ID: 1014653125

View in Genome Browser
Species Human (GRCh38)
Location 6:124065992-124066014
Sequence GAGATTAAAGAGAAGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 714
Summary {0: 1, 1: 0, 2: 6, 3: 76, 4: 631}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014653125 Original CRISPR GAGATTAAAGAGAAGGAAGT GGG Intronic
900032047 1:379284-379306 GAGACTCAAGAGGAGGAAGAGGG - Intergenic
900052596 1:607470-607492 GAGACTCAAGAGGAGGAAGAGGG - Intergenic
901255318 1:7820288-7820310 GACATTAAAGAGAAACAAGAAGG - Intronic
902717894 1:18285134-18285156 GAAAACAAAGAGAAGGAGGTTGG + Intronic
903036826 1:20498464-20498486 GAGATTAAAAAGGAGCAGGTAGG - Intergenic
903538787 1:24084944-24084966 GAGATTAAAGATAAGGACTGAGG - Intronic
903600381 1:24534042-24534064 GAAAGTAAAGAGAAGGAAAAAGG - Intronic
904240682 1:29142833-29142855 AAGAGTGAAGAGAAGGAGGTTGG - Intergenic
905235512 1:36543462-36543484 GAGAATGAGAAGAAGGAAGTGGG - Intergenic
906721772 1:48011358-48011380 GAGAAGAAAGAGGAAGAAGTGGG - Intergenic
908415002 1:63904562-63904584 GAATTTAAAGAGAAGGAGGAAGG - Intronic
909079438 1:71091193-71091215 AGAATTAAAGAGAAAGAAGTGGG + Intergenic
909419230 1:75444933-75444955 GAGATTGAGGAGAAAGAAGAAGG + Intronic
909455337 1:75843285-75843307 GAGATAAAAGAAAAGGCAGCTGG - Intronic
911261747 1:95694609-95694631 GAGCTGAAATAGAAGAAAGTAGG - Intergenic
911280840 1:95926502-95926524 GATATTAAAGAGAGGGTTGTGGG + Intergenic
911476439 1:98379335-98379357 GAGTTTAAAGATGAGAAAGTGGG - Intergenic
912308442 1:108595284-108595306 AAGAATAAAGAGAAGGAAGAAGG + Intronic
912775289 1:112502793-112502815 GAGGCTATAGAGAAGGAAATTGG + Intronic
912918023 1:113837149-113837171 AAGAAGAAAGAGAAGGAAGCAGG + Intronic
915154612 1:153864643-153864665 GAGATGAAAGAGAGGGAGGGAGG + Intronic
915480074 1:156178406-156178428 GAGATGAAAGATGAGGAAGTGGG - Intergenic
916149342 1:161771233-161771255 AAGAATAAAGAGAAGGAAAAAGG - Intronic
916421179 1:164639226-164639248 ATGATTAAAGAGTAGGAAGTTGG + Intronic
916808481 1:168283563-168283585 GAGAAAAGAGAGAAGGAAGAAGG - Intronic
917069641 1:171136223-171136245 GAGCTGAAAGAGCAGGAACTAGG - Intergenic
917236713 1:172900565-172900587 GGTGGTAAAGAGAAGGAAGTTGG - Intergenic
917780665 1:178392774-178392796 GAGATCAAGGAGAAGCCAGTGGG + Intronic
918036481 1:180878137-180878159 CACATGAAAGAGAAAGAAGTGGG - Intronic
918470519 1:184868136-184868158 GAGGTAAAAAAGAAGGAAGTTGG - Intronic
918889295 1:190244330-190244352 AAAATTATAGAGTAGGAAGTAGG - Intronic
919435074 1:197548288-197548310 CAGTTCAATGAGAAGGAAGTGGG + Intronic
919742064 1:200987071-200987093 GAGATCAAAGAGGACGGAGTGGG - Exonic
920797074 1:209149453-209149475 GACATTTAAAAGTAGGAAGTAGG - Intergenic
921294365 1:213688235-213688257 GAGCTTGGGGAGAAGGAAGTGGG - Intergenic
921377254 1:214487247-214487269 GGAATTAAAGTGAAGGAAGGAGG + Intronic
921516650 1:216100657-216100679 GAGAATAAAAACAAGGAATTGGG + Intronic
922854193 1:228760208-228760230 GAAGATAAAGGGAAGGAAGTAGG + Intergenic
923863535 1:237916177-237916199 GAGATAAAAGAAAAGGCAGCTGG - Intergenic
923877531 1:238065460-238065482 GAAATGAAAGAGAATAAAGTGGG - Intergenic
924048401 1:240055650-240055672 ATGATCAAAGAGAAGAAAGTAGG + Intronic
924700018 1:246441907-246441929 GATAGTAAAGAGAAAGAAGGTGG - Intronic
1062782426 10:226449-226471 CATATTAAAGAGGAGGAAATAGG - Intronic
1063090852 10:2865245-2865267 GAGATTACACAGCAGGAGGTGGG - Intergenic
1063206342 10:3834515-3834537 GAGATTCCTGAGAAGGAAGCTGG + Intergenic
1063576945 10:7270748-7270770 GAAATTAAAGTGAGGGAAGAAGG + Intronic
1063817670 10:9794750-9794772 GCCATTAAATAGAATGAAGTAGG + Intergenic
1064157873 10:12918702-12918724 GTGATTAAACAGATGGAAGGGGG + Intronic
1064218208 10:13417933-13417955 GACAGCAAAGAGAAGGAAGAGGG - Intergenic
1064709146 10:18105547-18105569 AAGATTAAAGAAATGTAAGTAGG + Intergenic
1065611905 10:27480081-27480103 CTGCTTAAAGAAAAGGAAGTAGG + Intergenic
1066069354 10:31790702-31790724 CAAATTAAACAGAAAGAAGTAGG - Intergenic
1066985190 10:42459313-42459335 GAGAGCAAAGAGAAATAAGTTGG + Intergenic
1067259668 10:44678083-44678105 GAGATAAAAAAGAAGGCAGAAGG + Intergenic
1067545313 10:47188463-47188485 GAGGAGAAGGAGAAGGAAGTGGG + Intergenic
1067574311 10:47398775-47398797 GAGTGTAAAGAGAAGGAAATTGG + Intergenic
1068357217 10:55924053-55924075 GAGAGAAAAGAAAAGGAAGGAGG + Intergenic
1068435730 10:56989006-56989028 GAGGTGGAAGAGAAGGAAGGAGG + Intergenic
1068599022 10:58936228-58936250 GAGATAAAAGGGAAAGAAGTTGG - Intergenic
1069042305 10:63708631-63708653 GGGCTGGAAGAGAAGGAAGTTGG - Intergenic
1069509114 10:69027843-69027865 GAGATAATTCAGAAGGAAGTGGG - Intergenic
1070153394 10:73818951-73818973 TAGATAAAAGACAAGGCAGTAGG - Intronic
1070277879 10:75025114-75025136 GAGATTGAAGTGGAGGAAGATGG + Exonic
1070704629 10:78628814-78628836 GCGAGTTAAGAGAGGGAAGTGGG - Intergenic
1070949634 10:80420440-80420462 GAGATTGAGAAGAAGGAAGAAGG - Intronic
1071229785 10:83572110-83572132 GAGAGGAAAGAGAGGGAAGAAGG + Intergenic
1071699621 10:87916203-87916225 GGGAGGAAAGAGAAGGAAGTGGG + Intronic
1071870978 10:89794354-89794376 GAGATGAAAGAAATGAAAGTGGG - Intergenic
1072946791 10:99817470-99817492 GAGATTGGAGAGAAGGTACTTGG + Exonic
1072963100 10:99948370-99948392 GAGATTCAGGAGTAAGAAGTTGG - Intronic
1073004700 10:100314422-100314444 GAGAAGAGAGAGAAGGAAGCAGG + Intronic
1073135589 10:101218341-101218363 CTCATTAAAGAGAAGAAAGTTGG - Intergenic
1073219671 10:101860207-101860229 GGGAAGAAAGAGAATGAAGTAGG + Intronic
1073513887 10:104060360-104060382 GAGAAGAAAGAGAAGGAGGAGGG + Intronic
1073707471 10:106001304-106001326 GTGATTAAAGAGGAGGAAATTGG + Intergenic
1073809010 10:107132150-107132172 GAGAGAAAAGAGAAAGAAGAGGG - Intronic
1073833554 10:107414934-107414956 AAGAAGAAAGAGAAGGAAGTTGG + Intergenic
1074071902 10:110079839-110079861 GCCATTAAAAAGAATGAAGTAGG - Intronic
1074347940 10:112706489-112706511 GAGAGTACAGAGACCGAAGTAGG - Intronic
1074369191 10:112885748-112885770 GAGATTAAAGAGACTGAGGGGGG + Intergenic
1075133728 10:119763552-119763574 GAGATGAAAGGGAATGAACTGGG - Intronic
1075166663 10:120074079-120074101 GAGAATATAGGGAAGGAAGGTGG - Intergenic
1075555262 10:123426365-123426387 AGGATTAAAGAGAAGAAAATGGG + Intergenic
1075661575 10:124200561-124200583 GGGAGGAAAGAGAAGGAGGTAGG + Intergenic
1076416064 10:130289892-130289914 TACATTAAGGAGAAGAAAGTAGG + Intergenic
