ID: 1014634373

View in Genome Browser
Species Human (GRCh38)
Location 6:123826640-123826662
Sequence ACCTTGAAGATATTACATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 245}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014634373 Original CRISPR ACCTTGAAGATATTACATTA AGG (reversed) Intronic
900842223 1:5062025-5062047 ACATTGAAAACATTACATTATGG + Intergenic
905056944 1:35103429-35103451 ACCTTGAAAATATTATGCTAAGG - Intronic
907583225 1:55590820-55590842 ACTTTAAGGATATTACACTAAGG - Intergenic
908123388 1:61006745-61006767 AACTTGAAAATTTCACATTAGGG - Intronic
909048483 1:70739258-70739280 ACAATAACGATATTACATTATGG - Intergenic
909745539 1:79092236-79092258 ATCTAGAACATATTATATTATGG - Intergenic
910010556 1:82456303-82456325 ACATTGAATACATTACAGTAAGG + Intergenic
910513513 1:88034065-88034087 ACATTGAAAACATTACGTTAAGG + Intergenic
913344907 1:117798587-117798609 ACCTTGAAAGTATTCCATTAAGG + Intergenic
916799743 1:168205317-168205339 ACCTTGAAAATATTACAGTGTGG + Intergenic
916883824 1:169047801-169047823 ACTTTGAATATATTGAATTAAGG - Intergenic
917402698 1:174668390-174668412 AACTAAAAGATATTACATTAAGG - Intronic
919094555 1:193014572-193014594 ACTTTTAAAATATTACATTTAGG + Exonic
919286210 1:195563447-195563469 ACCTAGAGGACATTATATTAAGG + Intergenic
919286561 1:195569189-195569211 AACTTGAAAATACTATATTATGG + Intergenic
921483262 1:215688118-215688140 TCCTTGAAGAAGTTACATTTAGG + Intronic
921785974 1:219229841-219229863 ACCTTGATAATATTAGTTTAGGG - Intergenic
921949282 1:220912431-220912453 ATCTTAAAAATATTACCTTAGGG + Intergenic
922901665 1:229141832-229141854 TCCTTGAAGATCTGACATAAAGG + Intergenic
923486915 1:234441832-234441854 ACCTTGAAAACATTATCTTAAGG - Intronic
923975001 1:239252582-239252604 ACCTGGAAGATACTAAATTTGGG + Intergenic
924199565 1:241644851-241644873 ACCTTGAAAACATTACGATAAGG + Intronic
924365930 1:243293576-243293598 ACCTTGAAAATATTATGCTAAGG - Intronic
924399123 1:243659131-243659153 ACTTTGAAGACATTATACTAAGG + Intronic
924642656 1:245848907-245848929 TCCTTGGAGATATTTCATTCTGG - Intronic
1063090019 10:2856411-2856433 ACTATGATGATATTATATTATGG + Intergenic
1064788135 10:18922138-18922160 ACTTTGAAGATATTATGCTAAGG - Intergenic
1065172831 10:23049060-23049082 GCCTTGAAGATATTAAATGATGG + Intergenic
1065545547 10:26816658-26816680 ACCTCGAATGTTTTACATTATGG + Intronic
1067111832 10:43406839-43406861 CCCTTGTAGGTATTACATTCCGG - Intronic
1069270883 10:66525931-66525953 ACCTTGAAAATATTATGTTAAGG - Intronic
1072966760 10:99980505-99980527 ACCTTGAAGACATTAAGCTAAGG + Intronic
1074334361 10:112554611-112554633 ACAATGATGATATTACATGATGG - Intronic
1075074030 10:119338432-119338454 AGCTAGAAGAAATTACATGAAGG - Intronic
1077809880 11:5626361-5626383 ATCTTCAAGAAGTTACATTAGGG + Intronic
1078060889 11:8042256-8042278 ACCTAGAAAATATTATACTAAGG - Intronic
