ID: 1014633342

View in Genome Browser
Species Human (GRCh38)
Location 6:123814138-123814160
Sequence CCTACAAGGCAGGGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 5, 3: 22, 4: 314}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014633331_1014633342 17 Left 1014633331 6:123814098-123814120 CCTTTTCTATGCACCTGGAATTA 0: 1
1: 0
2: 1
3: 16
4: 199
Right 1014633342 6:123814138-123814160 CCTACAAGGCAGGGGGTGGAGGG 0: 1
1: 0
2: 5
3: 22
4: 314
1014633333_1014633342 4 Left 1014633333 6:123814111-123814133 CCTGGAATTAAAGGCTTCTTTCA 0: 1
1: 0
2: 1
3: 15
4: 340
Right 1014633342 6:123814138-123814160 CCTACAAGGCAGGGGGTGGAGGG 0: 1
1: 0
2: 5
3: 22
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014633342 Original CRISPR CCTACAAGGCAGGGGGTGGA GGG Intronic
900218679 1:1495674-1495696 CCGGCAAGGCAGGGGTAGGAGGG - Exonic
900226034 1:1534115-1534137 CCGGCAAGGCAGGGGTGGGAGGG - Exonic
900923587 1:5689368-5689390 TCTACAAAGGAGGCGGTGGAGGG - Intergenic
901940301 1:12656764-12656786 CATACCAGGCAGTGGATGGATGG - Intronic
902903095 1:19533788-19533810 CCAGCAAGGCAGGAAGTGGAAGG + Intergenic
903318513 1:22527342-22527364 CTCACAAGGCAGGGAGTGGGCGG - Exonic
903623976 1:24718133-24718155 CCTAGAAGGGATGGGATGGATGG + Intergenic
904331167 1:29758536-29758558 CCTACAGGGTGGGGGCTGGATGG - Intergenic
904382551 1:30121121-30121143 GCTAAAAGGCAGGGAGTGGGTGG + Intergenic
904415517 1:30359027-30359049 CCTACAGGGTGGGGGCTGGATGG + Intergenic
905508941 1:38503204-38503226 CCTACAAGGGAGGAGGCAGAAGG - Intergenic
905792728 1:40798932-40798954 CCAACAAGGGAGGGGCTGGCAGG - Intronic
905973989 1:42162503-42162525 CCACCAAGGCAGCGGGTGGTGGG - Intergenic
907861216 1:58355599-58355621 CCTACCAGGAAAGGAGTGGAAGG - Intronic
908743291 1:67350686-67350708 CCTAAATGGCAGGGAGGGGAAGG + Intronic
912450300 1:109764131-109764153 CCTAAAAGGCAGAGGGAAGAGGG - Intronic
914802547 1:150972057-150972079 CCTGCAAAACAGGGGGTGGGGGG + Intronic
914825403 1:151135544-151135566 CCTGCAAAGCAGGGAGGGGATGG - Intronic
914883805 1:151568841-151568863 CCTGTAAGGCAGGGTGTGGTAGG + Intronic
915129823 1:153688522-153688544 CCTACAGGGCAGGAGGCGGGAGG - Intronic
915579911 1:156807376-156807398 CCTAGGAGGCAGAGGGTAGAGGG - Intronic
916581958 1:166116881-166116903 CCTAGAAGGCTGGAGCTGGAAGG - Intronic
917133360 1:171764209-171764231 GCAAAAAGGCAGGGGCTGGAGGG + Intergenic
917854140 1:179087849-179087871 CCCTCAAGGCCGGAGGTGGAAGG + Intronic
917982373 1:180278446-180278468 CCTACCAAGCAGAGTGTGGATGG - Exonic
918108971 1:181439176-181439198 CATGCTAGGCAGGGGGTTGAAGG + Intronic
921678686 1:218006320-218006342 CCAAAAAGGCAGGGGATGGAGGG + Intergenic
923619657 1:235568066-235568088 CCAAAAAGGCAGGGGCTGGAAGG - Intronic
923939656 1:238807371-238807393 CCTACAATGCAATGGGTGGCAGG + Intergenic
1062895555 10:1100818-1100840 CCTTGAAGGCAGGGGGTGATGGG - Intronic
1064299590 10:14111850-14111872 CCTGCAGGGCAGGTGGAGGAGGG + Intronic
1064928770 10:20599971-20599993 CATCCAAGGCAGAAGGTGGAAGG - Intergenic
1065628253 10:27653244-27653266 CCTGCATGGCAGGGAGTGGGTGG - Intergenic