1076498528 10:130915751-130915773 GAGTTCCAAGAGAAGGAAGGAGG + Intergenic
1077520155 11:3028344-3028366 GAGATAAAAGAGAAGACAGCTGG - Intronic
1077948196 11:6925904-6925926 GAGAGAAAATAGAAGGAAATGGG - Intergenic
1077996699 11:7458752-7458774 GAGAAAAAAGAGAGAGAAGTAGG + Intronic
1078007148 11:7540506-7540528 GAGAATATAGAGAGGGAGGTGGG + Intronic
1078093873 11:8284510-8284532 TAGATTCTAGAGAAGGAAGGAGG + Intergenic
1078127472 11:8582021-8582043 GATATTTAAGAATAGGAAGTGGG - Intronic
1078193240 11:9110921-9110943 AAGAATCAAGACAAGGAAGTTGG + Intronic
1078370331 11:10739461-10739483 GTGATTAAAGAGAATAAACTAGG + Intergenic
1078618336 11:12885131-12885153 AAGATTAAACAGAAGGAAACAGG + Intronic
1078678165 11:13446889-13446911 GAGGTCAAAGAGAAGAAAATGGG + Intronic
1079846438 11:25476231-25476253 GAGATAAAAGAGAAGACATTGGG - Intergenic
1080956319 11:37099879-37099901 GAGAAAAAAGGGAAGGAAGTAGG - Intergenic
1082635610 11:55589703-55589725 GAGTTTGAAGAAAAGGAATTTGG - Intergenic
1083133462 11:60648650-60648672 AAGACTAAAGGGGAGGAAGTTGG + Intergenic
1084470413 11:69356174-69356196 GAGGATGAAGAGAAGGAAGGAGG + Intronic
1085036333 11:73302438-73302460 GAGGTTTCAGGGAAGGAAGTAGG + Intergenic
1085983645 11:81757012-81757034 AAGAAGAAAGAGAAGGAAGGAGG + Intergenic
1086784452 11:90949679-90949701 AAGTTTAAAGAGACCGAAGTGGG + Intergenic
1087264125 11:96042415-96042437 GAGAAAAAAGAGAAGGCAGCTGG - Intronic
1087589108 11:100162124-100162146 GAGAACAAAGAGCAGGGAGTAGG - Intronic
1088205739 11:107390394-107390416 GAGAGTAAAGAGGTAGAAGTAGG - Intronic
1088235527 11:107718997-107719019 GAGAGAAAATAGAAGGAAGTGGG + Intronic
1089455754 11:118624958-118624980 GTGGTTAAAGCGAAGGAAGGTGG - Exonic
1090077017 11:123585960-123585982 GAGATTAAAGGAAAGGAAAGGGG - Intronic
1090139524 11:124240229-124240251 GTCTTTAAAGAGAATGAAGTAGG - Intergenic
1090708490 11:129362830-129362852 GAGATTTAAGAGCACGAAGGAGG - Intergenic
1091135371 11:133184048-133184070 GACATTGAAGGGGAGGAAGTAGG + Intronic
1091637128 12:2205663-2205685 GAGTTTTTAGAGTAGGAAGTAGG + Intronic
1091642466 12:2247807-2247829 GAGAATAAAGAGAAAGGAGCAGG - Intronic
1091766357 12:3122612-3122634 GAGACCATAGATAAGGAAGTTGG + Intronic
1091913362 12:4249995-4250017 CATATTACAGAGAAGGAAATGGG - Intergenic
1092224987 12:6742425-6742447 GAGATAAAAGAAAAGGCAGCTGG - Intergenic
1092444225 12:8538591-8538613 GAGATAAAAGAAAAGGCAGCTGG - Intronic
1092879410 12:12876283-12876305 GAGATGAAATCGTAGGAAGTCGG - Intergenic
1092896050 12:13011351-13011373 GAGTTTACTGAGAAGGAAGAAGG + Intergenic
1092953569 12:13529497-13529519 AAGAGTAAACAGAAGGAAGTGGG - Intergenic
1093613948 12:21197695-21197717 TGGATTAAGGAGAAGGAAGTCGG + Intronic
1093823045 12:23645371-23645393 GAGATTGAAGACAAGGAGTTGGG + Intronic
1093865294 12:24219503-24219525 AAGATTAAATAGATAGAAGTGGG - Intergenic
1094349740 12:29510920-29510942 GAGAGCAAAGAAAAGGAAATGGG - Intronic
1094404834 12:30106433-30106455 GAGGCTACAGAGAAGGAAGCTGG - Intergenic
1094488045 12:30940456-30940478 GGGATGTAAGAGCAGGAAGTGGG + Intronic
1094644106 12:32304200-32304222 GAGATTATATAAAGGGAAGTTGG + Intronic
1094778821 12:33765593-33765615 GAGAGTGAAGGGAAGGAAGGTGG - Intergenic
1095202441 12:39399937-39399959 GAAATTAAAGGGAAAGAAGGGGG + Intronic
1096861168 12:54529413-54529435 GAGAGGAAGGAGAAAGAAGTAGG - Intronic
1098679762 12:73338021-73338043 AAGGTTAAAGAGATGTAAGTAGG + Intergenic
1098731472 12:74040754-74040776 GAGGTAAAAGAGAAAGTAGTGGG - Intergenic
1099657576 12:85513950-85513972 GGGATTTCAGAGAAGAAAGTAGG - Intergenic
1100068884 12:90685938-90685960 GAGATGTAAGAGAAAAAAGTAGG + Intergenic
1100247594 12:92778151-92778173 GAAATAAAAGAAAAGGAAGTAGG - Exonic
1100416631 12:94384732-94384754 GAGAATAAAGAGAAGAAAATTGG - Intronic
1100882097 12:99030390-99030412 GAGGATAAAGGGAAGGCAGTGGG - Intronic
1101349035 12:103910977-103910999 GACTTTAAAGAGAAGAAATTAGG - Intergenic
1102866651 12:116380141-116380163 GGGATTAAAAAGAAAGAAATGGG - Intergenic
1103643028 12:122368030-122368052 GAGAGTAAAGAGAACGAATTGGG - Intronic
1103722826 12:122983732-122983754 GAAATCAAAGAGAAGGCAGGTGG + Exonic
1104223542 12:126809731-126809753 CACATTGAACAGAAGGAAGTAGG + Intergenic
1105052372 12:133066114-133066136 GAAAGGAAAGAGAAGGAAGTAGG + Intergenic
1105302782 13:19150879-19150901 GAGATTAATGCCAAGGAAGTGGG + Intergenic
1105359133 13:19690792-19690814 AAGAGGAAAGAGAAGAAAGTTGG - Intronic
1105596257 13:21842140-21842162 GAAATTAAAAATAAGGAAATTGG + Intergenic
1105856407 13:24376288-24376310 GAGATAAAAGAAAAGGCAGCTGG - Intergenic
1106052411 13:26204011-26204033 GAGAAGAAAGGGAAGGAAGGAGG - Intronic
1106062808 13:26311316-26311338 GAAAGAAAAGAGAAAGAAGTAGG - Intronic
1106063500 13:26320015-26320037 GACATTCAAAAGAATGAAGTTGG + Intronic
1106264366 13:28096885-28096907 AAGATTAAAGAGATGGAGGTAGG - Intronic
1106312178 13:28563818-28563840 GAGATTAAAGAGACACCAGTGGG + Intergenic
1106482478 13:30147351-30147373 GAGTTTGAAGAGAAGAAAGAGGG - Intergenic
1106587438 13:31069666-31069688 TAGCTGAAAGAGAAGGAACTGGG + Intergenic
1107651417 13:42549044-42549066 GGCATTGAAGCGAAGGAAGTGGG - Intergenic
1108909357 13:55524297-55524319 CAGAGTAAAGAGAAAGTAGTGGG - Intergenic
1109451254 13:62517923-62517945 GAGGTTAAAAGGTAGGAAGTTGG - Intergenic
1110674670 13:78226944-78226966 GAGATGAATGAGAAGGACATAGG - Intergenic
1111141892 13:84129611-84129633 GAGAGTAAGTAGAGGGAAGTAGG + Intergenic
1111244173 13:85513159-85513181 GAAAGTAGAGAGAAGGAAATGGG - Intergenic
1111876896 13:93908943-93908965 GAGAGTGATGAGAAGGGAGTGGG - Intronic
1112067076 13:95804012-95804034 GAAATTAAAAAGAAGCAAGCAGG + Intronic
1112214173 13:97413025-97413047 GAGCTTAAAGAGGAAGAAGAGGG - Intergenic
1113880384 13:113622244-113622266 GAGATAAAAGAAAAGGCAGCTGG - Intronic
1114165720 14:20216564-20216586 GAGATAAAAGAAAAGGCAGCTGG + Intergenic
1114188878 14:20425685-20425707 AAGATGAAAGAGAATGAAGATGG + Intergenic
1114612331 14:24051272-24051294 GAGATGAGAGAGAAGGAAGCTGG + Intergenic
1114744311 14:25131398-25131420 GAGATTGAGGAGAGGGAACTGGG + Intergenic
1114983973 14:28202672-28202694 GAGAGAAATGAGAAAGAAGTTGG - Intergenic
1115350948 14:32395171-32395193 GAGGTGAAAGAGAAAGAAGATGG - Intronic
1115510381 14:34132506-34132528 GGGATTAAGGAGAATGAGGTTGG - Intronic
1115590668 14:34861672-34861694 TAAATTAAAGAGAAGGAAGGTGG + Intronic