1078536221 11:12176757-12176779 ACCTTGAAGACATTATGCTAAGG - Intronic
1078936246 11:15952913-15952935 ACCTTGTACAGATTACATTTTGG - Intergenic
1078998261 11:16726802-16726824 ATTTTGAGGATATTACATTTTGG - Intronic
1080981605 11:37413794-37413816 ACCTTAAAGATTTCACATTCTGG - Intergenic
1083013737 11:59429209-59429231 AGCTTGCAGATGTCACATTATGG + Intergenic
1086282409 11:85206060-85206082 ATCTTGAGGATAGTACAGTAGGG - Intronic
1086957740 11:92950964-92950986 ACCATGCTGACATTACATTATGG - Intergenic
1087126654 11:94634246-94634268 ATCTTTAAGATATTAAAGTAGGG + Intergenic
1090577285 11:128119298-128119320 ACCTTGAAGACATTATGCTAAGG - Intergenic
1090761831 11:129844161-129844183 ACCTTGAAGACCTTATACTAAGG + Intronic
1091540484 12:1456570-1456592 ACCTTGAAGAGATAAAATAATGG - Intronic
1093354141 12:18142777-18142799 AATTTGAAGATCTCACATTATGG + Intronic
1093762976 12:22931046-22931068 ACCTGGAATATATTCCATGATGG + Intergenic
1093925350 12:24903382-24903404 ACCTCGGAGAAACTACATTAGGG + Intronic
1095256248 12:40040333-40040355 ATCATGAAGATATTACAGTGTGG - Intronic
1096125978 12:49119972-49119994 TCCTTGAAGAAATGACATTTGGG + Intergenic
1099174492 12:79404905-79404927 ACCTGGAGGTTAATACATTAAGG + Intronic
1099518498 12:83629250-83629272 AACTTGAAAATTTTACATTTGGG + Intergenic
1100062899 12:90603381-90603403 TCCTTAAAGAGATTTCATTAAGG + Intergenic
1100427339 12:94499504-94499526 ACCTTTAAGCTCTTACCTTAAGG + Intergenic
1101173881 12:102128607-102128629 ACCTGGAAAACATTATATTAAGG - Intronic
1101971757 12:109319287-109319309 ACTTTGAAGATGTTACACTAAGG + Intergenic
1104110215 12:125697709-125697731 AACTAGAAGATATTGTATTATGG + Intergenic
1105778912 13:23689542-23689564 ACCTTGAAGACATTATGCTAAGG + Intergenic
1107751268 13:43570082-43570104 ACCTTTAAGATTTTCCATTAGGG + Intronic
1108948196 13:56050519-56050541 ACCATGAAGATAATAAATAAAGG + Intergenic
1109143155 13:58742238-58742260 ACCTGGGAGATATAACCTTATGG - Intergenic
1109356838 13:61240905-61240927 TCCTTGAAATTATAACATTATGG - Intergenic
1110811289 13:79813140-79813162 ACCTTGAAAACATTATGTTAAGG - Intergenic
1114584062 14:23793785-23793807 ACCTTGTAGACATTAGATTCTGG - Intergenic
1116082142 14:40187644-40187666 CTCTTGAAGATATGACATAAGGG - Intergenic
1116287919 14:42996520-42996542 TCCATGAATATATTACATAATGG + Intergenic
1116387968 14:44356222-44356244 ACTTTGCAGATATTGCATTTTGG - Intergenic
1117235601 14:53771217-53771239 ACTTTAATGATATTAAATTAGGG - Intergenic
1117728963 14:58702387-58702409 ACCTTGAAGAAATTCACTTATGG + Intergenic
1118364148 14:65079867-65079889 TCCTTGAGGAAATTACCTTAAGG - Intronic
1118794093 14:69124101-69124123 ACCTTGAAGACATTATGCTAAGG - Intronic
1119017088 14:71069518-71069540 ACCTTGGAGATATTGCATGTTGG + Intronic
1122449878 14:101797190-101797212 ACCTGGAAGATATTATGTTTAGG - Intronic