1065722896 10:28643370-28643392 CGCACAAGGCAGGGCCTGGAAGG - Intergenic
1065933619 10:30500700-30500722 CCCACAGGACAGGGGGTGGTGGG + Intergenic
1068025479 10:51637761-51637783 CCTGTTGGGCAGGGGGTGGAAGG + Intronic
1069370475 10:67742491-67742513 CATTCAAGGCAGTGTGTGGAGGG + Intergenic
1070834470 10:79439405-79439427 CTCACAAGTCAGGAGGTGGAAGG + Intronic
1071606728 10:86998822-86998844 CCTGCGAGGCAGAGGGTGCAGGG + Intergenic
1071991312 10:91103138-91103160 GCCCCAAGGCAGAGGGTGGAGGG + Intergenic
1072041491 10:91611176-91611198 CCTCCATGGCAGGGGTGGGAAGG + Intergenic
1072797849 10:98369990-98370012 GGTCCAAGGCAGGAGGTGGACGG - Intergenic
1073059793 10:100726544-100726566 TCTGGAAGGCAGGGGGTGGGGGG + Intergenic
1073179920 10:101577554-101577576 CCTCCAGGGCTGGGGGTGGAGGG - Intronic
1073861287 10:107744567-107744589 ACTGCAGGGCAGGGGATGGAAGG - Intergenic
1074289875 10:112130422-112130444 CTTGCAAGGGAGGGGGTGGCAGG + Intergenic
1077161775 11:1116755-1116777 AATACAAGCCAGGGAGTGGAAGG + Intergenic
1077997947 11:7469929-7469951 CCTGCAATGCGGGGGGTGGGAGG + Intergenic
1078082084 11:8211434-8211456 CATCCAAGGCAGGGGAGGGAGGG + Intergenic
1078422758 11:11225699-11225721 CCTACATGGCAGAAGGTGGAAGG + Intergenic
1078936221 11:15952652-15952674 CCTACCAGGCAGAGACTGGAAGG + Intergenic
1079303281 11:19298461-19298483 CCTAGAAGGAAGGGAGGGGAAGG - Intergenic
1081652172 11:44831795-44831817 CCGAGAAGGCAGGGTGTGGCTGG + Intronic
1081908092 11:46681940-46681962 ATTCCAAGGCAGGGGGTGGCGGG - Intronic
1082116073 11:48329567-48329589 ACTAGAAGGTAGAGGGTGGAAGG + Intergenic
1082812864 11:57489170-57489192 CCTGGAAGGCAGGTGCTGGATGG + Intronic
1083263081 11:61533486-61533508 CCTTCCAGGCTGGGGGCGGATGG - Intronic
1084265910 11:68005002-68005024 CCTAAAGAGCAGTGGGTGGAGGG - Intergenic
1085514729 11:77105536-77105558 GCCACTGGGCAGGGGGTGGATGG + Intronic
1085527729 11:77173866-77173888 CCTCTAATGCAGGGGGTGCAGGG + Intronic
1085545451 11:77313578-77313600 TCTACAACGCAGAGCGTGGACGG - Intergenic
1085959233 11:81440170-81440192 CTTACATGGCAGCAGGTGGAAGG + Intergenic
1086074305 11:82834079-82834101 CTTACATGGCTGGAGGTGGAAGG - Intronic
1087252135 11:95914391-95914413 CCTGCAGGGCAGGGAGTGGTGGG + Intronic
1088566043 11:111174038-111174060 ACTACCAGGCTGGGGGTGGTGGG - Intergenic
1088996920 11:115008820-115008842 CCCAAAAGGCTGGGGGTGGACGG + Intergenic
1089387304 11:118076816-118076838 CCTAGAAGGTAGGGGGAGGGGGG + Intergenic
1089734996 11:120544673-120544695 ATCACAAGGTAGGGGGTGGAGGG - Intronic
1090199133 11:124841815-124841837 CCTGCAGGGCAGGGGGTCCAGGG - Intergenic
1091455915 12:607786-607808 CCCACAGGACTGGGGGTGGAAGG + Intronic
1091460573 12:641317-641339 TCTGCAAAGCAGGAGGTGGAGGG - Intronic
1094480170 12:30875166-30875188 CCTCCCAGGCAGGGAGGGGAGGG + Intergenic
1096256262 12:50063961-50063983 CCAGCTAGGCAGGGAGTGGAGGG + Intronic
1097374814 12:58828911-58828933 GCAACGAGGCAGGGGGTGGTTGG + Intergenic
1097748555 12:63327179-63327201 CCTATAAAACAGGGTGTGGAAGG + Intergenic
1099318453 12:81114361-81114383 CCTACAGGGCAGGGGTTGGAAGG - Intronic
1099918140 12:88922038-88922060 CCTACTAGGCAGATGGTGAAAGG + Intergenic