1116403783 14:44542864-44542886 GAGGTGAGAGAGAAGGAAGGGGG + Intergenic
1117186780 14:53247648-53247670 GAGACTAGAAAGAAGGAAGAGGG + Intergenic
1117740059 14:58808626-58808648 TAGAATTAAGAGAAGAAAGTAGG + Intergenic
1117878544 14:60282515-60282537 GAGATTAACAAGGAGGAACTGGG - Intronic
1118370921 14:65136560-65136582 GGGTGTAAAGAGAAGGGAGTGGG - Intergenic
1118383541 14:65237181-65237203 GAGATAGGAGAGAAAGAAGTGGG + Intergenic
1118459223 14:65973591-65973613 AAGATTAAAGAGGAAGAAATGGG + Intronic
1118701851 14:68441046-68441068 GATTTTAATGAAAAGGAAGTAGG + Intronic
1119404836 14:74391647-74391669 GACATTAAAAAGAATGAAGCAGG - Intergenic
1119538613 14:75423643-75423665 GAGATTAAAGAGAAGACACTAGG + Intergenic
1119576491 14:75728053-75728075 GAGATTAAAGAGGAAGAAACTGG + Intronic
1120470540 14:84918273-84918295 GAGAAGAAAAAGAAGGAAGAAGG - Intergenic
1121149799 14:91621941-91621963 GAGATTAAACAGAAGAGACTTGG + Intronic
1121724925 14:96140274-96140296 GAGGGTAAAGAGAAGGGAGATGG - Intergenic
1122038315 14:98964389-98964411 GAGAGTAAAGAAACCGAAGTCGG + Intergenic
1122566985 14:102666134-102666156 AAAGATAAAGAGAAGGAAGTGGG + Intronic
1122674758 14:103402581-103402603 TACATTAAATAGAAGGCAGTTGG + Intronic
1124037440 15:26068774-26068796 GAAAATAAAAAGAAGGAAGGAGG - Intergenic
1124793974 15:32758382-32758404 GAGAGAAATTAGAAGGAAGTAGG - Intergenic
1124956178 15:34362047-34362069 TAGAATAAATAAAAGGAAGTGGG - Intronic
1125044332 15:35229433-35229455 GATATCACAGAGAAGGAATTTGG - Intronic
1125047683 15:35261369-35261391 GATCTTCAAGAGAAGGAAGAAGG - Intronic
1125760327 15:42092048-42092070 GAGATAAAAGAAAAGGCAGCTGG - Intronic
1126382078 15:48059252-48059274 AAGATTAAAAAGATAGAAGTAGG + Intergenic
1126571435 15:50157448-50157470 GAAATAAAAAAGAAAGAAGTGGG - Intronic
1126860701 15:52879974-52879996 GAGCAGAAAGAGAAGGAAGAGGG - Intergenic
1126938507 15:53739177-53739199 GAGAATGAAGTGAAGAAAGTAGG + Intronic
1127019142 15:54726594-54726616 GATAACACAGAGAAGGAAGTTGG - Intergenic
1127284522 15:57520837-57520859 CAGCTTAACCAGAAGGAAGTTGG - Intronic
1127689307 15:61378925-61378947 GAAATTAATGAGAAAGGAGTGGG + Intergenic
1128369466 15:67029884-67029906 AAGATTAATGAGACAGAAGTGGG + Intergenic
1129004711 15:72362978-72363000 GACATTAAAGAGTGGGAAGGTGG - Intronic
1129542755 15:76364353-76364375 GGGATGAGAGAGAAGGAAGAAGG + Intronic
1129610626 15:77052670-77052692 GACATTAAAGACAAGCAAGGTGG + Intronic
1129771741 15:78207210-78207232 GAGATAAAGGAGAAGGGACTGGG - Intronic
1129921068 15:79319589-79319611 GAGATTAAAAAGAAGACAGCTGG + Intronic
1129974900 15:79813833-79813855 GAGATTAAATAGAAGGATTCAGG - Intergenic
1130937059 15:88479553-88479575 AGGACTAAAGAGAAGGCAGTAGG - Exonic
1131312801 15:91306149-91306171 AAGATTCTAGAGAAGGAAATAGG + Intergenic
1131842313 15:96450422-96450444 GGGAGAAAAGAGAAGGCAGTAGG - Intergenic
1132988816 16:2782719-2782741 CAGATTACGGAGAGGGAAGTAGG + Intergenic
1133059554 16:3165528-3165550 GAGATAAAAGAAAAGACAGTTGG + Intergenic
1133520118 16:6549103-6549125 GGGAGGAAAGAGAAGGAAGAGGG + Intronic
1133659341 16:7901034-7901056 GTGATAAAAGAGAGGGAAGGAGG + Intergenic
1134190854 16:12120150-12120172 GAGATAAAAGGAAAGGGAGTGGG + Intronic
1134336300 16:13302663-13302685 GAGATTATCTAGATGGAAGTGGG - Intergenic
1134463104 16:14446903-14446925 GAAATTAAAAAGAATGAAGAAGG - Exonic
1134510171 16:14840043-14840065 GCGATTAAAAAGAAGTCAGTAGG - Intronic
1134837717 16:17376039-17376061 CACTTTACAGAGAAGGAAGTGGG + Intronic
1134974021 16:18556148-18556170 GCGATTAAAAAGAAGTCAGTAGG + Intronic
1135195588 16:20391768-20391790 GAGGTTAAAAAGAAGGCAGTGGG + Intronic
1138023812 16:53506491-53506513 GGGATTGAAGAGAATGAACTGGG - Intergenic
1138025699 16:53520827-53520849 CAGATGAAAGAGAAAGAATTTGG + Intergenic
1138214974 16:55196307-55196329 GAGCTTGGAGGGAAGGAAGTGGG + Intergenic
1138942585 16:61808242-61808264 GAGATTACAGTGAAGGGACTAGG + Intronic
1139108965 16:63864994-63865016 GAGAAGAAAAAGAAGAAAGTTGG + Intergenic
1139411832 16:66768420-66768442 GATTATAAAAAGAAGGAAGTAGG + Intronic
1139518489 16:67465825-67465847 GAGACTTAAGTGAGGGAAGTAGG + Intronic
1139667653 16:68469052-68469074 GGGAGCAAAGAAAAGGAAGTAGG - Intergenic
1139708736 16:68760558-68760580 CAGATTAAAGAGAAAGAATGGGG - Intronic
1139742012 16:69043557-69043579 GTGAATAAAGAAAAGGAAATGGG + Intronic
1139953770 16:70684034-70684056 GGGATGAGACAGAAGGAAGTGGG - Intronic
1140638534 16:76944926-76944948 GAGAAAAAAAGGAAGGAAGTAGG + Intergenic
1140903612 16:79392330-79392352 GAGAGGAGAGAGAAGGAAGGAGG + Intergenic
1141009493 16:80384217-80384239 GAGATTAAAAAAAAAGAAGATGG + Intergenic
1141382888 16:83591612-83591634 GAGAATTCAGAGAAGGAAGAAGG - Intronic
1142415319 16:89937953-89937975 GAGATAAAAGAAAAGGCAGCTGG + Intergenic
1143091264 17:4450253-4450275 GAGAGAAAAGAGGAGGAAGGAGG - Intronic
1143787404 17:9266220-9266242 GAGATTGGAGAGGAAGAAGTTGG + Intronic
1144083064 17:11782355-11782377 AAGATCAAAGAGAGGGAAGATGG - Intronic
1144166250 17:12613768-12613790 TTGATGGAAGAGAAGGAAGTTGG - Intergenic
1146811193 17:35904966-35904988 CAGAGGAAAGAGAATGAAGTGGG - Intergenic
1147310781 17:39595148-39595170 GTGAATGAAGAGAAGGAATTGGG - Intergenic
1147492331 17:40881667-40881689 GGGATTAACAAGAAGGAAATAGG - Intronic
1148553947 17:48566697-48566719 GACATGACAGAGAAGGAAGAGGG - Intronic
1149918002 17:60629709-60629731 AAGATTAATGAGAAGGAATCAGG - Intronic
1150146482 17:62773764-62773786 AAGATTAGGGAGAAGGAAGACGG + Intronic
1150266748 17:63837218-63837240 CAGGTTAAAGAGGAGGAAGATGG - Exonic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1150693173 17:67381750-67381772 GTGATTAAAGAGAAACAAGTAGG - Intronic
1151179129 17:72313030-72313052 GAGTAGAAAAAGAAGGAAGTTGG - Intergenic
1151970581 17:77455518-77455540 GAGATAAAAGACAAGGATCTGGG - Intronic
1152114245 17:78375187-78375209 GCGACTAACGAGAAGGCAGTGGG + Intergenic
1152947607 17:83206430-83206452 GAGACTCAAGAGGAGGAAGAGGG + Intergenic
1153163040 18:2230282-2230304 GAGATAAAAGAAAAGGCAGCTGG + Intergenic
1153187700 18:2503050-2503072 GAGAATAAAAAGGAGGAAGAAGG + Intergenic
1153697228 18:7656424-7656446 GAGATAGGAGAGAAGGGAGTGGG + Intronic
1155034521 18:22014664-22014686 GAGAATAAAGAGAGGGAAAAAGG - Intergenic
1155917779 18:31572980-31573002 GAGAGGAAAGAGAGGGAAGGAGG + Intergenic
1155920204 18:31596113-31596135 GAAATTAAGGAGAAGGCAGGGGG - Intronic
