ID: 1014659340

View in Genome Browser
Species Human (GRCh38)
Location 6:124148423-124148445
Sequence CTGTAAATCAGTAGTTGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 1, 2: 4, 3: 42, 4: 331}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014659340_1014659342 5 Left 1014659340 6:124148423-124148445 CCCTGGCAACTACTGATTTACAG 0: 1
1: 1
2: 4
3: 42
4: 331
Right 1014659342 6:124148451-124148473 TCTCTTTACATTTGCCTATCTGG 0: 1
1: 0
2: 6
3: 49
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014659340 Original CRISPR CTGTAAATCAGTAGTTGCCA GGG (reversed) Intronic
900787896 1:4660287-4660309 CTACAGATGAGTAGTTGCCAGGG + Intronic
902619198 1:17640553-17640575 AAGTAAATTAGTGGTTGCCAGGG + Intronic
902657623 1:17880248-17880270 CTGACAGTCAGTAGGTGCCAGGG - Intergenic
903556193 1:24195452-24195474 TTGTATATCAGTGGTTGCCAGGG + Intergenic
905260507 1:36714902-36714924 AAGTAGATCAGTGGTTGCCAGGG + Intergenic
906958049 1:50393323-50393345 AGGTAGATCAGTAGTTGCCAGGG - Intergenic
910404091 1:86867524-86867546 CAACAAATCAGTGGTTGCCAGGG + Intronic
911088174 1:93996959-93996981 AAGTAGAACAGTAGTTGCCAAGG + Intronic
911720343 1:101183955-101183977 AAGTACATCAGTGGTTGCCAGGG - Intergenic
912324188 1:108742388-108742410 TTGGAAAGCAGTAGCTGCCAGGG + Exonic
912717554 1:111992479-111992501 CTGAAAGTCAGGAGCTGCCAGGG + Intergenic
912869501 1:113291125-113291147 CTATAAATCTGTAATTGCTAAGG - Intergenic
913235885 1:116782803-116782825 CTGCTAATCAGTAGTTGCCAAGG + Intergenic
913257647 1:116968724-116968746 AAGTAAATTAGTGGTTGCCAGGG - Intronic
917761284 1:178161294-178161316 AAGTAAATTAGTGGTTGCCAGGG - Intronic
918781968 1:188710811-188710833 CTGTAAATCAGACATGGCCAAGG + Intergenic
920886246 1:209931362-209931384 CAGTAAATCAGTGGTTGCCTGGG - Intergenic
921454633 1:215354438-215354460 AAGTAGATCAGTGGTTGCCAGGG + Intergenic
921956185 1:220985293-220985315 AAGTAAAACAGTGGTTGCCAAGG - Intergenic
922989884 1:229897448-229897470 CTCTAAATCAGTGACTGCCAGGG - Intergenic
924240882 1:242039117-242039139 AAAAAAATCAGTAGTTGCCATGG - Intergenic
1062832712 10:616848-616870 CTGCAAATGAGTAGAGGCCACGG - Intronic
1062954226 10:1529670-1529692 CTGCAACTCAGTAGCTTCCACGG + Intronic
1063583141 10:7327391-7327413 CTTTAGATCAGTAGTTGCCCCGG - Intronic
1063747414 10:8900451-8900473 GTGTAAATATGTAGGTGCCATGG - Intergenic
1065679366 10:28213266-28213288 CTGTCATTCAGTAGTTGTGAAGG + Intronic
1066088092 10:31990776-31990798 CTTTAAATCAGTACTGGCCAGGG + Intergenic
1068590864 10:58851719-58851741 ATAAAAATCAGTGGTTGCCAGGG + Intergenic
1068836269 10:61557641-61557663 GAATAAATCAGTGGTTGCCAAGG + Intergenic
1068874908 10:61985538-61985560 AAGTAGATGAGTAGTTGCCAGGG + Intronic
1069060609 10:63890709-63890731 AAGTAAATTAGTAGTTGCCTAGG - Intergenic
1070343051 10:75515189-75515211 AAGTAGATTAGTAGTTGCCAGGG + Intronic
1072471229 10:95715838-95715860 ATATAAATAAGTAGTTGTCAGGG - Intronic
1073894672 10:108141444-108141466 CCTTAAATCATTAGCTGCCATGG + Intergenic
1075913544 10:126147024-126147046 CTGACAATCAGTAGTTGCCATGG + Intronic
1076537010 10:131185641-131185663 CTCAAAATCACTAGTTGCTAGGG + Intronic
1079510973 11:21209907-21209929 ATGTAAATTAGTAGTTATCAAGG - Intronic
1081152527 11:39649470-39649492 GAATAAAACAGTAGTTGCCAGGG + Intergenic
1081435543 11:43023662-43023684 CTGTCTATCAGCACTTGCCAGGG + Intergenic
1082946383 11:58765117-58765139 CTTTAACTCAGTATTTGCCTTGG + Intergenic