1122528294 14:102405889-102405911 ACCTTGAAGATACTGTGTTAAGG + Intronic
1125873818 15:43126514-43126536 ACCTTGAAGCCATTATGTTAAGG + Intronic
1125907571 15:43407557-43407579 TCCTTGCAGATATTGCTTTAGGG - Exonic
1126327058 15:47490348-47490370 ACTTTGAAGAAATTACATCCAGG + Intronic
1128847139 15:70909173-70909195 ACCTTGAAAATTATACATCAGGG - Intronic
1132168603 15:99623186-99623208 ACCTTGAAGACATTAGGTAAGGG - Intronic
1132348850 15:101125276-101125298 ACCTTGAAAACATTACGCTAAGG + Intergenic
1134283200 16:12836341-12836363 AACTTGAACATATCACTTTAAGG - Intergenic
1135197598 16:20407503-20407525 AACTGGAAGTCATTACATTAAGG + Intergenic
1137226999 16:46523062-46523084 ACTTTGAAAATATTCCATTGAGG + Intergenic
1137397855 16:48129221-48129243 TCCTTGAAGAGATTACAGTCTGG + Intronic
1138429474 16:56959504-56959526 ACCTTGAAGACATTCCTCTAAGG + Intergenic
1139625589 16:68185948-68185970 TCCTAGAGGATATTACATTTGGG + Intronic
1141888895 16:86913255-86913277 ACCTTGAAAATAGTATATGAGGG + Intergenic
1145319005 17:21752175-21752197 ACCTTGAGGACATTACGCTAAGG + Intergenic
1146023738 17:29301468-29301490 AACTTTCAGATATTTCATTAAGG + Intergenic
1146464312 17:33074254-33074276 TCCTTGAAGATTTTACTATATGG - Intronic
1146710648 17:35038506-35038528 AGCTTGAGGCTATTACAGTAGGG - Intronic
1150326890 17:64264452-64264474 ACGTTGAAGATCTGACATTTGGG - Intergenic
1152972146 18:172886-172908 ACCTTGAAGATATTACAGTTTGG - Intronic
1153483179 18:5567995-5568017 AGCATAAAAATATTACATTAGGG + Intronic
1158243810 18:55407878-55407900 ACAATGAAAATATTACATGAAGG + Intronic
1159124773 18:64210042-64210064 ACTTTGAGGATATTACCTAAAGG - Intergenic
1159503916 18:69309902-69309924 ACATTGTAGATACTACATTTGGG + Intergenic
1159688322 18:71452307-71452329 ACCTGGAAGACATTATGTTACGG + Intergenic
1159744153 18:72210672-72210694 ACCTTGGCGCTAGTACATTATGG + Intergenic
1166472864 19:43095339-43095361 ACCTTGAAGACATTATGTGAGGG + Intronic
1167881207 19:52459377-52459399 ACCTTGAGGACATTACACTAGGG - Intronic
926538653 2:14146648-14146670 ACCATGGAGATATTTCTTTAGGG + Intergenic
926851459 2:17202712-17202734 ACCTTGATTATATCACAGTAAGG - Intergenic
926851632 2:17204487-17204509 ACCTTGATTATATCACAGTAAGG + Intergenic
928139410 2:28715419-28715441 ACTTTGAAGATATGTTATTAAGG - Intergenic
929001941 2:37355712-37355734 AATTTGAAGATAATACATTTGGG + Intronic
931301797 2:60987362-60987384 TCCTTGCAAATATTACATCAAGG - Intronic
933293183 2:80460507-80460529 ACCTTGCATATAGTACATAAAGG - Intronic
935900527 2:107787613-107787635 ACCATGAACACATGACATTAGGG + Intergenic
937343956 2:121111310-121111332 ACCATGAAGTTGTTACATCATGG + Intergenic
938983615 2:136551007-136551029 ACCTTGAAAACATTATACTAAGG - Intergenic
939225600 2:139360027-139360049 ACCAAAAAGCTATTACATTATGG + Intergenic
939764568 2:146230413-146230435 ACTCTGTAGATATTACTTTATGG - Intergenic