1155943921 18:31826578-31826600 GAGATTTCAGAGAGGGAAGAGGG - Intergenic
1157767351 18:50310070-50310092 GAGATGACAGAGGAAGAAGTTGG - Intergenic
1157836815 18:50911500-50911522 GAGAGTTAACAGAGGGAAGTAGG + Intronic
1158191397 18:54832593-54832615 GAGATTACAGAGAAAAAATTGGG + Intronic
1158708007 18:59811378-59811400 GAAATTAAGGAGAAGAAAGAGGG - Intergenic
1159140985 18:64394342-64394364 TACACTAAAGAGAAGAAAGTTGG + Intergenic
1159295660 18:66484159-66484181 GAGAGAAAAGAGAATGAATTTGG + Intergenic
1159357178 18:67351229-67351251 GAGATAAGAGTGAAGGAAGATGG - Intergenic
1159441817 18:68490148-68490170 GAGATTAAAAACAAGGAATTCGG - Intergenic
1159820449 18:73134953-73134975 CAGAAGAAAAAGAAGGAAGTGGG - Intergenic
1161274725 19:3409486-3409508 GGGATGGCAGAGAAGGAAGTGGG - Intronic
1163730461 19:18946441-18946463 GGGAATGAAGAGAAGGAAGAGGG - Intergenic
1163924622 19:20328289-20328311 GAGAATAAAGAGAAGGCTCTGGG - Intergenic
1164131622 19:22368326-22368348 CAAATGAAAGAGAAGGAAGTAGG + Intergenic
1164168304 19:22701531-22701553 CAAATGAAGGAGAAGGAAGTAGG - Intergenic
1164972248 19:32542560-32542582 GAGGAGAAAGAGAATGAAGTAGG + Intergenic
1165454365 19:35902180-35902202 GAGATGAAAGGTAGGGAAGTGGG - Intronic
1165671163 19:37680614-37680636 GAGATAAAAGAAAAGGCAGCTGG + Intronic
1166278630 19:41774404-41774426 AAGTGTAATGAGAAGGAAGTAGG + Intergenic
1166450711 19:42898160-42898182 AAGAGTAATGAGAAGAAAGTAGG - Intronic
1166462611 19:43002502-43002524 AAGAGTAATGAGAAGAAAGTAGG - Intronic
1167970233 19:53184709-53184731 GAGATAAAAGAAAAGGCAGCTGG + Intronic
1167990921 19:53360097-53360119 GAGATAAAAGAAAAGGCAGCTGG + Intergenic
1168409811 19:56132640-56132662 GAGAGTAAAGGGCTGGAAGTGGG + Intronic
1168480857 19:56718609-56718631 GAGATAAAAGAAAAGGCAGCTGG + Intergenic
925480437 2:4264882-4264904 GAGAGTAAAGAGAGGGGAATGGG - Intergenic
925703712 2:6664221-6664243 GAGATGAAGGAGAAGGAGGAAGG + Intergenic
926038574 2:9654680-9654702 AAGATGAAAGAAAAGGAAGGAGG - Intergenic
926839504 2:17063843-17063865 GAGATAAAAGAGAAATAAGTAGG + Intergenic
927031344 2:19123430-19123452 GAGGTTAAAGTGAAGGACCTGGG + Intergenic
927369749 2:22340752-22340774 GGGATAAAGGAGAAGAAAGTTGG - Intergenic
927501762 2:23588049-23588071 GAGGTTACAGAGAAGGATGAGGG - Intronic
928236651 2:29547698-29547720 GAGGCAAGAGAGAAGGAAGTTGG - Intronic
928425704 2:31176026-31176048 GATATTAAAGAGGAGGAAATGGG + Intronic
928979841 2:37126473-37126495 GACATTAAAGGGAAAGGAGTGGG - Intronic
930073617 2:47389357-47389379 GAAGTAAAAGAGAAGGAATTTGG - Intergenic
930093790 2:47551357-47551379 AAGAATAAAGTGATGGAAGTAGG - Intronic
930261988 2:49157690-49157712 GAGAGAGAAGAAAAGGAAGTTGG - Intergenic
930590520 2:53321428-53321450 GAGTTTTAAGGGAAAGAAGTGGG - Intergenic
930929473 2:56862726-56862748 GGGCTGAAAGAGAAGGAAGCTGG - Intergenic
931601317 2:64005905-64005927 TACAGTAAATAGAAGGAAGTAGG + Intronic
931721892 2:65072675-65072697 GAGCTTGAAGGGAAGGAAGCTGG - Exonic
931992776 2:67807774-67807796 GAGAAGAAGGAGAAGGAAGAAGG - Intergenic
932094061 2:68831381-68831403 GAGAACAGAGAGAAGGAAGGAGG - Intergenic
932168282 2:69528650-69528672 GAGGGTAAAAAGAAGGAAGGAGG + Intronic
932516206 2:72352533-72352555 TAGATTAAAGAGAAAGAAAGAGG + Intronic
932632895 2:73361911-73361933 GAGATTAAGGACAAGACAGTAGG - Intergenic
932842216 2:75094288-75094310 TAAAATAAAGAGAAGTAAGTAGG + Intronic
932875309 2:75444962-75444984 GAGATTCAATACAAGGAAGCAGG + Intergenic
932880391 2:75495856-75495878 GAGAAGAAAAAGAAGTAAGTGGG - Intronic
932888347 2:75568185-75568207 AAGATTAAAGAGAAGGAAAGAGG - Intronic
933310171 2:80651034-80651056 GAGATTAAAGAATAGAAAATAGG + Intergenic
934870077 2:97855795-97855817 GATAATAAAGAGAATGAAATAGG - Intronic
935358113 2:102223573-102223595 GAGCTAAAAGAGAATGAAATTGG - Intronic
935402138 2:102671146-102671168 GAGTTTACAGAGAAGGAAGCGGG + Intronic
936041770 2:109155274-109155296 GTGATTATAGAGTTGGAAGTTGG + Intronic
936096328 2:109532903-109532925 GAAACTAAACAGAAGGAAGCAGG - Intergenic
936268323 2:111028454-111028476 GAGATTAAAAAGGAATAAGTAGG - Intronic
936388299 2:112050033-112050055 GAGATAAAAGAAAAGGCAGCTGG - Intergenic
936500634 2:113063149-113063171 AGGATTAAAGGGAAGGAGGTGGG - Exonic
936784425 2:116076761-116076783 AAGATGAAAAAGAAGGAAGTAGG - Intergenic
936870350 2:117129181-117129203 GAGAGAAGAGAGAAGGAAGAAGG - Intergenic
936995042 2:118404558-118404580 GACATTAACGAGGAGGAGGTGGG + Intergenic
937710934 2:124979147-124979169 CAGATTAGAGAGAAGGTAGCTGG + Intergenic
937714501 2:125015970-125015992 GAGATGAAAGAAAAGGAATAAGG - Intergenic
938288812 2:130138777-130138799 GAGATTAATGCCAACGAAGTGGG + Intergenic
938467722 2:131534155-131534177 GAGATTAATGCCAACGAAGTGGG - Intergenic
940165460 2:150765446-150765468 TAGATAAAAGAGAGGAAAGTGGG + Intergenic
940277087 2:151950797-151950819 GAGTAGAAAGAGAAGGGAGTGGG + Intronic
940531420 2:154882615-154882637 GAGTATAAAGAGAAGGAAAGGGG - Intergenic
940783344 2:157956814-157956836 GGGCTGGAAGAGAAGGAAGTGGG + Intronic
941311610 2:163939544-163939566 AAGATAAAAGAGAAGAAAATGGG + Intergenic
941632480 2:167899933-167899955 GTGGTTAAAGATAATGAAGTAGG + Intergenic
941873797 2:170412906-170412928 CAAATTAAATAGAAAGAAGTGGG - Intronic
941928273 2:170916859-170916881 GAGATAAAAGAAAAGGCAGCTGG - Intergenic
943128688 2:183828953-183828975 AAGATTAAAGAGTAGGATTTGGG + Intergenic
943469435 2:188275523-188275545 GATGTGAAAGAGAAGGAATTTGG + Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944247589 2:197547187-197547209 GAGGAGAAAGAGAAAGAAGTGGG + Intronic
944376441 2:199049665-199049687 GATATTTAAGAGAGTGAAGTAGG - Intergenic
944885331 2:204057062-204057084 GAGAGTTGAGAGAAGGGAGTGGG - Intergenic
945244933 2:207709571-207709593 GAGAGCAAAGGGAAGCAAGTAGG - Intergenic
945563046 2:211362098-211362120 GAAATGAAAGATAAGGAAGAAGG - Intergenic
945626236 2:212210148-212210170 GAGATAAAAGAAATGAAAGTAGG + Intronic
945863501 2:215150658-215150680 GTAATTAAAGAGAGAGAAGTTGG - Intergenic
946876842 2:224138004-224138026 GAGGGCAAAGAGAAGGAAGAGGG - Intergenic
946976915 2:225163533-225163555 GAGATTTGGGAGAAGGAAGCGGG - Intergenic
948127475 2:235575163-235575185 GAGAATAAAGAGATGGTGGTTGG + Intronic
948856915 2:240734544-240734566 GAGAATAAAAAGAAAGAAGACGG + Intronic
949019286 2:241732153-241732175 GAGATAAAAGAAAAGGCAGCTGG + Intergenic