1084852353 11:71952289-71952311 ATGTAAATTAGTGGTTGCCTTGG + Intronic
1085005878 11:73089751-73089773 AAGTAAATTAGTGGTTGCCAAGG + Intronic
1085185032 11:74568580-74568602 TTGTACATCAGTAGTTGCTCAGG - Intronic
1085275781 11:75299039-75299061 AGGTAAATTAGTGGTTGCCAAGG + Intronic
1086272653 11:85086182-85086204 GTGTAAATCAGTAGTGCCAAGGG + Intronic
1088127987 11:106451411-106451433 AAGCAGATCAGTAGTTGCCAGGG - Intergenic
1088156355 11:106808685-106808707 CTGCAAATCAGTAGTTTAGAGGG + Intronic
1088352265 11:108903234-108903256 AGGTAGATTAGTAGTTGCCAAGG - Intronic
1088910761 11:114190125-114190147 AAGTAAATTAGTAGGTGCCAGGG + Intronic
1089900829 11:121982449-121982471 CAGCAAATCAGTGGTTGACAGGG + Intergenic
1090910373 11:131113267-131113289 CAGTAGAACAGTGGTTGCCAAGG - Intergenic
1092445064 12:8547840-8547862 CTCTACATCATTAGTTGCCAGGG + Intergenic
1092841169 12:12542445-12542467 AAGTAAATCAGCAGTTGCCAGGG + Intronic
1093473132 12:19526160-19526182 CAGTAGATCAGTGGTTGCCTGGG - Intronic
1094217536 12:27960238-27960260 TTATAAATCAGTATTTTCCAAGG + Intronic
1094240581 12:28218618-28218640 AAGCAAATCAGTGGTTGCCAGGG - Intronic
1096388214 12:51209312-51209334 AAGCACATCAGTAGTTGCCAGGG - Intronic
1096667233 12:53173948-53173970 AAGTAGATTAGTAGTTGCCAGGG - Intronic
1097808605 12:63992822-63992844 CTGTAAATAGGCAGTTTCCAAGG - Intronic
1097986701 12:65790369-65790391 CTGTTAATCAGTATTTTCCTTGG + Intergenic
1099033153 12:77554122-77554144 CTGTAGATCATTAGATGCCATGG + Intergenic
1099935664 12:89122077-89122099 CTGTATAGCAGTGGTTTCCAAGG + Intergenic
1102081875 12:110104747-110104769 CTGGAAATCCGTAGAAGCCATGG - Intergenic
1102354954 12:112225503-112225525 CTGTAAATTGGTAGTTGGCCTGG - Intronic
1102523712 12:113495589-113495611 ATGTAAACCAGAAGTTGCCAGGG - Intergenic
1102796092 12:115689983-115690005 AAGTAAAACAGTGGTTGCCAAGG + Intergenic
1103546875 12:121708498-121708520 CTTCAGATCAGTAGTTTCCAGGG - Intergenic
1104267842 12:127253267-127253289 ATGAAAATCAGTTGTTGTCAGGG - Intergenic
1106155572 13:27152439-27152461 AAGTAAATCAGTGGTTGCCTAGG + Intronic
1106365470 13:29075027-29075049 AAGTAGATTAGTAGTTGCCAGGG - Intronic
1106446481 13:29836910-29836932 CTGAAATTCAGGACTTGCCAAGG + Intronic
1106754459 13:32808963-32808985 AAGTAAATTAGTACTTGCCACGG - Intergenic
1106785410 13:33103181-33103203 TTGTAAATAAATAATTGCCAAGG - Exonic
1108381725 13:49861049-49861071 CTGCAGATCAGTGGTTGCCTGGG + Intergenic
1108416108 13:50199713-50199735 AAGTAAAACAGTGGTTGCCAGGG - Intronic
1109578591 13:64295338-64295360 AAGTAAATCAGTGGTTGCCTAGG + Intergenic
1110918221 13:81049792-81049814 CTGTAATTAAGTACTTGACAGGG + Intergenic
1111505007 13:89176592-89176614 CTGTAAATTAGTATTTTCCTGGG + Intergenic
1111843628 13:93480673-93480695 AGGTAGATTAGTAGTTGCCAAGG - Intronic
1112775124 13:102835477-102835499 AGGTAGATCAGTGGTTGCCAGGG - Intronic
1113604788 13:111597561-111597583 CTGGAAATCACTAATTGACAAGG - Intronic
1114239401 14:20852405-20852427 AAATAGATCAGTAGTTGCCAGGG + Intergenic
1114380251 14:22195754-22195776 CTGTCAATCAGTGGTTGTCTGGG - Intergenic
1114970475 14:28020950-28020972 CTTTAAATCAATAGTTGGTAGGG + Intergenic
1114995119 14:28339907-28339929 AAGAAGATCAGTAGTTGCCAGGG - Intergenic
1116512506 14:45764441-45764463 CTGTAGATCAGAAGTTGGCATGG + Intergenic
1116877309 14:50125249-50125271 CTACAAATCAGGAGATGCCAAGG + Intronic
1117293413 14:54355501-54355523 TTTTAAATCAGTGGTAGCCAGGG + Intergenic