1100261035 12:92932206-92932228 ACTTGAAGGCAGGAGGTGGATGG + Intergenic
1101624810 12:106429226-106429248 CCCAAAAGGCAGGGGCTGCAGGG - Intronic
1101837241 12:108304152-108304174 CCTACAGGGAAGGAGCTGGAGGG - Intronic
1102031383 12:109741898-109741920 CCTGCCAGGCAGGGAGTGGCTGG - Intronic
1102088088 12:110160501-110160523 AGAACAAGGCAGGGGGAGGAAGG - Intronic
1102472219 12:113165770-113165792 TCTACAAGGCAGGGGGTGGCAGG - Intronic
1104649860 12:130523754-130523776 CCCACAAGGCTGGGGGCAGAGGG - Intronic
1106801017 13:33255739-33255761 CCTCCAGGGCAGGGAGGGGACGG + Intronic
1107171835 13:37351883-37351905 TCTATAAGTCAGGGGTTGGAAGG + Intergenic
1107294251 13:38893211-38893233 CCTACAAGGCTGGGGGAAGTGGG + Intergenic
1107352141 13:39526337-39526359 TATACATGGCAGGGGTTGGAGGG + Intronic
1108270232 13:48752053-48752075 GCACCAAGGCAGGGGCTGGAGGG - Intergenic
1112922296 13:104628811-104628833 CCTACAAAGCAGAGGGGGGGGGG - Intergenic
1113472853 13:110559102-110559124 CCTGCAAGGCAGGCAGTGGATGG - Intronic
1113742890 13:112723637-112723659 CCCAAAAGGGAGGGGGTAGAAGG + Intronic
1113883158 13:113640098-113640120 ACTGCAAGGCAGGAGGCGGATGG - Exonic
1113932695 13:113976674-113976696 CCTACAGGGCAGTGGGAGGTGGG - Intergenic
1114455012 14:22848573-22848595 TCTGCAAGGCAGGCGGCGGAGGG - Intronic
1115497896 14:34025137-34025159 TCTACTAGTCAGGGTGTGGATGG - Intronic
1116269324 14:42741422-42741444 CCTTGCAGGCAGGGGGTGGGGGG - Intergenic
1118372551 14:65149873-65149895 CATACAAAGCAGGTGGTGGCTGG - Intergenic
1119611494 14:76066887-76066909 TCTCCAAGGCTGGTGGTGGAAGG - Intronic
1119848401 14:77847688-77847710 CCAACAAGGCAGGGCCAGGAAGG - Intronic
1119850114 14:77861096-77861118 GCTAATCGGCAGGGGGTGGAGGG - Intronic
1119998684 14:79279502-79279524 CCAACGTGGCACGGGGTGGAGGG - Intronic
1120678617 14:87452110-87452132 CCTACACTGGATGGGGTGGAAGG - Intergenic
1121406974 14:93725096-93725118 CCTGGAAGGCAGGGTGAGGAGGG + Intronic
1122097635 14:99383161-99383183 CTTAAAGGGCATGGGGTGGAAGG + Intergenic
1122198967 14:100110519-100110541 CCTGCAGGGCTGGGGGTGAATGG + Intronic
1122886668 14:104713374-104713396 CCTAGAGGGCTGGGGGTGGTGGG - Intronic
1122976345 14:105172410-105172432 CTTCCAAGGCTGGGGGTGCACGG + Intergenic
1123072998 14:105651268-105651290 CCTCCCAGGCTGGGGGAGGACGG + Intergenic
1123092922 14:105750037-105750059 CCTCCCAGGCTGGGGGAGGACGG + Intergenic
1125672272 15:41482416-41482438 CGTACAAGGAAGGGGGACGATGG + Exonic
1126804519 15:52333008-52333030 CTTACATGGCAGAAGGTGGAAGG - Intronic
1127492084 15:59474407-59474429 CTTACATGGCAGAAGGTGGAAGG + Intronic
1127725068 15:61742165-61742187 CATACACTGCAGGGGGAGGAAGG - Intergenic
1128363156 15:66976812-66976834 CCTGAAGGGCAGGGGGTGAAGGG + Intergenic
1129453616 15:75664282-75664304 CCTTCAAGTCAGTGGGTGAAAGG + Intergenic
1132242980 15:100275293-100275315 CATGAAAGGCAGGGGGTGGGGGG + Intronic
1132251645 15:100339895-100339917 GCTAGAAGGCTGGGGGTGCAAGG - Intronic
1132638023 16:962904-962926 CCTCCAAGGCAGTGGGAGCAGGG + Intronic
1132980858 16:2738099-2738121 CCTGCCAGCCTGGGGGTGGAGGG - Intergenic
1133021403 16:2968552-2968574 TGTAGAAGGCGGGGGGTGGAAGG + Intronic