1169089316 20:2848462-2848484 TAGATTCAAGAGGTGGAAGTGGG - Intronic
1169295462 20:4393711-4393733 GAGATAAAAGAAAAGGCAGCTGG + Intergenic
1169673123 20:8126390-8126412 GAGATGACGGAGAAGGAAATAGG + Intergenic
1169830600 20:9820965-9820987 AAGAATAAAGAGAAGAAATTTGG - Intronic
1169994045 20:11536602-11536624 GAATTTGAAGAGAAGGAATTAGG - Intergenic
1170023772 20:11866069-11866091 GAGATAAATCAGACGGAAGTTGG + Intergenic
1170053696 20:12175400-12175422 AAAATTAAAGAACAGGAAGTAGG - Intergenic
1170950683 20:20933309-20933331 GAGATTAAGAAGCAGGAGGTTGG - Intergenic
1171329980 20:24329033-24329055 GAAATTAGTGATAAGGAAGTTGG - Intergenic
1172013638 20:31860866-31860888 GAGATGTTAGAGAAGGAGGTGGG + Intronic
1172936236 20:38622576-38622598 GGGATTAAAGGGAAGGATGTGGG + Intronic
1172985551 20:38985395-38985417 AGGCTTAAAGAAAAGGAAGTAGG + Intronic
1173713045 20:45176937-45176959 AACATTAATGAGAAGGAAGTGGG - Intergenic
1173828868 20:46065451-46065473 GAGAATCAAGAGAAGGACCTGGG - Intronic
1175155182 20:56966354-56966376 GAGGTGAAAGAGAAGGAAATGGG + Intergenic
1175362324 20:58422383-58422405 GAGATTGAAGAAAGGGAGGTTGG + Intronic
1175461628 20:59155952-59155974 AAGACTAAAGAGGAAGAAGTAGG + Intergenic
1175661416 20:60816238-60816260 GAGATTAAAGAAAAAGAAGGAGG - Intergenic
1176912163 21:14579124-14579146 GACACTAAAGTGAAAGAAGTTGG - Intronic
1176984587 21:15421280-15421302 GAGAAAACAGAGAAGCAAGTAGG - Intergenic
1177649709 21:23944918-23944940 GAAATGAAAGAGAAGGAAAGAGG - Intergenic
1177771858 21:25525911-25525933 GACATTAAAGAGAATGATGTAGG - Intergenic
1179003776 21:37490495-37490517 GAAATTAAATAGAAGTAGGTAGG + Intronic
1179106275 21:38403522-38403544 GAGATGTGAGAGAAGGATGTCGG + Exonic
1182268156 22:29135481-29135503 AAGTGTGAAGAGAAGGAAGTGGG + Intronic
1182353291 22:29710752-29710774 GAGATTCAGGAGGAGGAAGCGGG + Intergenic
1182467211 22:30524959-30524981 GAGATCAAAGAGGAGGGTGTGGG + Exonic
1182855843 22:33516882-33516904 GTGCTTAAATAGGAGGAAGTGGG - Intronic
1183848535 22:40563222-40563244 GATAATAAAGAGAAGGAAGTAGG - Intronic
949225876 3:1695240-1695262 GAGGAGAAAGAGTAGGAAGTGGG + Intergenic
949452943 3:4207002-4207024 GAAATTAATGAGACGTAAGTAGG - Intronic
949680708 3:6511372-6511394 GAGAGTAAAGAAAAGGAAGTAGG + Intergenic
950150974 3:10687139-10687161 GGGATTAAAGAGCAGGAGTTTGG + Intronic
950636443 3:14318553-14318575 GATATGATAGAGAAAGAAGTTGG - Intergenic
951062230 3:18222780-18222802 GTGATTTAAGAGAGGAAAGTGGG - Intronic
951175640 3:19596083-19596105 GAGAAGAAAGAAAGGGAAGTGGG - Intergenic
951677180 3:25254748-25254770 GAGATAAAAGAAAATGAAATAGG + Intronic
951837378 3:26998115-26998137 GAGACTACAGGGAAGAAAGTGGG - Intergenic
952213328 3:31251330-31251352 GAGGATAAAGAGAAGGAAGAAGG + Intergenic
952470767 3:33649052-33649074 GGGATTAGAGAGAAAGAAGTAGG - Intronic
953384411 3:42498415-42498437 GAGACAAAAGAGGAGAAAGTAGG - Intronic
953599740 3:44350410-44350432 AAAATGAAAAAGAAGGAAGTGGG - Intronic
954367376 3:50153892-50153914 GAGGGTAAAGAGCAGGAAGAAGG + Intergenic
955198304 3:56826555-56826577 GATATCAAAGAGAAGAAAGTAGG + Intronic
955247514 3:57240759-57240781 GAAATTCTAGAGAAGGAAGTGGG + Intronic
955598096 3:60613636-60613658 GAAGTTAAAGAAAAGGAAGTAGG - Intronic
956004232 3:64761842-64761864 GAGATAAAAGAGAGTGCAGTAGG + Intergenic
956063974 3:65377640-65377662 AAAAATAAAGAGAAGGAAGAGGG - Intronic
956338892 3:68197325-68197347 GAAATGAAAGAGAAATAAGTGGG + Intronic
956892970 3:73630449-73630471 GAGATGCAAGAGAAGGTAGTTGG - Intergenic
956900290 3:73708371-73708393 GAGATCAAAGATAAGGAGGCAGG - Intergenic
956929148 3:74022908-74022930 AAGATTTAAGAGATGGTAGTTGG + Intergenic
957167357 3:76692052-76692074 GAGATGAAGGAGGAGGAATTGGG + Intronic
957205075 3:77186253-77186275 GAGATTAAAATGAAGTTAGTGGG + Intronic
957515072 3:81239772-81239794 GAAATTAAAGAAGTGGAAGTGGG - Intergenic
957842209 3:85686157-85686179 GATATTAAACAGAAGGAAGTAGG - Intronic
957959725 3:87233737-87233759 GAGATTATAAAGTAGGATGTGGG + Intronic
958813305 3:98888256-98888278 GAGCTTAAAAAGAATGAAGCTGG - Intronic
958946302 3:100366183-100366205 GAGATGAAACAGAAAGAGGTGGG - Intronic
959311695 3:104745955-104745977 GAGAGTAATGGGAAGGAAGGGGG + Intergenic
959674537 3:109019896-109019918 GAGATTGGAGAGAAGGGAATTGG + Intronic
959740459 3:109712630-109712652 GAGGTTACAGAGAAGCAAGGAGG + Intergenic
959747474 3:109793837-109793859 TAGATTACAGAGGAGGAAATGGG + Intergenic
959871661 3:111335739-111335761 GAGATGAAAGGGATGGAGGTTGG - Intronic
959927372 3:111938709-111938731 GAGATTAAAGAGTCAAAAGTTGG - Intronic
960469160 3:118039457-118039479 GAGATTAAATATAAGTAAGTAGG + Intergenic
961346623 3:126267563-126267585 GTGATTAAAGAAAAGAAAGAAGG + Intergenic
961747877 3:129077143-129077165 GAGAGGAATGAGAAGGAAGAGGG - Intergenic
962370551 3:134817661-134817683 GAGCTCAAAGAGAAAGAGGTTGG - Intronic
962613149 3:137097998-137098020 GAAACTAAAGAGCAGGAAGAAGG - Intergenic
962968326 3:140374867-140374889 AAGGTTTGAGAGAAGGAAGTTGG + Intronic
963589490 3:147239292-147239314 GATTTTAAAAAGAAGGAAGAAGG + Intergenic
963626036 3:147674463-147674485 TAGATTAGAGAGAAGAAAATTGG - Intergenic
964577404 3:158188367-158188389 TGTATCAAAGAGAAGGAAGTTGG - Intronic
964653918 3:159045054-159045076 GAGAGGAAGGAGAATGAAGTTGG - Intronic
964658497 3:159094320-159094342 GATATTATAGAAAAGGAAGGTGG + Intronic
965207061 3:165734233-165734255 GAGATCAAAGACACAGAAGTTGG - Intergenic
965313813 3:167165376-167165398 GAGATTAGAGTGTAGGAGGTGGG - Intergenic
965439731 3:168698501-168698523 GAGATAAAAGAAAAGGCAGCTGG + Intergenic
966152047 3:176875817-176875839 GAGAATGAAGAAAAGCAAGTCGG - Intergenic
966606312 3:181824939-181824961 GAGGTAAAAGAGAAGAGAGTTGG + Intergenic
967060172 3:185865223-185865245 GAGATTTAATAAAAGGAATTGGG + Intergenic
967079667 3:186037825-186037847 CTGATGAAAGAGAAGGAGGTGGG - Intergenic
967431329 3:189389289-189389311 AAGATTAAACAGAAGAAAGATGG - Intergenic
967652505 3:192004054-192004076 GAGTTAAAAGACAAAGAAGTGGG - Intergenic
968262878 3:197339315-197339337 CAGTTTAAAGGTAAGGAAGTGGG - Intergenic
968744242 4:2351298-2351320 GAGAGTAGAGAGTAGAAAGTAGG + Intronic
968840934 4:3005355-3005377 GAGGTTAAAGAGAGGGAAGATGG + Intronic
969063059 4:4454564-4454586 GACATTACGGAGAAGGAGGTAGG - Intronic
969380656 4:6794938-6794960 GGAATTAAAGAGAAAGAAGCAGG + Intronic
969932877 4:10649160-10649182 TAGTTAAAATAGAAGGAAGTAGG - Intronic
