ID: 1014660929

View in Genome Browser
Species Human (GRCh38)
Location 6:124170757-124170779
Sequence ATGTTTATTAGGAACATCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 200}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014660929_1014660932 -7 Left 1014660929 6:124170757-124170779 CCGTGGATGTTCCTAATAAACAT 0: 1
1: 0
2: 0
3: 20
4: 200
Right 1014660932 6:124170773-124170795 TAAACATTCAGGTGATACCTAGG No data
1014660929_1014660933 -6 Left 1014660929 6:124170757-124170779 CCGTGGATGTTCCTAATAAACAT 0: 1
1: 0
2: 0
3: 20
4: 200
Right 1014660933 6:124170774-124170796 AAACATTCAGGTGATACCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014660929 Original CRISPR ATGTTTATTAGGAACATCCA CGG (reversed) Intronic
901143237 1:7049274-7049296 ATGTTCCTTAGGAACACCCAGGG + Intronic
901983410 1:13054061-13054083 AAGTTTGTTGGGAACATTCATGG + Intronic
901998679 1:13174857-13174879 AAGTTTGTTGGGAACATTCATGG - Intergenic
908073386 1:60488872-60488894 ATGTTTATTTGATGCATCCATGG - Intergenic
910835070 1:91500687-91500709 CTGTTTTTTAAGATCATCCACGG + Intergenic
913540666 1:119817392-119817414 ATATTGATTAGGAAAATGCAAGG + Intergenic
914038838 1:144029094-144029116 AAGTTCATTATGAAAATCCAAGG + Intergenic
916903978 1:169261736-169261758 GTGTTTATCAGGAAAACCCAGGG + Intronic
918110916 1:181454632-181454654 ATTTTTATTAGCATCATTCAAGG + Intronic
919044952 1:192439525-192439547 CTGCTTATTAGGACCATCTAGGG + Intergenic
921745699 1:218738067-218738089 TTGATTAGGAGGAACATCCACGG + Intergenic
922501554 1:226100607-226100629 ATGCTTGTTAACAACATCCAAGG - Intergenic
924796071 1:247293147-247293169 ATGCTTGTTAGGAAATTCCAGGG + Intergenic
1064471986 10:15644791-15644813 ATATTTATTAAGAGCCTCCAGGG + Intronic
1064840931 10:19591387-19591409 ATGATAATTAGGTAAATCCATGG + Intronic
1065466039 10:26023646-26023668 AAGTCTCTGAGGAACATCCAGGG - Intronic
1065823358 10:29547315-29547337 ATATTTATTAGGAAAATACCTGG - Intronic
1066400956 10:35075316-35075338 ATGTTTAATAATAACATTCAGGG + Intronic
1068756055 10:60654486-60654508 GTGTTTATTATGAATATCAATGG + Intronic
1069319463 10:67150221-67150243 ATGTGTATTTGGAAATTCCATGG + Intronic
1070501063 10:77072899-77072921 ATTTTTATTTGGCACATCCACGG - Intronic
1071025539 10:81108527-81108549 ATGATTATGACGTACATCCATGG - Intergenic
1071314550 10:84381621-84381643 GAGTTTCTTAAGAACATCCACGG + Intronic
1074650048 10:115511013-115511035 ATGTTTATAAACAATATCCAAGG + Intronic
1076237479 10:128876613-128876635 AGGTGGATTAGGAACATCGATGG - Intergenic
1079846242 11:25472652-25472674 ATGTTTGTTTGGAAGATCAAAGG + Intergenic
1079947566 11:26763370-26763392 TTTTTTATTAAGAACAACCAGGG + Intergenic
1081033869 11:38117287-38117309 ATGCTTAATAAGAAGATCCAGGG - Intergenic