1133304666 16:4801664-4801686 CCTCCAAGTCAGCGGGGGGAAGG + Intronic
1135062967 16:19286469-19286491 CCCACAAGGCTGGGGGTTGCTGG - Intronic
1135550271 16:23392350-23392372 CCCACAAGACAGGCGGTGGGAGG - Intronic
1136409226 16:30066607-30066629 CCCACAAGGGAGGGGGCGGGTGG - Intronic
1138205084 16:55118781-55118803 CTCAGAAGGCAGGGGGTGGAGGG - Intergenic
1138521734 16:57575120-57575142 GCTACCTGGCAGGGGGTGTATGG + Intronic
1138756366 16:59490942-59490964 CCTGCAGGGGAGGGGGAGGAAGG - Intergenic
1139253503 16:65519286-65519308 GCTACATGGCAGGAGGAGGATGG + Intergenic
1140214510 16:72996610-72996632 CCTACAAGGCGGGGAGGGGCTGG + Intronic
1141774773 16:86115974-86115996 CCTGCAAAGCAGAGGGAGGATGG - Intergenic
1141900781 16:86988896-86988918 CACACAGGGCAGGTGGTGGAGGG + Intergenic
1142119678 16:88379758-88379780 GGGACAAGGCAAGGGGTGGACGG + Intergenic
1142519892 17:497488-497510 CCTACAAGGGAGCGGGGAGAGGG - Intergenic
1142669715 17:1482605-1482627 GCTACAAGGCGGGGTGGGGAGGG - Intronic
1143585287 17:7847725-7847747 TCAACCAGGCAGGGGGTGGTGGG - Exonic
1144047327 17:11465697-11465719 ACCACAAAGCAGGGAGTGGATGG - Intronic
1146437738 17:32866827-32866849 GCCACAGGGCAGGGGGAGGAAGG + Intronic
1146923073 17:36726761-36726783 CAAACAGGGCAGGTGGTGGAGGG - Intergenic
1146939156 17:36832103-36832125 CCTAGAATGCTGGGAGTGGAGGG - Intergenic
1147110414 17:38257276-38257298 CCTACGGGGAAGGGGGCGGAGGG + Intergenic
1148419094 17:47531155-47531177 CCTACGGGGAAGGGGGCGGAGGG - Exonic
1149870681 17:60178554-60178576 CCCACAAGGCTCTGGGTGGAAGG + Intergenic
1150463009 17:65368463-65368485 GATACAAGAAAGGGGGTGGAGGG + Intergenic
1151478423 17:74356344-74356366 CCCACAAGCCAGGGGGTTTAGGG - Intergenic
1151729206 17:75901073-75901095 CTAACAAGGGAGGGGGTGGCAGG - Intronic
1151926463 17:77201210-77201232 CCTGCAAGGCAGGGTATGGAAGG - Intronic
1152407287 17:80104920-80104942 CCTGCAAAGCAGGGGCTGCAGGG + Intergenic
1152498112 17:80688875-80688897 CCCACCAGGCTTGGGGTGGAAGG - Intronic
1152584217 17:81181879-81181901 CCTACAAGGTGGGGGGCGAACGG + Intergenic
1152585647 17:81188353-81188375 CCCACCCGGCAGGGGGTGCAGGG - Intergenic
1152730576 17:81967721-81967743 CCTCCAAAGCTGGGGGAGGAAGG + Intergenic
1153842461 18:9019119-9019141 ACTTGAAGGCAGAGGGTGGAAGG - Intergenic
1153868742 18:9297212-9297234 CCCACAGGGCAGGGGTTGGGGGG - Intergenic
1154379058 18:13833348-13833370 CACACACGGCAGGGGATGGAAGG - Intergenic
1160507948 18:79437685-79437707 CCGTCAGGGCAGAGGGTGGAGGG - Intronic
1161138805 19:2636204-2636226 CCTCCCACTCAGGGGGTGGATGG + Intronic
1161333516 19:3699321-3699343 CTTTCAAGGCGGGGGGTGGGGGG + Intronic
1161495422 19:4583643-4583665 CCAAGAAGGCAGGGGAGGGAGGG - Intergenic
1162306776 19:9879516-9879538 CATTCATGGCAGGGGGTGAAAGG - Intronic
1163162356 19:15472100-15472122 CCTACAGGCAAGGGGGTTGAAGG + Exonic
1163819377 19:19487397-19487419 CCTGCAAGGCAGGGGGAGGGAGG + Intronic
1164392841 19:27840734-27840756 GCAACAAGGCAGTGGGTGGAGGG - Intergenic
1164477158 19:28584775-28584797 CCCACGAGGAAGGGGATGGAAGG - Intergenic
1165243868 19:34486784-34486806 CCTACAGGGAAGGGGCAGGACGG - Intronic