1117774667 14:59170779-59170801 AAGTAAATTAGTAGTTGCCAGGG + Intergenic
1118334304 14:64839392-64839414 AAATAAATCAGTGGTTGCCAGGG + Intronic
1119581310 14:75784207-75784229 AAGTAGATCAGTGGTTGCCAGGG - Intronic
1121034948 14:90694317-90694339 AAGTAAATTAGTGGTTGCCAGGG + Intronic
1121489401 14:94347106-94347128 CTGTAGTTCGGTAGTGGCCAAGG - Intergenic
1121679996 14:95785874-95785896 CTCTCAATCAGTAGTTGCTCAGG + Intergenic
1123189822 14:106558267-106558289 GTAAAGATCAGTAGTTGCCAGGG - Intergenic
1123469562 15:20540132-20540154 CCCTAAATCAGCAGCTGCCAGGG + Intronic
1123648500 15:22460567-22460589 CCCTAAATCAGCAGCTGCCAGGG - Intronic
1123729840 15:23135118-23135140 CCCTAAATCAGCAGCTGCCAGGG + Intronic
1123748010 15:23332600-23332622 CCCTAAATCAGCAGCTGCCAGGG + Intergenic
1124280375 15:28356452-28356474 CCCTAAATCAGCAGCTGCCAGGG + Intergenic
1124302323 15:28555160-28555182 CCCTAAATCAGCAGCTGCCAGGG - Intergenic
1125010371 15:34865870-34865892 AAGTAAATTAGTGGTTGCCAAGG + Intronic
1125010571 15:34868678-34868700 AAGTAAATCAGTGGTTGCCTGGG - Intronic
1125682262 15:41538977-41538999 AAGTAGATTAGTAGTTGCCAGGG + Intronic
1126105355 15:45143565-45143587 CTACAAATCAGCAGTTCCCAGGG - Intronic
1126972623 15:54134231-54134253 GAGTAGAACAGTAGTTGCCAGGG - Intronic
1127409803 15:58694867-58694889 AAGCAAATCAGTAGTTGCCTAGG + Intronic
1128219447 15:65957861-65957883 CTGTTTATCAGAAGATGCCAAGG + Intronic
1128435942 15:67648249-67648271 AGATAAATCAGTGGTTGCCAAGG - Intronic
1128899211 15:71404263-71404285 AAGTAAATTAGTGGTTGCCAGGG - Intronic
1129040379 15:72681119-72681141 CTGAAAAGGAGAAGTTGCCAGGG + Intronic
1130527314 15:84718361-84718383 ATGGAAATCAGTGGTTGCCTAGG + Intergenic
1135502983 16:23013216-23013238 CTGTAGCTCAGAAGTTGGCATGG - Intergenic
1137521287 16:49197552-49197574 CTGTAAATCTGTGGTTCTCAGGG + Intergenic
1138402170 16:56755432-56755454 AAGTAGATTAGTAGTTGCCAGGG + Intronic
1138518071 16:57549733-57549755 GAACAAATCAGTAGTTGCCAGGG - Intronic
1139789952 16:69425736-69425758 CTGCATATCACTAGTTGCCTGGG - Intronic
1139809252 16:69599077-69599099 AAGTAAATTAGTGGTTGCCAGGG + Intronic
1140494855 16:75376552-75376574 ATAAAAATCAGTAGTTGCCTGGG + Intronic
1141184173 16:81775258-81775280 ACGTAGATCAGTGGTTGCCAAGG - Intronic
1141349059 16:83276049-83276071 CTGTAAATCAGTCTTGGCCTAGG - Intronic
1141601234 16:85127589-85127611 CTGTAGATCAGTGGGAGCCATGG - Intergenic
1143935497 17:10480203-10480225 GAGTAAAACAGTGGTTGCCAGGG - Intergenic
1144009212 17:11129986-11130008 CTGAAAATCAGTGGTTTCCTGGG + Intergenic
1145096374 17:20031679-20031701 AAGTAAAACAGTGGTTGCCAAGG - Intronic
1145218149 17:21067612-21067634 AAGTAAATTAGTAGTTGTCAGGG + Intergenic
1145860473 17:28205695-28205717 GTGTAAAACAGTGGTTACCAGGG - Intergenic
1145897522 17:28468924-28468946 AAGTAAAAAAGTAGTTGCCAGGG + Intronic
1146114411 17:30121982-30122004 AAGTAAATTAGTGGTTGCCAGGG - Intronic
1146245909 17:31282531-31282553 AAGTAGATCAGTGGTTGCCAGGG - Intronic
1146276016 17:31516134-31516156 CTGTAAATCAGGAATGGCAATGG - Intronic
1146547689 17:33753272-33753294 AAGAAAATCAGTGGTTGCCATGG + Intronic
1147485841 17:40813134-40813156 ATGGAGATTAGTAGTTGCCAGGG + Intergenic
1148165399 17:45480555-45480577 CTGTATATTAGTGATTGCCAGGG + Intronic
1148408327 17:47441076-47441098 GAATGAATCAGTAGTTGCCAGGG - Exonic
1149631307 17:58126798-58126820 CTGTAAATAAATAGTTGTAATGG - Intergenic