1081054225 11:38388022-38388044 CTGAGTATTAGGAACATCAAAGG + Intergenic
1087935031 11:104023502-104023524 ATGTTTATTATTTATATCCATGG + Intronic
1091948601 12:4572216-4572238 TTGTATATTGGGAACACCCAGGG + Intronic
1095145253 12:38719740-38719762 ATGTTTATAAGTAAAATACAGGG - Intronic
1095821335 12:46481954-46481976 AAGTGTCTTAGGGACATCCATGG - Intergenic
1097656912 12:62376695-62376717 GTTTTTATTAAGAACAACCATGG + Intronic
1098875435 12:75861615-75861637 TTGTATATCAGGAACACCCAAGG - Intergenic
1099132985 12:78859807-78859829 ATTTTTATACTGAACATCCATGG - Intergenic
1099837202 12:87921588-87921610 AAGTGTATTAGGAACACCGACGG - Intergenic
1100890576 12:99121168-99121190 ATGCTTATAAGGTAAATCCAGGG + Intronic
1102245852 12:111355298-111355320 ATATTTATTGGGAGGATCCAGGG + Intergenic
1103581019 12:121915605-121915627 ATCTTTAAAAGGTACATCCAAGG - Intronic
1104048100 12:125177605-125177627 CTGTTTATTAAGATCTTCCAAGG - Intergenic
1104111241 12:125706733-125706755 ATGTTTCTTTGCAACATCCTAGG - Intergenic
1104111932 12:125712223-125712245 ATATTTATTAGGACAACCCAAGG + Intergenic
1106204131 13:27573517-27573539 ATGTTTACAAGGAAGAGCCAGGG + Intronic
1108752518 13:53462803-53462825 ATGTGTAGTAGGAAGATACATGG + Intergenic
1109421376 13:62116331-62116353 ATGCTTATTAAGAAATTCCAGGG + Intergenic
1109881857 13:68488987-68489009 ATCATTCTTAGGCACATCCAGGG + Intergenic
1112058571 13:95714856-95714878 ACATTTATTAGAAACATCAAGGG + Intronic
1112329216 13:98464051-98464073 GTATTTATTAGGGACATCCTTGG - Intronic
1114520878 14:23334918-23334940 ATGTTTATTTCAAACATCCATGG - Intergenic
1119063597 14:71502148-71502170 ATGGTTTTTAAGAACAACCATGG - Intronic
1119306110 14:73609440-73609462 ATGCTTATTAGGAACCTGCCAGG + Intergenic
1120560496 14:85986530-85986552 ATGCTTATTTTGAACATCCATGG + Intergenic
1121067432 14:90981774-90981796 ATGCTTATTACCAACATTCAAGG + Intronic
1121867380 14:97375432-97375454 ATTTTTAGTATAAACATCCAGGG - Intergenic
1122727368 14:103766505-103766527 CTGTTGATTAGGAGCAACCACGG - Intronic
1130827477 15:87564567-87564589 GTGTTTATTAGCAAGAGCCATGG + Intergenic
1133792092 16:9016938-9016960 ATTGTTATTTGAAACATCCAAGG - Intergenic
1133864116 16:9625925-9625947 AGGGTTATTGGGAAGATCCAGGG - Intergenic
1134504739 16:14795793-14795815 ATGTTTACTTGGAACAACGAAGG + Intronic
1134575834 16:15333116-15333138 ATGTTTACTTGGAACAACGAAGG - Intergenic
1134726610 16:16423385-16423407 ATGTTTACTTGGAACAACGAAGG + Intergenic
1134940823 16:18288474-18288496 ATGTTTACTTGGAACAACGAAGG - Intergenic
1135180198 16:20266708-20266730 ATGTTTCTGCAGAACATCCACGG + Intergenic
1136668043 16:31831534-31831556 ATGTTTATTTGGTGCATCCACGG - Intergenic
1137357964 16:47784900-47784922 TTGTTTATTTGGAACAGCAAAGG + Intergenic