970103363 4:12551571-12551593 GAGATATAAGACAAAGAAGTAGG + Intergenic
970730283 4:19095137-19095159 GAGAAGAAAGAGAAGGAAGAGGG + Intergenic
971068546 4:23063352-23063374 GTGATCAGATAGAAGGAAGTAGG - Intergenic
971102526 4:23483706-23483728 GAGCTGAAAGGGAATGAAGTAGG - Intergenic
971470366 4:27018459-27018481 GAGATCAGAGAGACGGAAGTTGG - Intronic
972081283 4:35153507-35153529 GACACTAAAAAGAAGAAAGTAGG - Intergenic
972230349 4:37065286-37065308 GAGATCAAAGAGAAGCATTTGGG + Intergenic
972866515 4:43239897-43239919 GAGAATAAAGAAGAGGAAGAAGG + Intergenic
973765973 4:54163242-54163264 GAGGGGAAGGAGAAGGAAGTGGG - Intronic
974273342 4:59681068-59681090 GAGCTGAAGGAGAAGGAACTGGG + Intergenic
975256332 4:72240057-72240079 AAGATTAAACAAAAGGAAGGAGG + Intergenic
975377754 4:73665541-73665563 GAGATAAAAGAAAAGGCAGCTGG + Intergenic
975387405 4:73773651-73773673 GAGATAAAAGAAAAGGCAGCTGG + Intergenic
975495904 4:75035631-75035653 GAGATAAAAGGGAAGGAGGAGGG - Intronic
975545480 4:75556277-75556299 GTGGTTAAAGAGAAGGAAGTTGG + Intronic
976133442 4:81909307-81909329 GATACAAAAGAGAAGGAAGTTGG + Intronic
976244032 4:82989689-82989711 GAAATTAAAGAGTAGGAGGAGGG + Intronic
976469440 4:85410775-85410797 GACATTAAAGATAATTAAGTAGG - Intergenic
976673434 4:87678776-87678798 AAGATTCTATAGAAGGAAGTGGG + Intergenic
977576627 4:98681797-98681819 GACATTAAAGATAATGAAGCAGG + Intergenic
978000411 4:103550902-103550924 GAGATGAAAGAGAAGCAATTGGG + Intergenic
978290323 4:107130272-107130294 GACATCAGAGGGAAGGAAGTCGG + Intronic
978826887 4:113035400-113035422 GAGATGAAAGAAAAGAAAATAGG + Intronic
979672891 4:123379783-123379805 GAGATGAAAAAGAAGGAAATGGG + Intergenic
979801098 4:124909873-124909895 AAAATTAAAGAGAATGAAATAGG - Intergenic
980726579 4:136769633-136769655 GAGGGTGAAGAGAAGGAAGTGGG - Intergenic
981252639 4:142622666-142622688 GTGATCCAAGAGAAGGAACTTGG + Intronic
981254382 4:142644238-142644260 GAGGAGAAAGAGAAGGAAGGGGG + Intronic
982640804 4:157957663-157957685 AAATTTAAAGAAAAGGAAGTTGG - Intergenic
982763612 4:159317707-159317729 GGGATTAAAAAGAAAGAAATTGG - Intronic
983825646 4:172255872-172255894 GCAATTAAAAAGAAGGAAGAGGG + Intronic
984017530 4:174443621-174443643 GAGATGAAAGAAAAGGAGGAGGG - Intergenic
984125407 4:175803131-175803153 GAGGAGAAAGAGAAGGAAGAGGG - Intronic
985224458 4:187745155-187745177 GAGATCAAAGGGAAAGGAGTGGG + Intergenic
986067061 5:4245124-4245146 GAGAAGAAAGAGAAGGAAAACGG - Intergenic
986129375 5:4912731-4912753 GAGAGAAAGGAGAAGGAAGAAGG + Intergenic
986190535 5:5492915-5492937 GAAAGGAAAGAGAAGGAAGGAGG + Intergenic
986701341 5:10412479-10412501 GAGAGTGAAAAAAAGGAAGTGGG + Intronic
986776773 5:11022633-11022655 GAGAATCAAGAGAAGGAAAATGG - Intronic
987490768 5:18578047-18578069 GAGAGAAAAGAGAAGGTAGTAGG + Intergenic
988095395 5:26601970-26601992 GAGAGAAAAAAGAAGGAAGTGGG - Intergenic
988403869 5:30799046-30799068 AAGAATAAAGAGAAGAAAGGAGG + Intergenic
988404625 5:30808245-30808267 GAAAGAAAGGAGAAGGAAGTAGG + Intergenic
988848078 5:35150229-35150251 AAGAATAAAGAGAAAGAAGTGGG - Intronic
989351996 5:40497178-40497200 GAAATTAAAGAGAAGAAGTTGGG + Intergenic
989510864 5:42286515-42286537 GAGAAGACAGAGAAGGAAGCAGG + Intergenic
989967244 5:50478852-50478874 CAAATTAAAGAGAAGGATATAGG + Intergenic
990136366 5:52649146-52649168 GAGTCTAAAGAAAAGGCAGTCGG + Intergenic
990219770 5:53575080-53575102 GAGAGAAAAGAGAAGAAAATGGG + Intronic
990258784 5:53999116-53999138 GAGAATAAAGAGAAGGCTGTAGG + Intronic
990758796 5:59105647-59105669 AAGATTAAAAAGCAGAAAGTGGG + Intronic
991043042 5:62195045-62195067 GGCAGTAATGAGAAGGAAGTGGG + Intergenic
991190403 5:63866259-63866281 GAGATTAGAGACAAGAAAGAAGG - Intergenic
991474270 5:67003473-67003495 GAGGATAAAGAGAAGGAAGAGGG - Intronic
991991096 5:72340408-72340430 GATAATAAAGATAAGGAAATGGG + Intronic
992522176 5:77565561-77565583 CATATTAAAGAGAAAGAAATTGG + Intronic
992559854 5:77940288-77940310 GAGATGAAAGAATAGGAAGCAGG - Intergenic
992708241 5:79420490-79420512 GAGATCAAAGTGAGGGAAGAGGG - Intronic
993293441 5:86104653-86104675 GAAATTAAAAAGAAGCAAGCGGG + Intergenic
993525294 5:88957959-88957981 GAGAATAAAGAAAAGAAAGCAGG - Intergenic
993677959 5:90840156-90840178 GAGAGTAGAGAGAAGGCAGAGGG - Intronic
993767947 5:91886005-91886027 GAGATAAAACAAAAGGCAGTTGG + Intergenic
993931314 5:93944713-93944735 GAGATGAAAAAGAAGAAAGAGGG + Intronic
993996146 5:94725618-94725640 GAGAGTTTAGAGAAGGAGGTGGG + Intronic
994195108 5:96914314-96914336 GAAATGAAAGAGAAGGAACTAGG - Intronic
994625535 5:102214347-102214369 GAGATATAAAAGGAGGAAGTCGG + Intergenic
995345694 5:111114310-111114332 GAGAAAAATGAGAAGGAAGGTGG + Intronic
995934708 5:117495824-117495846 GACATTGATGAGAAAGAAGTTGG - Intergenic
996801038 5:127403268-127403290 AAAATTAAAGAAAAAGAAGTAGG - Intronic
996952578 5:129145628-129145650 GAGGTTAAAGAGATAGATGTTGG - Intergenic
997115745 5:131124111-131124133 GGGATGAAAGAACAGGAAGTAGG - Intergenic
998261302 5:140633701-140633723 TAGGTTCAAGAAAAGGAAGTTGG + Exonic
998581042 5:143376445-143376467 GAGCTTAGAGAGAAGGAACGTGG - Intronic
998621502 5:143799469-143799491 GAGATTCAAGAGAAGAACATGGG + Intergenic
998834382 5:146189910-146189932 AAGAATAAAGAGAAGAAGGTAGG + Intergenic
999445025 5:151632469-151632491 GAGGTTAGAGAGGAGGAAGGTGG + Intergenic
999585536 5:153085740-153085762 GAGAATGGAGAGAAGGAAGAAGG + Intergenic
999606448 5:153322015-153322037 GATATTTAGGAGAAAGAAGTCGG + Intergenic
999616327 5:153428486-153428508 GAAAAGAAAGAGAAGGAAGGAGG + Intergenic
1000743430 5:164998792-164998814 GAGATAAAGGAGAAGCAGGTGGG - Intergenic
1000918949 5:167116164-167116186 AAGGATAAACAGAAGGAAGTAGG + Intergenic
1001893818 5:175361913-175361935 GAGGAAAAAGAGAAGGAAGAGGG + Intergenic
1002741773 5:181439584-181439606 GAGACTCAAGAGGAGGAAGAGGG + Intergenic
1002893274 6:1356442-1356464 GCCATTAAAAAGAAGGAAGTAGG + Intergenic
1004535117 6:16492901-16492923 GAAATTAAAGAGGAGGAGCTGGG - Intronic
1004601638 6:17156084-17156106 GGGATGAAAGAAAAGGAAGGAGG - Intergenic
1005441997 6:25880094-25880116 TAGATTTAAGAGAAGGGAGAAGG - Intronic
1006539735 6:34729942-34729964 GAGATTCATGAGCAGGATGTAGG - Intergenic
1006721009 6:36151207-36151229 GATATTAATAAGAAGGAAGCTGG - Intergenic
1006881380 6:37342937-37342959 GAGATAAAAGCAAAGGAAATGGG + Intergenic