1149751479 17:59149841-59149863 CTAGAGATCAGTGGTTGCCAGGG + Intronic
1150166559 17:62949615-62949637 ATGTACATTAGTAGTTGCCTAGG + Intergenic
1150189439 17:63222526-63222548 TAGCAAATCAGCAGTTGCCAAGG + Intronic
1150191608 17:63246495-63246517 CTGTCAATTAGTGGTTGCCTGGG - Intronic
1150296876 17:64015088-64015110 AAGTGAAACAGTAGTTGCCAGGG + Intronic
1151432462 17:74072763-74072785 ATATAGATCAGTGGTTGCCAGGG - Intergenic
1153804140 18:8697400-8697422 AAGTAGATTAGTAGTTGCCAAGG - Intergenic
1154072980 18:11171218-11171240 ATGTAAATTAGTAGTTCCCAGGG + Intergenic
1155094393 18:22542094-22542116 CTGTAAAACAGTTGTTGGGAAGG + Intergenic
1155262575 18:24058859-24058881 CTGAAAATCATTAGTTATCAGGG - Intronic
1156147698 18:34205700-34205722 GTGTATATAAGCAGTTGCCAAGG + Intronic
1156231232 18:35155788-35155810 CTGTCCTTTAGTAGTTGCCAAGG - Intergenic
1156265661 18:35486323-35486345 AAGTAGATCAGTGGTTGCCAGGG + Intronic
1156283681 18:35668587-35668609 GTGTAGAATAGTAGTTGCCAGGG + Intronic
1157850603 18:51045809-51045831 AAGTAAATCAGTGGTTGCCAGGG - Intronic
1158480525 18:57817675-57817697 AAGGAAATCAGTGGTTGCCAGGG - Intergenic
1159386635 18:67734492-67734514 AAGTAAATTAGTAGTTGCCAGGG - Intergenic
1159669814 18:71209549-71209571 CTCTAAATCAGTACTAGCCTGGG + Intergenic
1159831665 18:73284906-73284928 GCTTAAATCTGTAGTTGCCAGGG + Intergenic
1160069909 18:75619294-75619316 AAGTAGATGAGTAGTTGCCAGGG - Intergenic
1162858408 19:13487461-13487483 CAGAAGATTAGTAGTTGCCAGGG + Intronic
1164780756 19:30889997-30890019 AAGTAGATTAGTAGTTGCCAGGG + Intergenic
1166534925 19:43567128-43567150 AAGTAGATCAGTGGTTGCCAAGG + Intronic
1167967619 19:53159865-53159887 GTTTAAATCAGTAGTTGACTGGG - Intronic
1168650999 19:58092080-58092102 ATGTAGATCAGCTGTTGCCAGGG + Intronic
925535847 2:4915718-4915740 CTGAAAATCAGTAATTCTCATGG + Intergenic
926206356 2:10836719-10836741 AAGTAGATCAGTGGTTGCCAGGG - Intronic
927984760 2:27401408-27401430 ATGTAAATTAGTGGATGCCAGGG + Intronic
928052773 2:28017695-28017717 CTGTAAATTAGTGGTTGCCTAGG - Intronic
929327614 2:40636260-40636282 CTATAAATCAGCAGGTGTCAAGG - Intergenic
929680118 2:43985511-43985533 GTAAAAATCAGTGGTTGCCAGGG - Intronic
930570884 2:53085526-53085548 CAGTAGACCAGTAGTTGCCAGGG + Intergenic
930577831 2:53173527-53173549 CTGTAAATCTTTCTTTGCCAAGG + Intergenic
930675930 2:54200437-54200459 CAGTAGATTAGTGGTTGCCAGGG - Intronic
930956562 2:57209941-57209963 CTGGAAAACAGTATTTGCCTTGG - Intergenic
931292606 2:60888347-60888369 CTTTAAATAAGTAGTGGGCAGGG + Intronic
932174335 2:69585761-69585783 CTTTCAGTCAGTAGTTTCCAGGG + Intronic
932194702 2:69773394-69773416 CTGAAAAGCAGTATCTGCCAGGG + Intronic
932206305 2:69886214-69886236 GTGTACAACAGTAGTTACCAAGG - Intergenic
933298303 2:80515169-80515191 CTGAAAATGAGCAGTTTCCAAGG - Intronic
933502057 2:83125659-83125681 ATGTACATCAGTGGTTGCCAGGG - Intergenic
934511667 2:94949196-94949218 ATGAAGATCAGTAGTTGCCCGGG - Intergenic
934977265 2:98811715-98811737 AAATAGATCAGTAGTTGCCAGGG - Intronic
935295090 2:101642247-101642269 TTGTAAAGCTGTAGCTGCCACGG - Intergenic
935600268 2:104915354-104915376 CTGAATATGAGTAGTGGCCATGG + Intergenic
935931261 2:108128585-108128607 CTGTAAATCTGATCTTGCCAGGG - Intergenic
936256047 2:110913569-110913591 AACTAAATCAGTGGTTGCCAGGG + Intronic
937107742 2:119334192-119334214 AACAAAATCAGTAGTTGCCAAGG + Intronic
937425714 2:121796921-121796943 CAGAGACTCAGTAGTTGCCATGG - Intergenic