1137870298 16:51943902-51943924 ATGTTTATTAGGAGCTTAGAAGG + Intergenic
1141327899 16:83079798-83079820 ATATTTATTTGGATGATCCATGG + Intronic
1149913258 17:60585406-60585428 ATGTTTAGTAGTAACATCCTTGG + Intronic
1150841153 17:68606841-68606863 ATGTTTACTTAGAACATCAATGG + Intergenic
1151053039 17:71001315-71001337 ATGTTTAGTAGGCACTTCCATGG + Intergenic
1151223291 17:72629933-72629955 CTGTCTATTGGGAAAATCCAGGG + Intergenic
1153070065 18:1095491-1095513 ATGTTCATTTTAAACATCCAAGG - Intergenic
1153536091 18:6102990-6103012 ATGATTACTAGAAACTTCCAAGG + Intronic
1155831021 18:30514722-30514744 CTGTATATTAGAAACACCCAGGG + Intergenic
1157033219 18:43938749-43938771 ATGTGAATTAGAAACATCCCTGG + Intergenic
1158534232 18:58292909-58292931 ATGTTTATAAGGCACATGAATGG + Intronic
1159439642 18:68460779-68460801 ATATATTTGAGGAACATCCATGG - Intergenic
1163061084 19:14762423-14762445 ATCCTGATTAGGAAAATCCATGG + Intronic
927227378 2:20782066-20782088 GTGTTTATTGTGAACATCTAGGG + Intronic
927370220 2:22345918-22345940 ATATTTCTTACGAACCTCCATGG - Intergenic
929840034 2:45449362-45449384 ACATTTATTAGGAATATCCGTGG - Intronic
930075132 2:47400397-47400419 CTGATTGTCAGGAACATCCAGGG + Intergenic
930860947 2:56071902-56071924 ATGTTTATTTGGTGCATCCATGG + Intergenic
933522073 2:83386687-83386709 AAGTTAATTAAGAACATTCAAGG - Intergenic
935521613 2:104113210-104113232 ATGGTGTTTAGGAACATCCTTGG + Intergenic
937645728 2:124264174-124264196 AAGTTTCTTATGAACACCCACGG - Intronic
937999720 2:127722885-127722907 ATATTTATCAGGAACATAAACGG + Intronic
939883183 2:147653015-147653037 AAATTTATTAGGAAGATACAAGG - Intergenic
940009936 2:149041792-149041814 ATGCTTCTTAGTGACATCCATGG - Intronic
941713027 2:168734628-168734650 CTGTATATTGGGAACATACATGG + Intronic
943938277 2:193955052-193955074 AAGATTATCAGGAACATTCAAGG + Intergenic
1171210785 20:23315351-23315373 ATGTTTGTTTGGATCAGCCAGGG - Intergenic
1171998552 20:31752953-31752975 ATGTTTCTCAGTAACATTCAAGG - Intronic
1174100033 20:48120173-48120195 AGGAACATTAGGAACATCCACGG + Intergenic
1174148781 20:48471242-48471264 AGGAACATTAGGAACATCCATGG + Intergenic
1174516136 20:51093847-51093869 AAGTTTATTAGGAACGTAAAGGG - Intergenic
1177685410 21:24430485-24430507 ATGCTTATTAGTACCATGCATGG - Intergenic
1179073123 21:38091671-38091693 CTGTCTATCAGGAACAGCCAGGG + Intronic
1179163913 21:38920261-38920283 ATGTGTATTAGGAGTCTCCAGGG - Intergenic
1181350137 22:22249286-22249308 GTGTTTATCAGGCACATCAATGG - Intergenic
1182138432 22:27929871-27929893 AGGTTTATTCTGAAAATCCAAGG - Intergenic
1183847184 22:40551995-40552017 AAGATTATTAGGAACTTTCACGG + Intronic
949272244 3:2231618-2231640 ATGTACCTTAGCAACATCCAAGG + Intronic
949515330 3:4802181-4802203 ATATGGATTAGGAACCTCCAAGG + Intronic