1166809558 19:45507377-45507399 CCTCCAGGCGAGGGGGTGGAGGG - Intronic
1167739673 19:51316939-51316961 CCTGGGAGGTAGGGGGTGGAGGG - Intronic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925410380 2:3636472-3636494 CCTGCAAGACAGTGGGTGGTGGG - Intronic
925556478 2:5136348-5136370 TCTACAATCCAGGGGGTGGAGGG + Intergenic
927092507 2:19722801-19722823 CCTACAGGGCTGGTGGGGGAGGG - Intergenic
927285673 2:21354455-21354477 CCAAAGAGGCAGGGGCTGGAGGG - Intergenic
929819285 2:45260381-45260403 CCAACAAGGTCGGGGGAGGAAGG + Intergenic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
932128976 2:69170262-69170284 TCTCCTCGGCAGGGGGTGGAGGG - Exonic
932194257 2:69769554-69769576 TCTAAAAGGCAGGGGAAGGAGGG - Intronic
933181659 2:79234363-79234385 CCTACAAGCCAGAGGATGGTGGG - Intronic
933301518 2:80546085-80546107 CTTACAAGGCAGCTGGAGGAGGG + Intronic
933689472 2:85168539-85168561 TCTACCAGGCGGTGGGTGGATGG - Intronic
934507509 2:94905638-94905660 TCTACTATGCAGGGGGTGGGGGG + Intergenic
935947167 2:108296958-108296980 GCTACAAGGCTGGGAGTTGATGG - Intronic
937211686 2:120276802-120276824 CCTGCAAGGTAGGTGGTGGTTGG + Intronic
937666204 2:124489893-124489915 CCTATAAGGCATGGCATGGAAGG - Intronic
938066051 2:128282623-128282645 CCTGCAAGGCAGGAAGTGGCAGG + Intronic
938613031 2:132968958-132968980 CCAAGAAGGCAGGGGATGAAGGG + Intronic
942218628 2:173747261-173747283 CCAACCAGGCAGATGGTGGATGG - Intergenic
944095386 2:195961399-195961421 CCTACAAGGGTGGGGCTGGTGGG - Intronic
946025921 2:216671575-216671597 CTTACAAGGCAGTGGGAGGAGGG + Intergenic
946269732 2:218581065-218581087 TCTACATGACAGGGGGAGGAAGG + Intronic
946335889 2:219036197-219036219 CCCAGAAGGCAGGGGATGGGTGG - Intronic
947178691 2:227392822-227392844 CTTACAAGTCAGTGGGGGGATGG + Intergenic
948404114 2:237704707-237704729 TCTAGAAGGCAGGGGCTGCAAGG + Intronic
948868855 2:240788365-240788387 CCCACAAGGCAGGAGTAGGATGG - Intronic
948943419 2:241207552-241207574 CCTGCAAGGCATGGAGCGGAGGG - Exonic
1169000270 20:2163349-2163371 CCAACAAAGCAGGGACTGGAGGG - Intronic
1169379827 20:5096703-5096725 CCTGCTAGGCAGCTGGTGGAAGG + Intronic
1169482595 20:5998249-5998271 CCTATAATGCAGGGGCTGGAAGG + Intergenic
1171107937 20:22453593-22453615 TCAACAATGCAGGGGGTGGGTGG - Intergenic
1172164299 20:32889548-32889570 CCAAGTAGGCAGGGGGTGGTCGG + Intronic
1173454387 20:43190992-43191014 CCAACAAGGATGGGGGTGGGGGG - Intergenic
1174516780 20:51098673-51098695 AATAAAAGGCAGGGGGTGGAGGG - Intergenic
1176703124 21:10082573-10082595 CCTACACTGCAGAGGGTAGAGGG + Intergenic
1179473611 21:41629132-41629154 ACAAAAAGGCAGGGGCTGGAGGG + Intergenic
1179484889 21:41703941-41703963 CCTACGAGGGAGGGAGTGGGGGG + Intergenic
1182647415 22:31821557-31821579 GCTACAAGGCAGCGGGCAGAGGG + Exonic
1182749002 22:32626970-32626992 CCTCCAAAGCTGGGGGTGCAGGG - Intronic
1183414842 22:37676181-37676203 CCTTCTAGGTCGGGGGTGGAGGG + Intronic
1184177124 22:42794795-42794817 CCTGCTAGGAAGGGTGTGGACGG - Intergenic
1184246370 22:43237807-43237829 CCTAGAGAGCAGGGCGTGGAGGG - Intronic
1184592003 22:45491138-45491160 GCAAAAAGGCAGGGGCTGGAGGG - Intergenic