1007150288 6:39683823-39683845 GATATAAAAGAGGAGGAAGTAGG + Intronic
1007261622 6:40568056-40568078 GAGAGAGAAGAGAAGGAAGGGGG - Intronic
1008103556 6:47418612-47418634 GACATGAAAGAGAATGAAGTTGG - Intergenic
1008227556 6:48939178-48939200 GAGATGAAAGAAAAGGAAAGGGG + Intergenic
1008342538 6:50384927-50384949 GATTTGAAAGAGAAGGAAATGGG + Intergenic
1008499085 6:52162407-52162429 GAGAAGGATGAGAAGGAAGTAGG - Intergenic
1008725606 6:54414656-54414678 GAGAGTAAAGTTAAGGAAGCTGG + Intergenic
1010348992 6:74849342-74849364 AAGTTTAAAGAGAAGGATGTAGG - Intergenic
1010709606 6:79158377-79158399 GAAATTACCGAGAAGAAAGTTGG + Intergenic
1011503901 6:88020261-88020283 GAGAAGAGAGATAAGGAAGTAGG - Intergenic
1011836090 6:91433102-91433124 GTAATGAAAGAGAAGGAATTTGG - Intergenic
1012136021 6:95556998-95557020 CAGATTAATAAAAAGGAAGTGGG - Intergenic
1012516337 6:100064898-100064920 GAAATCAAAGAGAATGAAATGGG + Intergenic
1012530888 6:100234949-100234971 GAGAAGAAAGAGAGGGAAGGAGG + Intergenic
1012835210 6:104255945-104255967 AAGATTGATGAGAATGAAGTGGG - Intergenic
1013026996 6:106285103-106285125 GAGAATAGAGAGATGGAAATTGG - Intronic
1013046697 6:106492752-106492774 GAGGTAAAAGGGAAGGAAGAAGG - Intergenic
1013490036 6:110637429-110637451 GTGTTTAAAGAAAAGGAAGTTGG + Intronic
1014484081 6:121977755-121977777 GAGAGTCAGGAGAAGGGAGTGGG + Intergenic
1014645547 6:123968236-123968258 GAGAGCAAAGAGAAAGAGGTGGG + Intronic
1014653125 6:124065992-124066014 GAGATTAAAGAGAAGGAAGTGGG + Intronic
1014982582 6:127962581-127962603 GAGAGTAAAGGGAAGGAAAATGG - Intergenic
1015526571 6:134179894-134179916 TAAATTAAAGAGAAGCCAGTGGG + Intronic
1015666195 6:135631762-135631784 GAAATTAAAGACAAGGGATTTGG + Intergenic
1015973549 6:138767042-138767064 GAGAAGAAAGAGAGGGAAGGAGG - Intronic
1016027750 6:139305700-139305722 AATGTTAAGGAGAAGGAAGTGGG + Intergenic
1016583897 6:145662157-145662179 GAGAGAGAAGAGAAGGAAGTGGG - Intronic
1016681438 6:146833650-146833672 GAGATAATAGAGAAGGCAGAAGG + Intergenic
1016784306 6:147993271-147993293 GGGAGTAAAGAGAAGGGAGAGGG + Intergenic
1016816295 6:148306204-148306226 GAGTGGAAAGAGAAAGAAGTAGG - Intronic
1016935392 6:149445870-149445892 GAGAATAAACAGAAGGAAACAGG + Intergenic
1019124103 6:169827786-169827808 GAGAATAAAGAGAAGGATGGAGG - Intergenic
1019246913 6:170715341-170715363 GAGACTCAAGAGGAGGAAGAGGG + Intergenic
1020189429 7:5983950-5983972 GCCATTAAAAAGAATGAAGTAGG - Intronic
1020293489 7:6740706-6740728 GCCATTAAAAAGAATGAAGTAGG + Intergenic
1020654274 7:10911098-10911120 GGCATTTAAGAGAAGGAGGTTGG - Intergenic
1020685386 7:11287361-11287383 ATGATTAGAGAGAAGGAAGAGGG - Intergenic
1021199326 7:17710645-17710667 GGGAAGAAAGAGAAGGAATTGGG - Intergenic
1021291865 7:18855288-18855310 GTTATTACAGAGAAGGGAGTTGG + Intronic
1021484533 7:21153078-21153100 GAGATTGGAGAGGAGAAAGTTGG + Intergenic
1021783884 7:24133808-24133830 GAGCTTTAGGGGAAGGAAGTTGG + Intergenic
1022846977 7:34220133-34220155 GAGAGGAAAGAGAAGCGAGTTGG - Intergenic
1022901173 7:34811965-34811987 GAGAAGAAAGAGAAGGAAAGAGG - Intronic
1023300431 7:38764643-38764665 GAGATTAAACAGAATGAGGAGGG + Intronic
1023658197 7:42447376-42447398 GGGCTAAAAGAGCAGGAAGTTGG - Intergenic
1024141721 7:46468877-46468899 GAGAATACAGAGAGGGAAGGAGG - Intergenic
1024324412 7:48097578-48097600 GAAATGAAGAAGAAGGAAGTAGG - Intronic
1025165127 7:56705728-56705750 AAGATAAAAGAATAGGAAGTGGG - Intergenic
1025705167 7:63856386-63856408 AAGATAAAAGAATAGGAAGTGGG + Intergenic
1025872320 7:65446690-65446712 GAGATAAAAGAAAAGCCAGTTGG + Intergenic
1026206234 7:68260278-68260300 GAGACAAAAGAGAAGGAGGAAGG - Intergenic
1027733686 7:81906527-81906549 GAGCTGAAAGGGAAGGAAGCTGG + Intergenic
1028368904 7:90068690-90068712 GACACTGAAGAGAAGGAAATAGG + Intergenic
1029338993 7:99927824-99927846 GAAATTAAAGAGTAGGAACTTGG + Intronic
1030168622 7:106579493-106579515 GAAATTAAAGAGAAACAAGAAGG + Intergenic
1030663587 7:112249568-112249590 GTGGTCAAAGAGAAGGAAATAGG + Intronic
1030711545 7:112756052-112756074 GGGATCCAAGAGAAGGAATTTGG + Intergenic
1030839799 7:114334620-114334642 GAGATTAAAAAAAAAGAAGAAGG + Intronic
1030854720 7:114540703-114540725 GGGCTTAAAGAAAAGGAATTTGG + Intronic
1031326437 7:120404805-120404827 GAGAAGAAAGGGAAGGAAGGAGG - Intronic
1031407500 7:121404309-121404331 GAGAGAAGAGAGAAGAAAGTGGG + Intergenic
1031731335 7:125304690-125304712 GAGATTAAAGAAAAAGAAGATGG - Intergenic
1032275830 7:130454439-130454461 GAAAGTAGAGAGAAGGAAGATGG + Intergenic
1032736294 7:134695617-134695639 GAAAAGAAAGAGAAGGAAGAAGG - Intergenic
1032748791 7:134815013-134815035 GAGAATAAAGGGTAGGAAGCAGG - Intronic
1033254954 7:139792429-139792451 GAGAATAAAGACAAGTAGGTAGG - Intronic
1033785736 7:144727621-144727643 GAGATAAAAGAAAAGGCAGCTGG - Intronic
1033970429 7:147032724-147032746 GAGAGAAAAAGGAAGGAAGTTGG + Intronic
1034239166 7:149596630-149596652 GAAAAAAAAGAGAAGGAAGAAGG + Intergenic
1034256159 7:149725676-149725698 GAGTTCTGAGAGAAGGAAGTAGG - Intronic
1034464069 7:151215445-151215467 TAGAGTAAAGAAAAGGTAGTAGG + Intronic
1034847523 7:154460373-154460395 CAGAGTGAAGAGACGGAAGTGGG - Intronic
1034888790 7:154820739-154820761 GAGATTGGGGAGAAGGAAGGGGG + Intronic
1035487014 7:159233881-159233903 CAGAATAAAAAGAAGAAAGTTGG - Intergenic
1035501228 8:92612-92634 GAGACTCAAGAGGAGGAAGAGGG - Intergenic
1036445523 8:8818794-8818816 GGGACTTTAGAGAAGGAAGTAGG - Intronic
1036628806 8:10496123-10496145 GAGAAGAAAGAGAAGGAAAAAGG + Intergenic
1037208832 8:16360313-16360335 GAGACTAAAGAGAGGGAGGAGGG + Intronic
1037360853 8:18072008-18072030 TAAGTTAAAGAGTAGGAAGTTGG - Intronic
1037692457 8:21193762-21193784 GAGCTGAAAGAGAAGGAGGAAGG + Intergenic
1038552324 8:28480923-28480945 GAGAGCAAAGAAAAGGAAGCAGG + Intronic
1039097788 8:33905100-33905122 AAGATAACAGAGAAGGAAGAAGG - Intergenic
1039925765 8:41930805-41930827 GAGAGAAAAGAGAATGGAGTTGG + Exonic
1041102948 8:54415035-54415057 GAGATAAAAGAGAGGAAAGAGGG + Intergenic
1041392409 8:57358778-57358800 GAGAAGAAAGAGAGGGAAGGGGG - Intergenic
1041510864 8:58653917-58653939 GAGATAAAAGGAAAGTAAGTGGG + Intronic
1043058566 8:75471597-75471619 GAAATTAATAAGAAGGAAGGAGG - Intronic
1043451946 8:80376586-80376608 GCTATTGAAGAGCAGGAAGTGGG + Intergenic
1043524202 8:81078948-81078970 AAGATGGAAGATAAGGAAGTGGG - Intronic
1043830495 8:84982765-84982787 GAAATTAAAGAGAGGGAGGTTGG + Intergenic