950463810 3:13141456-13141478 AGGTTTATTAGGAGAACCCAGGG - Intergenic
951374836 3:21901029-21901051 ATGTTTATTATCATCATCCAAGG - Intronic
953700616 3:45192907-45192929 ATGTGTACTAGGAGCATCTATGG - Intergenic
953735853 3:45493398-45493420 ATGCTCATTAAGATCATCCAGGG - Intronic
955640409 3:61076909-61076931 AAGTTTATTATGCACATACAAGG + Intronic
957530462 3:81434368-81434390 ATGTTTGCTAGGAACAGTCATGG - Intergenic
959470015 3:106738816-106738838 ATGTGTATTACGAACAAGCATGG + Intergenic
959934161 3:112012348-112012370 ATGTTTGTTTGGAACAGTCATGG + Intronic
960168741 3:114433999-114434021 ATGTTTATCAAAAACATGCATGG + Intronic
960463935 3:117971985-117972007 ATGTTTTTTTGGAATTTCCATGG - Intergenic
960475744 3:118125113-118125135 ATATTTATCATGAACATGCATGG - Intergenic
960961003 3:123070201-123070223 ATGTTTATGAAGAATATCTAAGG + Intronic
963974446 3:151465216-151465238 ATTTTTGTTAGTGACATCCAAGG + Intergenic
964885068 3:161472632-161472654 ATTTTTCTTAGGAACATTTATGG + Intergenic
965130692 3:164695454-164695476 ATGATTAAAAGGAACATACATGG - Intergenic
966476177 3:180349696-180349718 ATAATTGTTAGAAACATCCATGG + Intergenic
970125553 4:12805853-12805875 AAGTTTATTGGGAAGATTCAAGG + Intergenic
971847744 4:31942558-31942580 ATGTTTTCTAGGAACATCTTTGG - Intergenic
972008669 4:34145868-34145890 AAATTTTTTAGAAACATCCATGG - Intergenic
973248317 4:48034502-48034524 ATCTTTCTTGGAAACATCCATGG + Intronic
973949598 4:55998220-55998242 GTATTTATTAGGAATTTCCATGG - Intronic
974197970 4:58601153-58601175 ATTTTTCTTAGGAAAATCCAAGG + Intergenic
975193751 4:71498040-71498062 ATGTTTATCAGGAATTTCCATGG + Intronic
975395849 4:73872442-73872464 ATGTTTACAAGTAGCATCCAAGG + Intergenic
975423277 4:74195125-74195147 ATGTTTTCAAGGAACATCAAGGG + Intronic
979149651 4:117294277-117294299 TTGTTTATTATGTATATCCAGGG + Intergenic
980814981 4:137934035-137934057 ATGTTTACTAGGAAATTTCACGG + Intergenic
981398647 4:144285237-144285259 ATCATTAATTGGAACATCCATGG - Intergenic
983121080 4:163885451-163885473 ATCTTTATTAGGAACATTATAGG + Intronic
984185101 4:176534027-176534049 ATGTTTATAATAAACATTCAAGG + Intergenic
985310869 4:188597266-188597288 ATGTTTATTAGCAACAGTCACGG + Intergenic
986765665 5:10923827-10923849 ATGTTACCTGGGAACATCCAGGG - Intergenic
987870956 5:23615852-23615874 CTGTTAATTAGTAACATCAAGGG - Intergenic
988015936 5:25559568-25559590 ATGTTTATCAGGAACATTATTGG + Intergenic
988277731 5:29104299-29104321 ACATTTATTAAGAACATTCAAGG - Intergenic
989747008 5:44840699-44840721 GTGTATATTAGTAAAATCCAAGG - Intergenic
990046769 5:51442537-51442559 ATATTTAATAGGAAAATCCAGGG - Intergenic
992330074 5:75707601-75707623 ATGTGTATTAGTATCATCTAGGG - Intronic
993040380 5:82807939-82807961 ATGTTTATTAGGGACCTTAATGG - Intergenic