1184829848 22:46977753-46977775 CGTACAGGGCTGGAGGTGGAGGG + Intronic
1185083588 22:48723612-48723634 TCTTCCAGGCAGGGGGAGGATGG - Intronic
950117876 3:10463193-10463215 ACCCCAAGGCAGTGGGTGGAGGG - Intronic
950540532 3:13609660-13609682 CCTTCAAGGCAGGGTGGGGTGGG + Intronic
952049807 3:29370883-29370905 CCTACATGGCAGAGGCTAGAGGG + Intronic
952368007 3:32691936-32691958 CCTACAAGGGAGGGTGAGGTGGG + Intronic
953032849 3:39189352-39189374 CCTCCAGGGCTGGGGGTGGAGGG + Exonic
953547163 3:43872135-43872157 CCTACAAGGGCTGGGGTGGCAGG - Intergenic
953575651 3:44111255-44111277 CCTGCAAAGCAGGGGGTGTAAGG - Intergenic
954117970 3:48477783-48477805 CCCACAAGGCAGGGTGTGGAGGG - Intronic
954973028 3:54667378-54667400 CCTCCAAGGCAGAGGCTGGAAGG + Intronic
955106707 3:55905734-55905756 TCTACAAGGCAAGGGTTGCATGG - Intronic
959308009 3:104694122-104694144 CCTTCAAAGCAGTGGGTAGAGGG - Intergenic
960023339 3:112980339-112980361 CCTTCAATGAAGGGGGTTGATGG + Intergenic
961904422 3:130247809-130247831 ACTATTAGGCAGGGGGTGGGGGG + Intergenic
962904348 3:139788706-139788728 TCTATAAGGCAGGGGGTGGGGGG + Intergenic
963102442 3:141620327-141620349 CCCACAGGGCTGGGGGTGGGAGG + Intergenic
964918668 3:161868716-161868738 CCTACAAGACAGGGCTAGGAGGG - Intergenic
966516159 3:180822903-180822925 CCTTGAAGGCAGAGGGTGGGAGG + Intronic
966942588 3:184756306-184756328 CTTATAAGGCTGGAGGTGGAGGG - Intergenic
968197576 3:196721545-196721567 ACTACAAGGGAGGGTGTGGTAGG - Intronic
968899237 4:3423144-3423166 CCTACAAGCCCGGGGGTGAGAGG + Intronic
968912974 4:3485206-3485228 CCGACAGGGCATGGGGAGGAGGG - Intronic
968924545 4:3540151-3540173 GCTAGAAGGCGGGGGGTGGGGGG - Intergenic
969485586 4:7470765-7470787 CCCACAAGGCAGTGGGAGGCAGG + Intronic
969690344 4:8700828-8700850 CCCACCAGGGAGGGGGTGGCTGG - Intergenic
970007815 4:11427902-11427924 TCTACCAGCCAGGGGGCGGACGG - Intronic
970233306 4:13933131-13933153 ACCACAGGGCAGGGGTTGGAAGG + Intergenic
974121966 4:57649663-57649685 CATTCATGGCAGGAGGTGGAAGG + Intergenic
974416785 4:61618482-61618504 CCTACTAGGCTGGGGTTTGATGG + Intronic
977084055 4:92571873-92571895 CATTCAAGGCAGTGTGTGGAAGG + Intronic
979531621 4:121774453-121774475 CCAGCAAGGCAGAAGGTGGAAGG - Intergenic
980375326 4:131938940-131938962 CCTACACTGCAGAGGGTAGAGGG + Intergenic
981052371 4:140321982-140322004 CTCACATGGCAGGAGGTGGAAGG - Intronic
982734626 4:158992753-158992775 CCAACAGGGCAGCAGGTGGAAGG + Intronic
984629314 4:182043898-182043920 CTTACAAGACAAGGGGAGGATGG - Intergenic
988629058 5:32909766-32909788 CCTCCAAGAGAGGGGGCGGAGGG - Intergenic
989111707 5:37913147-37913169 CCTACAAGGAAACAGGTGGATGG - Intergenic
989507632 5:42245895-42245917 ACTACAAGGCAGGGGGCTGAGGG - Intergenic
991099392 5:62776062-62776084 CCTACAAGGAAGGGGAGAGAGGG + Intergenic
996557659 5:124795959-124795981 CCCAAAATGCAGGGGGTGGGGGG - Intergenic
997699134 5:135884185-135884207 ACTCAAAGGCAGGGGGTGGTTGG - Intronic
998936389 5:147234547-147234569 CCTAAAAGCCGGGGGGTTGAGGG - Intergenic
999144525 5:149383550-149383572 CCTACCAGGGAGGGAGGGGAGGG - Intronic
999273078 5:150309387-150309409 CCAGCGTGGCAGGGGGTGGAGGG - Intronic
