18:20266434-20266456 TGATATGTGTCCTCAACTAAAGG + Intergenic
1154885372 18:20282040-20282062 TGATATGTGTCCTCAACTAAAGG + Intergenic
1159968701 18:74622279-74622301 GAAAATGTGTCTTGCCCTTATGG - Intronic
1160246192 18:77162137-77162159 GAGTCTGTGTCTTCACCTACAGG - Intergenic
1163067558 19:14810162-14810184 GAATATGTGTCTAGTCCCAAAGG - Intronic
1163932001 19:20403750-20403772 TAATATCAGTCTTCACCTAATGG - Intergenic
926492389 2:13540702-13540724 GTATATGTGTCTCCACCATAAGG - Intergenic
928287637 2:30007370-30007392 GAGTTTGTTTCTTCATCTAAAGG - Intergenic
937771204 2:125722368-125722390 GCATTTGCGTCTTCACCCAAGGG - Intergenic
938580377 2:132640356-132640378 GAATCTGTGTCATCATCTAATGG + Intronic
941481329 2:166018264-166018286 GAATAAGTGGTTTCACTTAAAGG - Intronic
941885436 2:170522775-170522797 GATAATGTGTCTTGACCAAAAGG - Intronic
944158891 2:196638783-196638805 GAATATGTATTCTCACTTAAGGG - Intergenic
944439944 2:199731904-199731926 GAATAGGTGACTTCTCCTAGGGG - Intergenic
949081212 2:242101339-242101361 GCATGTGTGTCTTCATCTAAAGG + Intergenic
1171047473 20:21824196-21824218 GCCTAGGGGTCTTCACCTAAAGG - Intergenic
1171110794 20:22480396-22480418 CAATAAGTGTCTTCACTTCATGG - Intergenic
1171588692 20:26563518-26563540 TGATATGTGTCCTCAGCTAAAGG + Intergenic
1176988525 21:15465545-15465567 AAATATGTGTCCTCACCTAGTGG - Intergenic
1177996446 21:28105670-28105692 GAATATTTGTCTTCAGCGTAAGG - Intergenic
1178263694 21:31123245-31123267 GAATATGTGTCTCAACCTCAGGG - Intronic
951115402 3:18855334-18855356 GAATATGTGTCCTGGGCTAATGG + Intergenic
951981405 3:28571104-28571126 GAATCAGTGTCTGCACCTTAGGG - Intergenic
951983193 3:28588174-28588196 GAATATGTGCCTACAGCTAAGGG - Intergenic
952079654 3:29742683-29742705 TAATTTCTGTCTTCACCAAATGG + Intronic
952124012 3:30278041-30278063 GAATATGTTTTTTTTCCTAAAGG + Intergenic
955941788 3:64152899-64152921 GAGAAGCTGTCTTCACCTAATGG - Intronic
956753031 3:72359930-72359952 GGATGTGTGACTTCACATAATGG + Intergenic
959222515 3:103539653-103539675 GAAGAAGTTTCTTCACCAAATGG - Intergenic
961844142 3:129746602-129746624 TAATAGGTGTTTTCCCCTAAAGG + Intronic
961916571 3:130381340-130381362 GAATATTTTTCTCAACCTAAAGG - Intronic
962749149 3:138420384-138420406 GAATTCCTGTCATCACCTAATGG - Intergenic
963820582 3:149888407-149888429 GAACATCTGTCTTCAGATAATGG - Intronic
965023627 3:163268377-163268399 TAAAATGTGTATTCACCTAATGG + Intergenic
967190699 3:186982440-186982462 GAATATGTATCTTCAACTATGGG + Intronic
972961028 4:44451913-44451935 GAAAATGTATCTTCTTCTAAAGG + Intergenic
974301160 4:60068353-60068375 GAAAATATGACTTCACCAAATGG + Intergenic
974303025 4:60094444-60094466 AAGTATGTTTCTGCACCTAATGG + Intergenic
974516752 4:62924578-62924600 GAAAACGTATCTTCACCTAAAGG - Intergenic
976564341 4:86536575-86536597 GATTATGTATCTACAACTAAAGG - Intronic
977132465 4:93259005-93259027 GAAAATGAGTCTTCACAGAAAGG + Intronic
977470957 4:97442137-97442159 GAAAATGTGGCTTGACCCAAGGG + Intronic
979124852 4:116956281-116956303 GACTATGTTATTTCACCTAAAGG - Intergenic
981183184 4:141769710-141769732 GAAGTTCTGTCTTCACCTTAGGG + Intergenic
982290848 4:153781244-153781266 GGATAGCTGTTTTCACCTAAAGG - Exonic
982697643 4:158621578-158621600 TAATATTTATCTTAACCTAATGG - Intronic
983962376 4:173770281-173770303 GTATATTTTTCTTCACCTAGTGG + Intergenic