995202045 5:109436504-109436526 AGGTTTATTTGGAAAATGCACGG + Intergenic
996803851 5:127432902-127432924 ATGTTTATTTGTTTCATCCAGGG + Intronic
997448100 5:133957542-133957564 ATCTCTATTATGAACATCAAAGG - Intronic
1001804136 5:174568935-174568957 CTGTTTATATGAAACATCCAAGG + Intergenic
1002457738 5:179355274-179355296 ATGTTTATGAGGAAGATCTGAGG - Intergenic
1003045952 6:2732850-2732872 ATGTTTGGAAGGAACAGCCAGGG - Intronic
1003662977 6:8081412-8081434 ATTTTTATTATGAAAATTCATGG + Intronic
1004293038 6:14385861-14385883 ATGATTTTTAGGAAGATGCATGG + Intergenic
1007059780 6:38927431-38927453 ATGTTTACTAAGAAAACCCAGGG + Intronic
1007212874 6:40210930-40210952 ATGTTTATTAGGAAGGCCCTGGG - Intergenic
1009932345 6:70191247-70191269 ATTTTTATAAGGAAGATCCAGGG - Intronic
1010424943 6:75719127-75719149 ATGTGTATTAAAATCATCCAAGG + Intergenic
1010616998 6:78025187-78025209 ATGCCTATTAGGTACATCCAGGG + Intergenic
1010622745 6:78097165-78097187 ATGTTCATTAGGAAAATATATGG - Intergenic
1010891101 6:81312076-81312098 ATGTTTATTTGGTGAATCCATGG - Intergenic
1010984312 6:82404634-82404656 ATCTTAAATAGGAACATCCTTGG + Intergenic
1011162601 6:84408630-84408652 ATGTTAGTTAGGAATCTCCAAGG - Intergenic
1011698941 6:89937502-89937524 ATGTTGATTATGAGCATCTATGG - Intronic
1012380922 6:98618061-98618083 TTGTTTCTTGGGAACATACATGG - Intergenic
1013199408 6:107878563-107878585 ATATTTATTAGGGCCAGCCATGG + Intronic
1014265528 6:119272535-119272557 ATATTTATTACTAACATACATGG - Intronic
1014660929 6:124170757-124170779 ATGTTTATTAGGAACATCCACGG - Intronic
1015765723 6:136713921-136713943 ATGTTTTTTAAAAACATCCTTGG - Intronic
1015863647 6:137706045-137706067 ATGTGTGTTAGGAACATCAAAGG - Intergenic
1016680366 6:146822171-146822193 ATATTTATTAAAATCATCCATGG - Intergenic
1017628801 6:156375522-156375544 TTTTTAATTAGCAACATCCATGG + Intergenic
1017662169 6:156685645-156685667 TTAAATATTAGGAACATCCAAGG + Intergenic
1018124196 6:160666048-160666070 ATGTATATTCAGATCATCCAAGG - Intergenic
1018312376 6:162524207-162524229 ATGTTGATTAAAAATATCCAGGG - Intronic
1020802571 7:12749729-12749751 ATGTTTATTAGGAAGTGCCTTGG + Intergenic
1021825044 7:24541788-24541810 ATGTTCAGTAGGCACATCAAAGG - Intergenic
1022701958 7:32769696-32769718 ATGGTAATTAGGAGCATCCCAGG + Intergenic
1026095591 7:67343924-67343946 ATGTTTATGAGGCATAACCAAGG + Intergenic
1027199964 7:76057729-76057751 AGGTTTATTAAGAACCCCCAAGG - Intronic
1027744261 7:82054064-82054086 ATTTTTTTTAGGAAAATCAATGG + Intronic
1028680143 7:93518838-93518860 ATGTTTATTAGAAACACGAATGG - Intronic
1030417935 7:109268751-109268773 ATGTTTATTTGCATCCTCCAGGG - Intergenic
1030799825 7:113835992-113836014 ACGTTTGTCAGGAAAATCCAAGG - Intergenic