1000050233 5:157556617-157556639 CCTTCATTGCAGGGTGTGGAAGG - Intronic
1001858166 5:175030824-175030846 CCTAAAAGGTAGATGGTGGAAGG + Intergenic
1001960689 5:175878886-175878908 CCTACGAGGAAGGGGTGGGAAGG - Exonic
1002638232 5:180618534-180618556 CAGACAAGGCAGGCAGTGGAGGG - Intronic
1004037603 6:11938861-11938883 TCTGTAAGGCAGGGGGTAGATGG + Intergenic
1006698095 6:35948913-35948935 CCCACATGGCAGAAGGTGGAAGG - Intronic
1006898717 6:37486559-37486581 GCTGCAGGGCAGGGGGTGGATGG - Intronic
1007430167 6:41771781-41771803 CCAACAGGGCAGGGGCTGGCCGG + Intronic
1007775540 6:44222662-44222684 CCTCCAAGGGAGGGGGAGGGAGG - Intronic
1013350413 6:109300790-109300812 CCTACAAGGCTAGAGGTAGATGG - Intergenic
1014633342 6:123814138-123814160 CCTACAAGGCAGGGGGTGGAGGG + Intronic
1015732733 6:136364771-136364793 CATACAAGGCCGGGGGCGGGTGG - Intronic
1015914980 6:138206836-138206858 CCAAGAAGGCAAGGGGTTGATGG + Intronic
1018244485 6:161809247-161809269 CCTCAAAGGCAGGGGGGGAAGGG + Intronic
1018802777 6:167236374-167236396 CCCCCAGGGCAGCGGGTGGAGGG + Intergenic
1019824539 7:3272933-3272955 CCTACAGGGCAGGGAATGAATGG - Intergenic
1020762697 7:12288199-12288221 ACTATAAGGCAGTGGGAGGAAGG + Intergenic
1022278149 7:28876550-28876572 GCTTGAAGCCAGGGGGTGGACGG + Intergenic
1023246975 7:38215525-38215547 CCTCCAAGACAGGGGGTTGTGGG - Intronic
1024903002 7:54343688-54343710 CCTCCAGGGCTGGGGCTGGACGG - Intergenic
1024939409 7:54746424-54746446 CTCACAAGGCTGGGGCTGGAGGG + Intergenic
1025212116 7:57025780-57025802 CCTCCAAGGCATGCAGTGGACGG + Intergenic
1025659838 7:63551048-63551070 CCTCCAAGGCATGCAGTGGACGG - Intergenic
1027540117 7:79454603-79454625 TCTACAGGGCTAGGGGTGGAGGG + Intergenic
1029115184 7:98233098-98233120 CCAACAGGGCAAAGGGTGGAAGG - Intronic
1029488009 7:100854796-100854818 CCTGCTAGGGAGGGTGTGGAAGG + Intronic
1029675294 7:102064535-102064557 CCTCCAAGGCATGCAGTGGATGG + Intronic
1030215523 7:107041342-107041364 CCTAGAAGGAAGGGAGGGGAGGG + Intergenic
1030546277 7:110900243-110900265 CCTACATGGCAGGGTGTCAAGGG - Intronic
1031377363 7:121043708-121043730 CCTACAAGGCAGTGACTGGCTGG - Intronic
1031389480 7:121195994-121196016 CCTAGAAGGCCGGGGGGAGATGG + Intronic
1032359991 7:131246224-131246246 CCGACAAGGCAGGGTGCAGAGGG - Intronic
1032403099 7:131637461-131637483 CCTAAAGGGAAGGGGGTGGTAGG + Intergenic
1033072054 7:138212408-138212430 CCTTCAAGGCAGGGACTGGTGGG + Intergenic
1034270563 7:149801759-149801781 CCCACAAGGCAGGGAGAGAAGGG - Intergenic
1035219737 7:157399251-157399273 CAGACAAGGCAGGGGATGGCGGG - Intronic
1037082074 8:14799642-14799664 CCTACTAGGCAGAGGAAGGAGGG + Intronic
1039170235 8:34736884-34736906 CCTACATGGGTGGGGCTGGAAGG - Intergenic
1041106996 8:54453962-54453984 CCTCCAAGGCAGGGGGCGCGCGG + Intergenic
1041403663 8:57472474-57472496 CTCACATGGCAGAGGGTGGAAGG + Intergenic
1041815171 8:61962299-61962321 CTTACATGGCAGAAGGTGGAAGG + Intergenic
1046468924 8:114642794-114642816 CCTGCGAGGCAGAGGTTGGAGGG - Intergenic
1046623152 8:116549389-116549411 CTTACAGGGCAAGAGGTGGAAGG - Intergenic