940665892 2:156609263-156609285 ACCTAGAATATATTAGTTTATGG + Intronic
941297053 2:163752306-163752328 ACCTTGCATCTATTCCATTAGGG - Intergenic
943011237 2:182452340-182452362 ACATTGAAGATATTTCCTTCAGG - Intronic
943430482 2:187794496-187794518 ATCCTGAAGATATTTCACTAAGG + Intergenic
945214644 2:207420524-207420546 ACCTTGAACCTAGTACATAAAGG - Intergenic
947245148 2:228038423-228038445 ACCTGGAAGATTCTGCATTACGG + Intronic
947377876 2:229515610-229515632 AACTTGAAGATATTTGATTTGGG - Intronic
1169236992 20:3937737-3937759 ACCTTGAAGACATTATGCTAAGG - Intronic
1170088726 20:12566755-12566777 ACCTTGTAGATATATCATTTGGG + Intergenic
1173355711 20:42287440-42287462 AACTAGAGGACATTACATTAAGG + Intronic
1174854067 20:54026198-54026220 AACTTGAAAATATTACACAAGGG + Intronic
1177166398 21:17610035-17610057 ACCTTGAATACATCACACTAAGG + Intronic
1177369317 21:20180766-20180788 ACCTTAAAGATTCCACATTAGGG - Intergenic
1177945059 21:27457143-27457165 ACCCTGAAGATATTGGATTAAGG - Intergenic
1178252557 21:31018446-31018468 ACCCTGAAGAAATTCCCTTAAGG - Intergenic
1178456032 21:32752401-32752423 ACTATGAAGATATGACAGTAAGG + Intronic
951031255 3:17884514-17884536 ACATAAAAGATATTACATTAAGG - Intronic
951307132 3:21078420-21078442 CCCTTGAAAATATTCCATAAGGG + Intergenic
952943212 3:38458851-38458873 ACCTTGACACTATTACATTTTGG + Intronic
953110545 3:39933647-39933669 ACCTTGAATATATTTCTTGAAGG - Intronic
954947157 3:54435648-54435670 ACATTTTGGATATTACATTATGG - Intronic
955439327 3:58939018-58939040 ACTTTGAAGACATTGCCTTAGGG - Intronic
956506132 3:69942336-69942358 ACCTTTAAAAAATTTCATTATGG - Intronic
956545746 3:70400261-70400283 ACCCTGAAGATATTAGAAGATGG + Intergenic
956925076 3:73977470-73977492 ACATTGAACCTATTACTTTAGGG - Intergenic
957802929 3:85108405-85108427 ATCTTGAAGATATTATACTAAGG + Intronic
960893498 3:122477136-122477158 ACCTGGAGGATATTATGTTAAGG + Intronic
961197841 3:125018237-125018259 ACCTTGAAAACATGACACTAAGG + Intronic
963008956 3:140751616-140751638 TCCATGAAGATATTTCTTTAGGG + Intergenic
963285238 3:143428793-143428815 ACCTGGAGGACATTACATTAAGG + Intronic
964002064 3:151786783-151786805 ATATTGGAGATATTACATTGTGG - Intergenic
964640326 3:158903108-158903130 CCCTTGCAGATATTACATGAGGG + Intergenic
965129167 3:164672714-164672736 AACCTGAACATGTTACATTAGGG + Intergenic
965233552 3:166085517-166085539 ACATTGATTATATTAGATTAGGG + Intergenic
968315428 3:197720294-197720316 ACCTGGAGGATGTTACCTTAAGG - Intronic
969100883 4:4767452-4767474 ACCTTGAAGATATTGTGCTAAGG + Intergenic
970745734 4:19293073-19293095 ACAAAGAAGATATTACATAATGG - Intergenic
971170038 4:24224645-24224667 CCCTTGAGGAGCTTACATTATGG + Intergenic
972447234 4:39156707-39156729 GCCTAGAAGACATTACACTAAGG + Intergenic
973121911 4:46531437-46531459 ACTTTCAAAATATTACATTTAGG - Intergenic