1031387772 7:121173538-121173560 ATCTTTTGTAGGAACATGCATGG - Intronic
1033491431 7:141847199-141847221 ATGTTTAGTAGGAACTTTCATGG - Intergenic
1033661605 7:143406914-143406936 CTGAGTCTTAGGAACATCCAAGG + Intronic
1033722546 7:144076857-144076879 ATGTTGATGAGGAAAATACATGG + Intergenic
1037168999 8:15867400-15867422 ATGTCTTTCAGGTACATCCATGG - Intergenic
1038437728 8:27548113-27548135 CTGTCAATTAGCAACATCCAAGG + Intergenic
1038569337 8:28647068-28647090 ATGCTTATTAGCAACAGCCGTGG - Intronic
1039006022 8:33037924-33037946 ATGTTTATTAAGAACCTACTAGG - Intergenic
1040458262 8:47621643-47621665 ATGTTTATTAGAGAAATCAAAGG + Intronic
1041128299 8:54667710-54667732 TTGTTTATTTGGTACGTCCATGG + Intergenic
1043322176 8:79001305-79001327 TTGTTTATGAAGAAAATCCATGG - Intergenic
1044067035 8:87711273-87711295 AAGTTTCTTAAGGACATCCATGG + Intergenic
1044106834 8:88219312-88219334 ATGTTAATTATGAACCTCCTAGG + Intronic
1044159475 8:88895569-88895591 ATGTTTATTTAGCATATCCATGG - Intergenic
1044961783 8:97538429-97538451 ATGTTTATTAGGCACCTGCTCGG + Intergenic
1045373059 8:101544209-101544231 CTATTTATTAGAAACATTCAGGG + Intronic
1046027380 8:108741467-108741489 AGGTTTATTTGGGACAGCCATGG + Intronic
1046144310 8:110137665-110137687 AAGATTTTTAGGAAGATCCACGG - Intergenic
1050084412 9:1949706-1949728 TTGTTTACTAGAAAGATCCATGG - Intergenic
1051835098 9:21327362-21327384 ATTTTTCTTAGTACCATCCATGG - Intergenic
1052794441 9:32910307-32910329 ATGTTTATTAAAAACATCTCTGG - Intergenic
1056423705 9:86455315-86455337 ATGTTTCTTTGGAAAATTCAAGG - Intergenic
1056802315 9:89701145-89701167 AGTTTCATTAGGAACCTCCAGGG + Intergenic
1057306468 9:93915162-93915184 ATTTTTAATAGGGACCTCCAAGG + Intergenic
1059921255 9:119162493-119162515 AAGATTATTATGAACATCCAAGG + Intronic
1060909355 9:127336972-127336994 ATGTTTACTTGGAGCCTCCAGGG - Intronic
1061277572 9:129578315-129578337 ATGTTTATTAGGGCCAGGCATGG - Intergenic
1061392315 9:130324305-130324327 ATGTTTTTAAGGTTCATCCATGG + Intronic
1061533635 9:131233974-131233996 TTGTGTATCAGGACCATCCAAGG + Exonic
1186529832 X:10284144-10284166 ATGTTTATTCTGGACATCCTGGG + Intergenic
1187168774 X:16830279-16830301 AAGTTTACTGGGAAGATCCATGG + Intronic
1187730526 X:22249079-22249101 ATGTTTATTTGGACTATGCAGGG - Exonic
1188014874 X:25097323-25097345 ATGTTTATTTGGTGCATCCACGG + Intergenic
1188736134 X:33718618-33718640 ATCATTATTAGAAACATCCTAGG - Intergenic
1190446831 X:50534130-50534152 ATGTTTATGAGGAACAACATGGG + Intergenic
1190819355 X:53959025-53959047 ATATATATTAGGTATATCCATGG + Intronic
1193499677 X:82260273-82260295 ATGTTTATTTGGTGCATCCATGG - Intergenic
1198792307 X:140358663-140358685 ATGTTCATAAGTAACATCAAAGG + Intergenic
1199365207 X:146972328-146972350 ATCTTTCTTAGGAAAAGCCATGG - Intergenic