ID: 1014644975

View in Genome Browser
Species Human (GRCh38)
Location 6:123961701-123961723
Sequence CTCTTTTTGATAATAGTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014644972_1014644975 28 Left 1014644972 6:123961650-123961672 CCGAAAATGACCACTGCTACTTT 0: 1
1: 0
2: 4
3: 28
4: 225
Right 1014644975 6:123961701-123961723 CTCTTTTTGATAATAGTGTAGGG No data
1014644973_1014644975 18 Left 1014644973 6:123961660-123961682 CCACTGCTACTTTGCATTTGTGA 0: 1
1: 0
2: 2
3: 28
4: 225
Right 1014644975 6:123961701-123961723 CTCTTTTTGATAATAGTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014644975 Original CRISPR CTCTTTTTGATAATAGTGTA GGG Intronic
No off target data available for this crispr