937479008 2:122240156-122240178 CTTCAAGTCAGAAGTTGCCAAGG - Intergenic
937974108 2:127570771-127570793 AGACAAATCAGTAGTTGCCAGGG - Intronic
940018727 2:149134246-149134268 TTGTAAATCAGAAGCAGCCAAGG - Intronic
940251516 2:151682173-151682195 ATGCAAATCAGTGGTTGCCTGGG + Intronic
941014515 2:160339518-160339540 CTGTAAATTAATTTTTGCCACGG + Intronic
943058357 2:183011460-183011482 GAGCAAATCAGTAGTTGCCTAGG - Intronic
943135274 2:183902917-183902939 CTGTAAATAAATATTTTCCAGGG - Intergenic
943247108 2:185469347-185469369 ATGGAGATTAGTAGTTGCCAGGG - Intergenic
945189114 2:207167528-207167550 TTGAAATTCAGTATTTGCCAAGG + Intergenic
946082210 2:217130840-217130862 AGGTAGATTAGTAGTTGCCAGGG - Intergenic
947258536 2:228193280-228193302 GAATAAATCAGTAGTTGCCAGGG - Intergenic
948917829 2:241046612-241046634 GAACAAATCAGTAGTTGCCAGGG + Intronic
1169844273 20:9972894-9972916 CAGTAAATTAATGGTTGCCAGGG + Intergenic
1170462914 20:16595830-16595852 ATGTAGATCAGATGTTGCCAGGG + Intergenic
1170584850 20:17726994-17727016 AAATAAATCAGTGGTTGCCAGGG - Intronic
1171211393 20:23319897-23319919 CTCTAAATCAGTGGTTCTCAAGG - Intergenic
1171565399 20:26180545-26180567 CTGCCAATCAGTGGTTACCAAGG + Intergenic
1172050518 20:32113835-32113857 AGGTAAATTAGTAGTTGCCTAGG - Intronic
1174148222 20:48467506-48467528 CTGTAACTCAGAAGTTTCCTGGG - Intergenic
1176418795 21:6498245-6498267 CTGGAAATTAGTACGTGCCAAGG + Intergenic
1178224681 21:30701477-30701499 AAGTAAAATAGTAGTTGCCAGGG - Intergenic
1178321195 21:31607091-31607113 TTACAAATCAGTAGTTGCCAGGG - Intergenic
1178358266 21:31926519-31926541 AAGTAAATTAGTAGTTGCCAGGG - Intronic
1178971143 21:37177995-37178017 GAGTAAATCAGTGGTTGCCAAGG - Intronic
1179694289 21:43106567-43106589 CTGGAAATTAGTACGTGCCAAGG + Intronic
1182407194 22:30145256-30145278 AAAAAAATCAGTAGTTGCCAGGG + Intronic
1185116666 22:48941856-48941878 CTGTAAATCAGCAGCTTCTAGGG + Intergenic
949149309 3:745575-745597 CTGTGAATCAATATATGCCAGGG + Intergenic
949271309 3:2220542-2220564 CTGAAAGTCGGTAGTTTCCATGG - Intronic
949487769 3:4556485-4556507 AAAAAAATCAGTAGTTGCCAGGG - Intronic
950137232 3:10590234-10590256 CTGTAAATCAGTGGTTGCCAGGG + Intronic
950750181 3:15122325-15122347 CTGTAAGACAGGACTTGCCATGG - Intergenic
950816909 3:15714087-15714109 CTTTAAATCAGTGTTTTCCAAGG - Intronic
950944004 3:16925553-16925575 CAGTAATTTAGTGGTTGCCAGGG - Intronic
951973984 3:28482170-28482192 ACAAAAATCAGTAGTTGCCAGGG - Intronic
952244870 3:31576555-31576577 GAGTAAATCATTAATTGCCAAGG + Intronic
953457556 3:43054989-43055011 GTGGGAATCAGCAGTTGCCAAGG - Intronic
953509543 3:43522111-43522133 AAGTAAAGCAGAAGTTGCCAGGG + Intronic
953634669 3:44652625-44652647 CTGGTAATGAGTAGCTGCCAAGG - Exonic
953693143 3:45136849-45136871 AGGCAAATCAGTGGTTGCCAGGG + Intronic
954470536 3:50690584-50690606 ATGTAGAACAGTAGTTGCCAGGG - Intronic
955144008 3:56298198-56298220 AAGTAAATCAGTGGTTACCAGGG - Intronic
955927015 3:64017118-64017140 AAGTAGATCAGTGGTTGCCAGGG + Intronic
956020418 3:64927825-64927847 CTGACAATCAGTAAATGCCACGG - Intergenic
956491980 3:69782303-69782325 CTATCAATCAGTGGATGCCAAGG + Intronic
956587874 3:70883388-70883410 CTGCAAATCAGAAGCTGCAAGGG + Intergenic
957431745 3:80119005-80119027 ATGTAGATCGGTAGTTGCCAGGG + Intergenic
959584343 3:108012162-108012184 TAGTAAATTAGAAGTTGCCATGG - Intergenic
960653351 3:119976522-119976544 TAGTAGATCAGTAGTTTCCAGGG + Intronic