1048999736 8:139817147-139817169 CCTGCAAGGCATGGGGCTGATGG - Intronic
1049276747 8:141723775-141723797 CCTACATGGCAGAGCGGGGAAGG - Intergenic
1049591590 8:143465291-143465313 CCAGGAAGGCAGGGGGTGGACGG - Intronic
1049663450 8:143831027-143831049 TCCACAATGGAGGGGGTGGATGG + Intergenic
1051165935 9:14261953-14261975 ATTGCAAGGCAGGAGGTGGAGGG + Intronic
1051287339 9:15510601-15510623 CCCAAAAGGGAGGGGGTGCATGG + Intronic
1051527360 9:18061111-18061133 CTCTCAAGGCAGGGGTTGGAGGG + Intergenic
1051712277 9:19944103-19944125 ACTACTAGGCAGGGGAGGGAGGG + Intergenic
1052438034 9:28455793-28455815 TCTACAAGGCAGGGGGATGTGGG - Intronic
1053312706 9:37029522-37029544 GCTCCAAGGCCGGGGGTGAAAGG - Intronic
1053640383 9:40069606-40069628 CCTACACTGCAGAGGGTAGAGGG + Intergenic
1053765752 9:41395867-41395889 CCTACACTGCAGAGGGTAGAGGG - Intergenic
1054321078 9:63665602-63665624 CCTACACTGCAGAGGGTAGAGGG + Intergenic
1054544365 9:66307020-66307042 CCTACACTGCAGAGGGTAGAGGG - Intergenic
1055341358 9:75287496-75287518 CCTACAAGCCAGAAGGGGGAGGG - Intergenic
1055671059 9:78606530-78606552 CTTCCATGGCAGGGGGTGGGGGG + Intergenic
1059387323 9:113974737-113974759 CAGACCAGGCAGGGGGTGCAGGG - Intronic
1060979361 9:127783873-127783895 ACTACCAGGGAGGGGCTGGAAGG - Intergenic
1061382535 9:130266806-130266828 GCTGCAAGGCAGGGGGTTAAAGG - Intergenic
1061416014 9:130447202-130447224 CCTAGGAGCCAGGGAGTGGAAGG + Intronic
1061885155 9:133587632-133587654 CCCACCAGGCAGGGTGTGGGAGG + Intergenic
1062483503 9:136763208-136763230 CCTAAAAGGCGGGGGGCGGAGGG + Intronic
1062737729 9:138147598-138147620 CCGTCAAGGCAGGGGATGGCGGG + Intergenic
1202788153 9_KI270719v1_random:52679-52701 CCTACACTGCAGAGGGTAGAGGG + Intergenic
1186123537 X:6387868-6387890 CCAATAAAGCAGGTGGTGGAAGG + Intergenic
1186276731 X:7947245-7947267 GCCAAGAGGCAGGGGGTGGAGGG - Intergenic
1187362413 X:18640976-18640998 ATTGCAAGGCAGAGGGTGGAGGG + Exonic
1188043569 X:25399289-25399311 ACTAGAAGGCAGAGGGAGGAAGG + Intergenic
1189201226 X:39197253-39197275 CCTTCATGGCAGAGGCTGGATGG + Intergenic
1192235414 X:69292406-69292428 CCTACATGGCACGGCGGGGAGGG - Intergenic
1192321735 X:70095422-70095444 CCTACAATACAGGGGGTGAGAGG - Intergenic
1194321270 X:92448535-92448557 TCTACATGGCAGGGGGTGGAGGG - Intronic
1194762796 X:97814512-97814534 CCCACAAGCCAGGGAGTAGAAGG - Intergenic
1194865121 X:99055504-99055526 CCAACAAAGTGGGGGGTGGATGG + Intergenic
1195265920 X:103179643-103179665 CTTACATGGCAGAAGGTGGAAGG + Intergenic
1195275394 X:103276124-103276146 CCTGCAAGGCAGCGGGAGGCGGG - Intronic
1196119294 X:112031300-112031322 CATTCAAGGCAGGGACTGGAGGG - Intronic
1196130895 X:112155022-112155044 CTCACATGGCAGGAGGTGGAGGG - Intergenic
1196480664 X:116143105-116143127 CCTACAATTCAGGGGGTAGGAGG + Intergenic
1197538386 X:127722793-127722815 CTTACATGGCAGTGGGGGGAGGG - Intergenic
1198412999 X:136390670-136390692 CCTACAGTGCAAAGGGTGGAAGG + Intronic
1198769303 X:140111828-140111850 CCTACAGGGCAGGGGGCTGGGGG + Intergenic
1199970714 X:152858678-152858700 CCTACAAGCCACAGGTTGGAGGG + Intronic
1200629387 Y:5561682-5561704 TCTACATGGCAGGGGGTGGAGGG - Intronic