974651693 4:64762267-64762289 ACCTTAAAAATATTATACTAAGG - Intergenic
974689974 4:65285807-65285829 ACCTTAAAGGTATTAAGTTAAGG + Intergenic
974866432 4:67587073-67587095 ACATGGAAGATATTAAATTCAGG - Intronic
975981672 4:80168052-80168074 ACCTTGAAAACATTATACTAAGG - Intergenic
976183072 4:82417554-82417576 ACCTAGAAGACATTATGTTAAGG - Intergenic
976580960 4:86736584-86736606 AATTTAAAGATATTAAATTATGG + Intronic
978497275 4:109373884-109373906 ACCTTGAATATAATAGAGTATGG + Intergenic
979659142 4:123232723-123232745 AACTTGAAGATACTGCATTGGGG + Intronic
981094696 4:140766380-140766402 ACCTTAAATATAAAACATTAAGG + Intergenic
981554228 4:145975305-145975327 ATCTTGAAGATTTTACCTTATGG - Intergenic
981594401 4:146402735-146402757 GCCTTGAAGACATTCCATTTTGG + Intronic
984774958 4:183473595-183473617 ACCCTGAAGATATTATGCTAAGG - Intergenic
986325288 5:6668638-6668660 ACCTTGAAGAGATCACTGTAGGG - Exonic
988401696 5:30769755-30769777 ACTTTGAATATATAACATTATGG + Intergenic
988508427 5:31844399-31844421 AGCTTGAAGATATTCCTTTATGG - Intronic
988983874 5:36597971-36597993 TCCTCGAGGATCTTACATTATGG - Intergenic
990311155 5:54540087-54540109 AGCTTGAAGATATTACATGCTGG + Intronic
991908735 5:71539319-71539341 TCCTTGAAGATATTATTTAATGG + Intronic
992673789 5:79085046-79085068 ACCTTGATGATAGTAAAGTATGG - Intronic
994659507 5:102636844-102636866 AGCTTGATGATATTGAATTATGG + Intergenic
997173674 5:131751717-131751739 ACCTTGAAAACATTAGGTTAAGG + Intronic
1000742265 5:164984491-164984513 ACCTAACAGATATTACATTAGGG - Intergenic
1001174170 5:169449813-169449835 ACATTGAAGATATTTAATTTTGG - Intergenic
1001271779 5:170318040-170318062 ACCTTGAGGATATTATGCTAAGG + Intergenic
1004958346 6:20756243-20756265 ATATTGAATATATTACATTTTGG - Intronic
1005579036 6:27216256-27216278 ACCTTGAAAATATTATGCTAAGG + Intergenic
1005711850 6:28510990-28511012 AATTTCAAGATATTACATGAAGG - Intronic
1007989169 6:46237532-46237554 ACCTTGACAATGTTCCATTAAGG + Intronic
1007990262 6:46247630-46247652 ACCTTGAAAACATTATACTAAGG - Intronic
1008169259 6:48182191-48182213 CCCTTGAAAATATTACACTAAGG + Intergenic
1008717420 6:54306007-54306029 ATCTTGTAGATCTTACATTTTGG + Intergenic
1010113665 6:72274204-72274226 ACAGTGAAGATTTTAAATTATGG + Intronic
1010361115 6:74995649-74995671 ACTATGAAAATATTACATTTAGG + Intergenic
1011321523 6:86098982-86099004 ACCATGGATATATTACATAATGG + Intergenic
1011518366 6:88177137-88177159 GCCTTGAAGATTTTACAGTGTGG + Intergenic
1011780237 6:90780588-90780610 ACCTTGAACATGTTTCCTTAGGG + Intergenic
1011780312 6:90781806-90781828 AGATTGATGATATTACATTAAGG - Intergenic
1012271033 6:97211478-97211500 AAGATGAAGATTTTACATTAGGG - Intronic
1012525558 6:100172965-100172987 CACTTCAAGATAGTACATTATGG + Intergenic
1012732159 6:102897148-102897170 ACCTTGAATATACTGCAGTATGG + Intergenic