960923764 3:122776079-122776101 AAGTAAATCAGTGGTTGCCAGGG + Intronic
961071273 3:123929779-123929801 AAGTAGATTAGTAGTTGCCAGGG - Intronic
961998980 3:131275120-131275142 CTGGGAATCAGTTCTTGCCATGG - Intronic
963895471 3:150681215-150681237 ATGTAAATTAGTGGTTGCCAGGG - Intronic
964808320 3:160635759-160635781 AAGTAAATTAGTGGTTGCCAGGG - Intergenic
966520323 3:180867916-180867938 AAGTAAATTAGTGGTTGCCAAGG + Intronic
969189739 4:5507571-5507593 CTACCAATCAGGAGTTGCCAGGG + Intergenic
970336896 4:15056628-15056650 CTGTAATTCAGCATTTTCCATGG + Intronic
970715541 4:18917960-18917982 AAGGAAATCAGTGGTTGCCAGGG + Intergenic
970949531 4:21737647-21737669 CTGTAAGGCAATAGTGGCCATGG - Intronic
971153329 4:24057267-24057289 AAGTAGAACAGTAGTTGCCAAGG + Intergenic
971307169 4:25493612-25493634 TGGTAGATCAGTAGTTGCCTAGG + Intergenic
971969614 4:33604699-33604721 GTGCAAGTCAGAAGTTGCCAAGG - Intergenic
972028918 4:34427709-34427731 CTGCCAATCAGTGGTTACCAAGG + Intergenic
973235167 4:47894144-47894166 CTTTAAATCAGAGGTTTCCAAGG + Intronic
974226765 4:59056096-59056118 AAGAAAATCAGTGGTTGCCAGGG - Intergenic
975374339 4:73626060-73626082 GAATAAAACAGTAGTTGCCAGGG - Intergenic
975567845 4:75778582-75778604 ATTTAGATCAGTGGTTGCCAGGG + Intronic
975953528 4:79806017-79806039 ATGTAAATTAGTTGTTGCCAGGG + Intergenic
977348118 4:95843982-95844004 AAGTAGATTAGTAGTTGCCAGGG - Intergenic
977449976 4:97182969-97182991 ATGTAAATCTGTAAGTGCCATGG - Intergenic
978150766 4:105431896-105431918 CAGTAAATTAGTGGTTGCCAGGG + Intronic
979305959 4:119143726-119143748 ATAAAGATCAGTAGTTGCCAGGG - Intronic
982565864 4:156985763-156985785 AAGCAAATCAGTAGTTGCCTGGG - Intergenic
983195446 4:164801241-164801263 CTGTGGATAAGTAGTTCCCATGG - Intergenic
986262294 5:6158735-6158757 AAGTAAATTAGTAGTTGTCAGGG + Intergenic
988145044 5:27294263-27294285 AAGTAAAACAGTAGTTTCCAGGG - Intergenic
988510853 5:31863357-31863379 CTGTTAAGCATTAGTTGGCAGGG + Intronic
988540798 5:32107259-32107281 CTGTAAGTAAGTAGTCCCCATGG + Intronic
990646729 5:57854005-57854027 CTGTAAATCAGTATTAGAGAAGG + Intergenic
990667008 5:58084010-58084032 CTGTAAATTAGTGGTTCTCATGG - Intergenic
990847062 5:60153829-60153851 GAGTAAAACAGTGGTTGCCAGGG + Intronic
990860905 5:60325831-60325853 GTGTAGATTAGTAGTTGCTAGGG - Intronic
991079251 5:62578714-62578736 GTGTAAAACAGAGGTTGCCATGG - Exonic
991105288 5:62836021-62836043 AAGTAAATTAGCAGTTGCCAGGG + Intergenic
992412420 5:76519246-76519268 CCATAGATCAGTAGTTGCCAAGG - Intronic
992519163 5:77531919-77531941 AAGGAGATCAGTAGTTGCCAGGG + Intronic
993570378 5:89530344-89530366 AAATAAGTCAGTAGTTGCCAGGG + Intergenic
994443899 5:99847263-99847285 TTGAAAATCAGTAGCTGCAAAGG + Intergenic
995923903 5:117345752-117345774 AAGTAGATCAGTAGTTGCCAGGG - Intergenic
996041209 5:118813931-118813953 TTGTTCATCAGTATTTGCCAGGG - Intergenic
996438567 5:123463224-123463246 AAGTAGAACAGTAGTTGCCAGGG - Intergenic
996620082 5:125489693-125489715 AATTAAATCAGTAATTGCCATGG - Intergenic
997242416 5:132317362-132317384 AAGTAAATTAGTGGTTGCCAGGG - Intronic
998178415 5:139916569-139916591 AAGTCAATCAGTGGTTGCCAGGG - Intronic
998963853 5:147516479-147516501 CTGTACATCATTATTGGCCAAGG - Intergenic
998991003 5:147816806-147816828 CAGTAAAACTGTAGTTGCAAAGG + Intergenic
999622839 5:153490255-153490277 CTGTAAGTCAGTAGGTGGCAGGG - Intronic