1044211762 8:89558969-89558991 GAGTGGATAGAGAAGGAAGTGGG - Intergenic
1044505593 8:93014264-93014286 AATATTAAAGAGAAAGTAGTGGG - Intronic
1044532401 8:93322296-93322318 AAAATCAAAGAGAAGGAAGTTGG + Intergenic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1045242183 8:100412152-100412174 GAGCTCAAAGAGCAGGAAGAGGG - Intergenic
1045316427 8:101047549-101047571 ACCATTAAAGGGAAGGAAGTTGG + Intergenic
1045636138 8:104193070-104193092 GAGATTAAAGGGAAGGAGGGAGG - Intronic
1045909506 8:107390156-107390178 TAGATTAAAAATAAGGAACTAGG - Intronic
1046124960 8:109894546-109894568 AAGATCAAAAAGAAGGAAATTGG - Intergenic
1046188466 8:110756150-110756172 CAGATAAAAGTGTAGGAAGTAGG - Intergenic
1046420613 8:113979093-113979115 GAAAGTAAACAGAAGGAAGTAGG - Intergenic
1046966833 8:120176866-120176888 GAGAATAAGGAGGAGAAAGTGGG - Intronic
1047097222 8:121639160-121639182 TAGAATAAAGAGAAGGAAGTTGG - Intronic
1047747536 8:127855925-127855947 GAGATTATGGAGAAGGGAGTGGG - Intergenic
1047846226 8:128808390-128808412 GAGAATAAAGGGAAGGAGGACGG - Intergenic
1048750502 8:137668176-137668198 CAGAACAAAGAGAATGAAGTAGG + Intergenic
1049635694 8:143687634-143687656 AAGATTACAAAGAAAGAAGTAGG - Intronic
1049666289 8:143844721-143844743 GAGATAAAAGAAAAGGCAGCTGG - Intergenic
1049667544 8:143853127-143853149 GAGAGAAAGGAGAGGGAAGTGGG - Intergenic
1051000615 9:12278062-12278084 AAGTCAAAAGAGAAGGAAGTGGG + Intergenic
1051860346 9:21617433-21617455 AAGATTAATGACAGGGAAGTGGG + Intergenic
1052269531 9:26613448-26613470 GAGATAAAAGAAAAGGCAGCTGG + Intergenic
1052483398 9:29062670-29062692 GGGAGTAAAGAGAATGAAATGGG + Intergenic
1052719422 9:32155426-32155448 GAGATAAAAGAAAAGGCAGCTGG - Intergenic
1053018227 9:34676220-34676242 GACATTAAAGAGGTAGAAGTTGG + Intergenic
1053426663 9:38014605-38014627 GAGATTAGAAAGATGGGAGTGGG + Intronic
1054892117 9:70261993-70262015 GAGAAGAAAGAGAAGGTAGCTGG + Intronic
1054968209 9:71054156-71054178 CAGATTAAAGATAAGGAACTTGG + Intronic
1055058471 9:72045281-72045303 GAGAAGAGAGAGAAAGAAGTAGG - Intergenic
1055328120 9:75153366-75153388 GGAATTAAAGAAAAGGAAGGAGG - Intergenic
1056860185 9:90174158-90174180 GAAAAAAAAAAGAAGGAAGTAGG - Intergenic
1057364352 9:94405036-94405058 CACATTAAAAAGAATGAAGTTGG - Intronic
1057658979 9:96983033-96983055 CACATTAAAAAGAACGAAGTTGG + Intronic
1057698038 9:97341271-97341293 GAGATAAAAGAAAAGGCAGCTGG - Intronic
1058159166 9:101549114-101549136 GAGATAAAAGAAAAGGCAGCTGG + Intronic
1058742183 9:107954904-107954926 GAGAGGAAAGAGGAGGAAGGAGG - Intergenic
1058875874 9:109244400-109244422 GAGAAAGAAGAGAAGGAAGGAGG + Intronic
1058906122 9:109484028-109484050 CAGAGTGAAGAGGAGGAAGTTGG - Intronic
1060745533 9:126128492-126128514 AAGATTAAAGGTAAGGAAATGGG + Intergenic
1061017708 9:127991891-127991913 GGGAATTAAAAGAAGGAAGTTGG - Intergenic
1061500723 9:131000334-131000356 GAGATTTAGAAGATGGAAGTGGG - Intergenic
1061835816 9:133328913-133328935 GAGATAAAAGAAAAGGCAGCTGG + Intergenic
1203607684 Un_KI270748v1:70800-70822 GAGACTCAAGAGGAGGAAGAGGG + Intergenic
1185619747 X:1446385-1446407 GAGATAAAAGAAAAGGCAGCTGG - Intronic
1186646893 X:11516846-11516868 GAGATGACAGAGAAGGAGGCTGG - Intronic
1186757290 X:12685355-12685377 GAGATGAGAGAGAAGAAAGAGGG - Intronic
1186792876 X:13016109-13016131 GAGATTAAGGGGAACAAAGTAGG - Intergenic
1187654357 X:21453359-21453381 GAGTTTAAACAGAAGGATGTGGG + Intronic
1187752624 X:22484299-22484321 AATTTGAAAGAGAAGGAAGTTGG - Intergenic
1188349660 X:29112687-29112709 GACATGAAAGAGAAGGACCTTGG - Intronic
1188698676 X:33231704-33231726 AAGAGTCAAGTGAAGGAAGTAGG + Intronic
1188956743 X:36442574-36442596 GAAATAAAAGAAAAGGAAATGGG - Intergenic
1188993841 X:36857932-36857954 GAGTTTAAAGAGAAGAGAGAGGG + Intergenic
1189578490 X:42381143-42381165 GAAATGAAGGAGAAGGAAGCAGG + Intergenic
1189696133 X:43665047-43665069 GGGAATAAAGAGAAAGAACTAGG + Intronic
1190259780 X:48790631-48790653 GAGTGGAAAGAGAAGGAAATGGG + Intronic
1190461063 X:50675921-50675943 GAGATAGAAGAGAAGGGAGTTGG - Intronic
1190553606 X:51611573-51611595 GAGAGGAAAGAGAAAGAAGGAGG - Intergenic
1191685375 X:63884597-63884619 GGGATTAAAGAGGAGGAAGCTGG + Intergenic
1192143956 X:68668213-68668235 GAGAAAAAAGAGAAAGAAGAAGG - Intronic
1192968401 X:76204940-76204962 GAGGGTACAGAGAAAGAAGTGGG - Intergenic
1193269737 X:79515291-79515313 GAGAGGACAGAGAAGGAAGGAGG - Intergenic
1193436946 X:81485764-81485786 TAGATTAAAGGTAAAGAAGTGGG + Intergenic
1194074267 X:89369059-89369081 GGGATTTAAGGGATGGAAGTAGG + Intergenic
1194413650 X:93583798-93583820 GATATCAAAGAGAAGGAAGTTGG + Intergenic
1194557462 X:95378272-95378294 GAGATTAAAAAAATGGAATTTGG + Intergenic
1194565442 X:95481855-95481877 AAGATTATAGAAAATGAAGTTGG - Intergenic
1194767521 X:97859140-97859162 GAGATAGAAAAGAAGGAAGAGGG + Intergenic
1195026723 X:100884856-100884878 AAGATTAAATAGAAAAAAGTTGG + Intergenic
1195694795 X:107658949-107658971 GAGAAAGAAAAGAAGGAAGTAGG + Intergenic
1196020492 X:110985940-110985962 GAGATTGAAGAGAAGCCAGGGGG - Intronic
1196820604 X:119697425-119697447 GAAAAGAAAGAGAAGAAAGTTGG + Intergenic
1197077881 X:122375165-122375187 GAGATAAAAGAAAAGGCAGCTGG + Intergenic
1197242776 X:124137327-124137349 GAGATAAAAGAAAAGGCAGCTGG - Intronic
1197627001 X:128813415-128813437 GACATTAAAGAGAACAAAGAGGG + Intergenic
1197886768 X:131226361-131226383 GAGATTAGAGAGCAGCAAGTAGG - Intergenic
1198197015 X:134373404-134373426 GAGGGTAAAGAGAAAGAAGTCGG - Exonic
1198287594 X:135207217-135207239 GAGATAAAAGAAAAGGCAGCTGG - Intergenic
1198320578 X:135515499-135515521 GAGATGAAAAACAAGGTAGTTGG + Intergenic
1198344650 X:135747660-135747682 GAGATAAAAGAAAAGGCAGCTGG + Intergenic
1198998605 X:142606276-142606298 GAGATAAAAGAAAAGGCAGCTGG + Intergenic
1199009561 X:142743124-142743146 TAGATTAAAGACAAGGAGGCTGG - Intergenic
1199218733 X:145292092-145292114 TAGATTAATGAGGAGGGAGTAGG - Intergenic
1199587844 X:149435230-149435252 AAGATCAAAGAGTAGGAGGTTGG - Intergenic
1199680836 X:150223577-150223599 GAGAGAAAAGAGAAGGAACATGG + Intergenic
1199878446 X:151953892-151953914 GGGGTCAAAGAGAAGGAAGAGGG + Exonic
1200729660 Y:6720586-6720608 GGGATTTAAGGGATGGAAGTAGG + Intergenic
1201343854 Y:12961193-12961215 GAGATAAAAGAGAAGACAGCTGG + Intergenic
1201974309 Y:19831909-19831931 GAGATAAAAGAGAAGACAGCTGG + Intergenic