1012927612 6:105283223-105283245 ACGTTGAAGATCTTTCATTCTGG - Intronic
1013557955 6:111276056-111276078 TCCTTGAAGACATTATGTTAAGG - Intergenic
1014634373 6:123826640-123826662 ACCTTGAAGATATTACATTAAGG - Intronic
1015784070 6:136902274-136902296 ACCTTGCTGATGTTACTTTAAGG + Intronic
1016069165 6:139717838-139717860 TCTTTGAAGATTTTAAATTATGG + Intergenic
1016153600 6:140775577-140775599 CCTTTGAAGTTTTTACATTAAGG - Intergenic
1016705079 6:147097342-147097364 ATTTTGAAGGTATTACATTTTGG - Intergenic
1017496481 6:154988102-154988124 ACCTTAAAGATATTACCTCTAGG - Intronic
1018104495 6:160469915-160469937 AGCTCAAAAATATTACATTAAGG - Intergenic
1018498800 6:164380125-164380147 AGCTTGAAGATGTTAAATTTTGG + Intergenic
1018604515 6:165583507-165583529 ACCTTGAAGTTATATCATTTAGG - Intronic
1020594217 7:10183789-10183811 TCCCTGAAGATATTACTTTCTGG - Intergenic
1020750701 7:12137688-12137710 ACCTTAAACATATTACATATGGG - Intergenic
1020936808 7:14475384-14475406 ATCCTGAATATATCACATTATGG + Intronic
1023465743 7:40452541-40452563 ACCTTGGATATATTATATTTTGG - Intronic
1023508339 7:40923291-40923313 ATGTTGAAGATATTACATGCAGG + Intergenic
1026423500 7:70265730-70265752 ACATTGAAAACATTATATTATGG + Intronic
1027740354 7:81995157-81995179 AGGTTGAAAATATTTCATTAAGG - Intronic
1028758907 7:94472106-94472128 ACTTTGAAGATATTTGTTTATGG - Intergenic
1030397269 7:109002496-109002518 GACTTTAAGGTATTACATTAAGG + Intergenic
1031225931 7:119037750-119037772 GACTTGAAGATAGTACATTTTGG - Intergenic
1032612243 7:133427401-133427423 ACCTTGAAACTATTATCTTATGG + Intronic
1033874626 7:145799681-145799703 ACTTTGAATATATTACTTCATGG - Intergenic
1033893920 7:146048314-146048336 ACTTTTAAGATATTTCTTTAGGG + Intergenic
1033918358 7:146356381-146356403 ACCTTGAAGCTATTAATTAATGG - Intronic
1035128835 7:156631867-156631889 AACTTTAAGATTTTAAATTATGG - Intergenic
1035309863 7:157960040-157960062 ACCTTGAGGATATTATGTTAAGG + Intronic
1035938187 8:3866136-3866158 ACTCTGAAGATATAACATTAAGG + Intronic
1036449963 8:8857334-8857356 GCCTGGAAGATATCTCATTATGG - Intronic
1036984564 8:13513741-13513763 ACCTTGAAGAGACTACAGTCAGG + Intronic
1038775817 8:30529695-30529717 ACCTTGATGACATTACGCTAAGG - Intronic
1041853784 8:62424998-62425020 ACCTTGAGGACATTATGTTAAGG + Intronic
1044305951 8:90641505-90641527 ACCTTAAAGATCAGACATTATGG - Intronic
1045102261 8:98856916-98856938 ACCTTGAAAACATTACAGTAAGG + Intronic
1045156479 8:99479551-99479573 AACTTGAAGATGTTAGATTGTGG - Intronic
1045670916 8:104552601-104552623 AACTGGAAGATAGTACTTTAAGG - Intronic
1045914492 8:107450654-107450676 CCCTTGAAAATATTTCATTTGGG - Intronic
1046359999 8:113139301-113139323 ACCTTGAATTTTTTAAATTATGG + Intronic
1046583740 8:116125393-116125415 ACCATGAAGATACTGCATTGTGG - Intergenic
1046619155 8:116509453-116509475 ATCTTCTAGATATTAAATTAGGG + Intergenic