1000167288 5:158664620-158664642 AAGTATATTAGTAGTTGCCAGGG + Intergenic
1000677341 5:164137461-164137483 TTGTAAAGCAGTAGATTCCAAGG + Intergenic
1001248943 5:170130982-170131004 AAGTAAATCAGTAGTTGTCTGGG + Intergenic
1001414433 5:171534693-171534715 CTGTCAATCAGCAGTGACCAGGG + Intergenic
1001761651 5:174212640-174212662 TAGTAGATCAGTAGTTGACAGGG - Intronic
1002346411 5:178550788-178550810 CTGTCACTCAATAGTTGGCACGG + Intronic
1003186841 6:3839458-3839480 AAGTAGATCAGTGGTTGCCAGGG + Intergenic
1004985132 6:21073007-21073029 CAGTAGATCAGTGGTTGCCAGGG - Intronic
1006765829 6:36505578-36505600 CTGTAAATCAGTATTTTACTAGG + Intronic
1008223986 6:48889390-48889412 CAGTAAGTTAGAAGTTGCCATGG + Intergenic
1008577763 6:52877769-52877791 AAGTAAATCAGTTGTTGCAAGGG - Intronic
1009641664 6:66345345-66345367 CTGTGATTCTGTAGTTCCCATGG + Intergenic
1010933354 6:81830801-81830823 ATGTAACTCAGTAGTTTCCAGGG + Intergenic
1011124916 6:83996783-83996805 CAGCAAATCAGTGGTTGCCAAGG + Intergenic
1012174384 6:96061900-96061922 CTGTAAGTCAGTAGTGGCATTGG - Intronic
1012182239 6:96168715-96168737 GAGTAAATCAGTAGATGGCAGGG + Intronic
1012594113 6:101020865-101020887 CTGTAAATCAGTGGTTGCATGGG + Intergenic
1013020866 6:106216545-106216567 AAATAAATTAGTAGTTGCCAAGG + Intronic
1013544950 6:111147018-111147040 AAGTAGATTAGTAGTTGCCAAGG + Intronic
1013911703 6:115283106-115283128 CTTTAAATCAATAGTTCTCAAGG + Intergenic
1014243049 6:119039590-119039612 AAATAGATCAGTAGTTGCCAGGG + Intronic
1014324198 6:119971097-119971119 AAGGAAATCAGTTGTTGCCAGGG + Intergenic
1014659340 6:124148423-124148445 CTGTAAATCAGTAGTTGCCAGGG - Intronic
1015766644 6:136724957-136724979 AAATAAATCAGTGGTTGCCAGGG - Intronic
1016486691 6:144547612-144547634 CTGTAATTCAGTCTCTGCCAAGG + Intronic
1017210165 6:151847096-151847118 CTGTAAATCAATACTTGCCTGGG - Intronic
1023734305 7:43221208-43221230 CTGTGAGTCAACAGTTGCCAGGG + Intronic
1023956065 7:44887605-44887627 GAGCAAATCAGTAGTTGCCTGGG + Intergenic
1023960410 7:44921793-44921815 CTGTAAACCAGTGGTTGTCGAGG + Intergenic
1024886862 7:54152321-54152343 ATGTGACTCAGTCGTTGCCATGG - Intergenic
1025272063 7:57531322-57531344 CTGCCAATCAGTGGTTGCCAAGG - Intergenic
1025961744 7:66229046-66229068 CTATAGATCAGTGGATGCCAGGG - Intronic
1026971268 7:74469450-74469472 AAGTAAATTAGTGGTTGCCAGGG - Intronic
1027471637 7:78581471-78581493 CTGTAAATCAGCAGTAGGGAGGG + Intronic
1028107568 7:86898312-86898334 AAGTAAATCAGTAGTTGCTCAGG + Intronic
1030116745 7:106067538-106067560 CTCTAAATCACTAGTGACCAAGG - Intergenic
1030920181 7:115374642-115374664 AAGTAAATTAGTAGTTGCCTAGG - Intergenic
1034132361 7:148731707-148731729 AAGTAAATGAGTAGTTGCCAGGG - Intronic
1036524808 8:9525224-9525246 CTCTAAATCAATAGTCACCAAGG + Intergenic
1037012294 8:13858716-13858738 CAGTAGATTAGTAGTTGCCAAGG + Intergenic
1038250432 8:25898996-25899018 ATGAAAACCAGTAGTTGCCTGGG - Intronic
1038555410 8:28509613-28509635 AAGTAAAACGGTAGTTGCCAGGG - Intronic
1039572444 8:38598477-38598499 GAAGAAATCAGTAGTTGCCAGGG - Intergenic
1040604740 8:48920613-48920635 CAGTAACTCCGTAGGTGCCAGGG - Intronic
1041049391 8:53918254-53918276 AAGTAAATTAGTGGTTGCCAGGG - Intronic
1042080156 8:65042760-65042782 CTGAAAATCAGCAGTTTCCGTGG - Intergenic
1043267172 8:78280681-78280703 TTATAATTCAGTAGTTGCCTAGG + Intergenic
1043509547 8:80936062-80936084 ATGTAAAACAGTGGTTACCAGGG - Intergenic
1044437394 8:92180096-92180118 CTAAAAATCACTAGTTGCCAAGG - Intergenic