984101030 4:175485841-175485863 GAATATGTTGATTCACTTAATGG - Intergenic
986509848 5:8492579-8492601 GAATATCTGTGTTAACATAAGGG + Intergenic
988070385 5:26281138-26281160 GAATATTTATCTTCACCTCACGG - Intergenic
988952843 5:36282481-36282503 TAGTATGTTTCTTCACCAAAGGG - Intronic
993866413 5:93201849-93201871 TAACATGTTTCTTCTCCTAAAGG - Intergenic
994144514 5:96378861-96378883 GTATATGTATTTTTACCTAATGG + Intergenic
996775936 5:127132563-127132585 GAATATATTTCCTCACCAAATGG - Intergenic
996876518 5:128246350-128246372 GACTATGTGACTTAACATAATGG - Intergenic
1000932162 5:167264686-167264708 GCCTATGTGTCTTCCCCTACTGG + Intergenic
1202774313 5_GL000208v1_random:51376-51398 GAATGTGTGTATTCAGCTCACGG - Intergenic
1005461316 6:26072389-26072411 GAGTATCTGTCTTCTCCTCATGG - Intergenic
1006422930 6:33946856-33946878 GAAAATATGTCTTCATTTAATGG + Intergenic
1008645982 6:53515440-53515462 AAATATCTGTCTTCCCCAAAAGG + Intronic
1008776801 6:55050061-55050083 GAAAATGTTTGTTCTCCTAAAGG - Intergenic
1009985196 6:70773759-70773781 AAATATATGTCTTCCTCTAAGGG + Intronic
1012831254 6:104206072-104206094 AAATGTGTGTCTTCACATAGTGG - Intergenic
1012988389 6:105899175-105899197 GAATATGTCTCTTCATCTCTTGG - Intergenic
1013428666 6:110036890-110036912 GAGTCAGCGTCTTCACCTAAAGG + Intergenic
1014633049 6:123811066-123811088 GAATATGTGTCTTCACCTAATGG + Intronic
1015294437 6:131574660-131574682 AAGTATTTGTCCTCACCTAAAGG + Intronic
1017852755 6:158319315-158319337 GAACTTGTGTCTTCATTTAAGGG + Intronic
1018074017 6:160193876-160193898 GAATGTGTGTCTGCAGCTATTGG - Intronic
1025028533 7:55537214-55537236 AAATATGTGTGTTCAGCTGAAGG - Intronic
1026627087 7:72004336-72004358 GAAAATGAATCTTGACCTAAAGG + Intronic
1026851715 7:73728265-73728287 GAATATTTGTCATCTCCTTAGGG + Intergenic
1028656187 7:93210055-93210077 GGAAAAGTGTCTTCACCTACTGG - Intronic
1035539122 8:418145-418167 GCATGTGTGTCTTCATGTAAAGG + Intronic
1035882492 8:3257594-3257616 AAATATGTGTCATCATCTCAGGG - Intronic
1038633992 8:29270819-29270841 GTAGATGTGTCTTCATCTCAAGG + Intergenic
1039270165 8:35871447-35871469 CAATATTTGTATTTACCTAAAGG + Intergenic
1040144062 8:43966854-43966876 CGATATGTGTCCTCAACTAACGG + Intergenic
1040166772 8:44352698-44352720 CGATGTGTGTCTTCAACTAATGG + Intergenic
1040263948 8:45788858-45788880 CGATATGTGTCCTCAACTAACGG + Intergenic
1046195898 8:110862008-110862030 GGCTTTGTGTCTTCCCCTAAAGG - Intergenic
1050782081 9:9349785-9349807 AAATATGTCTCATCACCTATGGG + Intronic
1053558202 9:39160307-39160329 GAATATGTTACATCACATAAGGG - Intronic
1053822319 9:41980543-41980565 GAATATGTTACATCACATAAGGG - Intronic
1054138913 9:61458619-61458641 GAATATGTTACATCACATAAGGG + Intergenic
1054608255 9:67206835-67206857 GAATATGTTACATCACATAAGGG + Intergenic
1054810304 9:69429019-69429041 GGTTATGTATGTTCACCTAAAGG - Exonic
1057616061 9:96591341-96591363 GAATTTGTGTCTTCAACAAATGG - Intronic
1058187578 9:101873217-101873239 GAAGATGGGTCTTCATCTATAGG + Intergenic
1060687900 9:125628454-125628476 GAAAATGTCTCTTCAGCAAATGG + Intronic
1203418077 Un_KI270366v1:2138-2160 GAATGTGTGTATTCAGCTCACGG - Intergenic
1186178725 X:6951958-6951980 TAATATGTGTCTTCTCCCACAGG - Intergenic
1192260309 X:69502335-69502357 AAATATGTGTCTTGAGCTGAAGG - Intergenic
1199529651 X:148831960-148831982 GAATCTGTTTCTTTATCTAAAGG - Intronic