1048063083 8:130940672-130940694 ACCTTGAAAAGATCACATAAAGG + Intronic
1048684238 8:136884916-136884938 ACCTTAATGATATTATTTTAAGG - Intergenic
1048753538 8:137706504-137706526 ACATGGAAGATATTACTTGAAGG - Intergenic
1048906219 8:139092036-139092058 ACCTGGTTGATATTACATGATGG + Intergenic
1050802428 9:9632263-9632285 ACCTTGAAAACATTACACTAAGG + Intronic
1050807263 9:9696134-9696156 CCCATGAATATATTCCATTATGG + Intronic
1050888326 9:10792294-10792316 ACCTGGAAGACATTATACTAGGG - Intergenic
1051580619 9:18669856-18669878 ACCTTGAATACCTTACATCAAGG - Intronic
1052167901 9:25356583-25356605 ACCTTCAAAAAATTACAATATGG - Intergenic
1052264542 9:26556520-26556542 ACCTTGAGGGTATTATGTTAAGG - Intergenic
1052322133 9:27179513-27179535 ACATTGAAAATGTTACATTATGG + Intronic
1053727706 9:41021150-41021172 ACCTTGATGATATTTCCTCATGG - Intergenic
1055230358 9:74056483-74056505 ACCTTAAACATAGTACATAAAGG - Intergenic
1056344948 9:85683348-85683370 GCCTTTAAAATATTACATCAAGG - Intronic
1057007362 9:91572526-91572548 ACATTGAAGATATTTTACTAAGG - Intronic
1059071824 9:111146148-111146170 ACCTTGAGGATTTTAGTTTATGG - Intergenic
1061706931 9:132460474-132460496 ACCTTGAAAACATTATACTAAGG + Intronic
1062317599 9:135976099-135976121 ACCTGGAAGACATTACGCTAAGG - Intergenic
1186095438 X:6096433-6096455 ATCTTGAGGCTATCACATTAAGG - Intronic
1186649678 X:11545403-11545425 ACCTTGAAGGGAATAAATTATGG - Intronic
1186704179 X:12124536-12124558 AACTTAATGATATTACAATATGG + Intergenic
1186915535 X:14215458-14215480 ACTTTGAAGATCTTAAATTTGGG - Intergenic
1186971215 X:14846211-14846233 ACCTTGAAGTTTTTACATCATGG + Intronic
1187759385 X:22563451-22563473 ACCTTGAAGACATTACGCTAAGG - Intergenic
1187916908 X:24161998-24162020 CTCTTGAATATGTTACATTAGGG - Intronic
1188762748 X:34052304-34052326 TTCTTGAAGATATTACCTAATGG - Intergenic
1189822148 X:44880488-44880510 ACCTTAAAAATAATACAATAAGG + Intronic
1192942644 X:75929093-75929115 ACCCTGAAGATATTATCTCAAGG - Intergenic
1193117969 X:77793897-77793919 ACCTTAAAGATACTATGTTAAGG + Intergenic
1194190332 X:90827454-90827476 ACATTGAATATATTAACTTAAGG + Intergenic
1194856895 X:98941666-98941688 ACCTTGAAGACATTATGCTAAGG + Intergenic
1195998592 X:110757466-110757488 ACTTTGAAGATATTACTAAATGG - Intronic
1196499843 X:116366871-116366893 ACCTTGAACATGTTACAACATGG + Intergenic
1196698657 X:118641862-118641884 ACCTTTGAGTTCTTACATTATGG - Intronic
1197307497 X:124861990-124862012 AGCTTGAATATATTACCATAAGG + Intronic
1198982531 X:142415750-142415772 AACTAGAAGATATAACATAAAGG + Intergenic
1199300444 X:146207300-146207322 ACAATGAAGATATTAGGTTAGGG + Intergenic
1199864461 X:151830278-151830300 TCACTGAAGACATTACATTAGGG + Intergenic
1200536987 Y:4409874-4409896 ACATTGAATATATTAACTTAAGG + Intergenic
1200544506 Y:4503294-4503316 ACTTTGAAGATTTTCCAATAAGG + Intergenic