1045088884 8:98718021-98718043 CAGTAGAACAGTGGTTGCCAGGG + Intronic
1045101399 8:98848222-98848244 AAGTAGATTAGTAGTTGCCAGGG - Intronic
1045226314 8:100249571-100249593 GAGTAAATTAGTAGATGCCAGGG + Intronic
1048348080 8:133593119-133593141 CTTGAAATCTGTAGATGCCAGGG + Intergenic
1051643134 9:19242100-19242122 GTACAAAACAGTAGTTGCCAAGG - Intronic
1052761364 9:32595439-32595461 AAGTAAATCAGTGATTGCCAGGG + Intergenic
1053551875 9:39089228-39089250 AAGTAAATTAGTAGTTGCCTAGG - Intronic
1053816006 9:41909366-41909388 AAGTAAATTAGTAGTTGCCTAGG - Intronic
1054614591 9:67278075-67278097 AAGTAAATTAGTAGTTGCCTAGG + Intergenic
1054752949 9:68926958-68926980 AAGTAAATCAGTAGTTGCCAGGG - Intronic
1054792325 9:69267675-69267697 AAGTAGATCAGTAGTTGCCAAGG - Intergenic
1055534848 9:77229451-77229473 AAGTAAATTAGTTGTTGCCAGGG - Intronic
1056149659 9:83773336-83773358 AAGTAGATCAGTGGTTGCCAGGG + Intronic
1057204308 9:93162041-93162063 CAGTAGATTAGTGGTTGCCAGGG + Intergenic
1057283166 9:93727126-93727148 CTGTGAAGCAGTTGTTGCCCGGG - Intergenic
1057536484 9:95913680-95913702 AAGCAGATCAGTAGTTGCCAGGG - Intronic
1057756413 9:97841209-97841231 GAGTAGATTAGTAGTTGCCAGGG + Intergenic
1058190561 9:101909883-101909905 CAGCAGATCAGTAGTTGCCTGGG + Intergenic
1058391946 9:104505287-104505309 TTGAAAATAAGTAGTTTCCAGGG - Intergenic
1058454263 9:105124712-105124734 GAATAGATCAGTAGTTGCCAGGG + Intergenic
1059744358 9:117185740-117185762 CTGTGAAGCAGTAGAAGCCATGG + Intronic
1061243462 9:129387881-129387903 ATGGAGATCAGTGGTTGCCAGGG - Intergenic
1062272578 9:135716617-135716639 ATGCAAATCGGTAGCTGCCAGGG - Intronic
1186281846 X:8001486-8001508 AAGTAAATTAGTGGTTGCCAGGG - Intergenic
1186534891 X:10336915-10336937 CTGTAAATCAGGAGTTAACCAGG - Intergenic
1186756997 X:12681977-12681999 AAGTAGATTAGTAGTTGCCACGG - Intronic
1186794150 X:13028198-13028220 AAGTAGATCAGTAGTTGCCCGGG - Intergenic
1187677409 X:21730530-21730552 CTCTCAATCAGTAGTTGTGAAGG - Intronic
1187717332 X:22115611-22115633 GAGTAGAACAGTAGTTGCCAGGG - Intronic
1188407229 X:29826561-29826583 AAGTCAATCAGTGGTTGCCAGGG - Intronic
1188500014 X:30815214-30815236 GAGTAGATCAGTAGTTGCCAGGG - Intergenic
1189279407 X:39810622-39810644 CTGTCAAGCAGAAGGTGCCAGGG - Intergenic
1189390779 X:40574777-40574799 AAGTAGATCAGTGGTTGCCAGGG + Intergenic
1189741801 X:44125219-44125241 CAGCAGATCAGTAGATGCCAGGG - Intergenic
1189852183 X:45188761-45188783 GAGGAAATCAGTGGTTGCCAAGG - Intronic
1189904108 X:45740246-45740268 CAGTAGATAAGTAGTTGCCGGGG - Intergenic
1189949944 X:46218674-46218696 ATGTAAATCAGTAGTTTCCATGG - Intergenic
1190032797 X:46990868-46990890 AGGTAAATTAGTGGTTGCCAGGG - Intronic
1191962317 X:66717443-66717465 CTGAAAATCAGTGGTCGTCATGG + Intergenic
1193358625 X:80553703-80553725 CAGTAAATTAGTAGTTATCAGGG - Intergenic
1197287176 X:124609485-124609507 TTGTAAGACAGTAGTTGCCAGGG + Intronic
1197291248 X:124661128-124661150 CAGTAGATTAGTGGTTGCCAGGG + Intronic
1198208729 X:134495785-134495807 AAGTAGATTAGTAGTTGCCAGGG - Intronic
1198962532 X:142197347-142197369 ATGAATATCAGTAGTTTCCACGG - Intergenic
1199071715 X:143483575-143483597 ATAAATATCAGTAGTTGCCAGGG - Intergenic
1199419024 X:147621576-147621598 CAGTAGATTGGTAGTTGCCAGGG + Intergenic
1199652272 X:149957994-149958016 AAGTAAATTAGTGGTTGCCAGGG - Intergenic
1199733047 X:150655708-150655730 AAGCAAATCAGTAGTTGCCTGGG + Intronic