ID: 1014635593

View in Genome Browser
Species Human (GRCh38)
Location 6:123843065-123843087
Sequence CTAGGGTTGTCCATGACCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 126}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014635592_1014635593 -10 Left 1014635592 6:123843052-123843074 CCTGCGACAATATCTAGGGTTGT No data
Right 1014635593 6:123843065-123843087 CTAGGGTTGTCCATGACCTCTGG 0: 1
1: 0
2: 0
3: 10
4: 126
1014635587_1014635593 1 Left 1014635587 6:123843041-123843063 CCCTGTACCGGCCTGCGACAATA 0: 1
1: 0
2: 0
3: 2
4: 16
Right 1014635593 6:123843065-123843087 CTAGGGTTGTCCATGACCTCTGG 0: 1
1: 0
2: 0
3: 10
4: 126
1014635590_1014635593 -6 Left 1014635590 6:123843048-123843070 CCGGCCTGCGACAATATCTAGGG 0: 1
1: 0
2: 0
3: 1
4: 44
Right 1014635593 6:123843065-123843087 CTAGGGTTGTCCATGACCTCTGG 0: 1
1: 0
2: 0
3: 10
4: 126
1014635585_1014635593 25 Left 1014635585 6:123843017-123843039 CCTTTGGGTGCTGGCAGGAATGA 0: 1
1: 0
2: 5
3: 37
4: 196
Right 1014635593 6:123843065-123843087 CTAGGGTTGTCCATGACCTCTGG 0: 1
1: 0
2: 0
3: 10
4: 126
1014635588_1014635593 0 Left 1014635588 6:123843042-123843064 CCTGTACCGGCCTGCGACAATAT 0: 1
1: 0
2: 0
3: 0
4: 15
Right 1014635593 6:123843065-123843087 CTAGGGTTGTCCATGACCTCTGG 0: 1
1: 0
2: 0
3: 10
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014635593 Original CRISPR CTAGGGTTGTCCATGACCTC TGG Intronic