ID: 1014664825

View in Genome Browser
Species Human (GRCh38)
Location 6:124223940-124223962
Sequence GTTTAAAATGAGATGGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 253}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014664822_1014664825 19 Left 1014664822 6:124223898-124223920 CCTGTGTGTAATCATATCCAGAA 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1014664825 6:124223940-124223962 GTTTAAAATGAGATGGTGCATGG 0: 1
1: 0
2: 1
3: 20
4: 253
1014664823_1014664825 2 Left 1014664823 6:124223915-124223937 CCAGAAAAGAATGCAGAGTGAAA 0: 1
1: 0
2: 7
3: 61
4: 496
Right 1014664825 6:124223940-124223962 GTTTAAAATGAGATGGTGCATGG 0: 1
1: 0
2: 1
3: 20
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014664825 Original CRISPR GTTTAAAATGAGATGGTGCA TGG Intronic
901631500 1:10650337-10650359 GTTTAAAAGGGGATGGGGGAGGG - Intronic
902250520 1:15152139-15152161 GGATTAAATGAGATGGTTCAGGG + Intergenic
902915916 1:19639334-19639356 GATTATAATGAGATGGAGCAAGG - Intronic
903321919 1:22548470-22548492 GTTGGAAATGAGATGGTAGAAGG + Intergenic
903408970 1:23123946-23123968 TTTTAAAGAGAGATGGTGAAAGG - Intronic
904953572 1:34264091-34264113 GGTTAAAATGAGATATTACACGG + Intergenic
905294670 1:36946693-36946715 CTGTGAAATGAGAAGGTGCATGG - Intronic
905330967 1:37196963-37196985 TTTGGAAATGAGATGGGGCATGG - Intergenic
906362954 1:45179925-45179947 GGTTAAAATGATATGGTATAGGG + Intronic
906732747 1:48097309-48097331 GTTTACACTGAGAAAGTGCAGGG - Intergenic
907663768 1:56416605-56416627 GATGCAAACGAGATGGTGCAAGG + Intergenic
908248424 1:62246107-62246129 GGTTTAAATGAGATGGTCCATGG + Intronic
911749945 1:101484478-101484500 TTTTAAAATGACAAGATGCAAGG - Intergenic
911855876 1:102873841-102873863 ATTTAGAAGGAGATGGTTCAGGG - Intergenic
917554099 1:176066278-176066300 GTTTTACATGACATGGGGCATGG - Intronic
919425825 1:197429327-197429349 GTTTAAAATGTAAAGATGCAGGG + Intronic
919976885 1:202618654-202618676 GGATTAAATGAGATGTTGCATGG + Intronic
920078435 1:203354052-203354074 TTTTAAAGTGAGATGGGGCTGGG + Intergenic
920333797 1:205230478-205230500 GTTTTAAGTGAGATGGTGAGGGG + Intronic
921809637 1:219497907-219497929 GTTTAAAGTGGGATGGTGGATGG - Intergenic
922778214 1:228227317-228227339 GATTAACATGAGATGGTGCTTGG + Intronic
923129108 1:231059630-231059652 TTTTAAAATGACACAGTGCATGG - Intergenic
924400240 1:243672217-243672239 GTTTAGAATGAGAAGCTGAAGGG + Intronic
924576666 1:245286744-245286766 TTATAAAAGGAGTTGGTGCAAGG + Intronic
1063656046 10:7989803-7989825 GGTAAAAATGAGATGGTGACTGG + Intronic
1065237096 10:23663746-23663768 TTTTAAAATTAGATATTGCATGG - Intergenic
1068519240 10:58061133-58061155 GTATAAAATGAGAACATGCATGG - Intergenic
1070564510 10:77593405-77593427 GTATCAAATGAAATTGTGCAAGG + Intronic
1072093446 10:92152495-92152517 GTTTAAAAGGGGAAGGTGGAAGG - Intronic
1072101932 10:92237818-92237840 TAATAAAATGAGATGTTGCAAGG - Intronic
1072454743 10:95565862-95565884 GCTGAAGATGAGATCGTGCATGG + Intergenic
1074394937 10:113089737-113089759 GTTTACAAGGAGAGGGTGGAGGG + Intronic
1076449177 10:130544481-130544503 GTTTAAAAGGAGAAGGTCAAAGG - Intergenic
1077601394 11:3577407-3577429 GTTTCAAATGCCATGGAGCAAGG - Intergenic
1078692085 11:13592140-13592162 GTTGAAAATGAGTAGGTGTATGG - Intergenic
1081110910 11:39132059-39132081 GTTTTAAAGGGGATGGTGGAAGG - Intergenic
1085497986 11:76989802-76989824 TTTTTAAATGACATGGTACAGGG - Intronic
1085835627 11:79953297-79953319 GGATAAAATGAGATAATGCAGGG + Intergenic
1086201970 11:84213941-84213963 GTATAAAATGATATGGTTCTTGG - Intronic
1086383934 11:86287981-86288003 GTTTAAAAAGTGATTTTGCATGG - Intergenic
1086435355 11:86774762-86774784 GATTTAAATGAGATAATGCATGG + Intergenic
1088074966 11:105836782-105836804 GTCTTAAATGATATTGTGCAGGG + Intronic
1089015764 11:115163971-115163993 GTAACAAAGGAGATGGTGCAGGG + Intergenic
1089904206 11:122021545-122021567 GGAGAAAATGAGATGATGCATGG - Intergenic
1090683958 11:129094909-129094931 GTATTAAATGAGATGATGCATGG + Intronic
1091117942 11:133032034-133032056 GTTCAAAATCAGATGGTGAAAGG + Intronic
1092759129 12:11793480-11793502 GTTTTGAATGAGATGGTGTGTGG - Intronic
1096482076 12:51948982-51949004 GTGGAAAATGAGGTGGAGCAGGG - Intergenic
1097776324 12:63651104-63651126 GTTGAAAATCAGATGGTTCTAGG - Intronic
1098467303 12:70801956-70801978 GGGTAAAAACAGATGGTGCAGGG + Intronic
1099796269 12:87403973-87403995 ATTTAAAATGATATGGTTCCAGG - Intergenic
1101083059 12:101208826-101208848 GGATTAAATGAGATGATGCAAGG - Intronic
1101583369 12:106064026-106064048 GTGTAAACTAAGACGGTGCAAGG + Exonic
1101693227 12:107100605-107100627 GTTAAAAAATAGCTGGTGCATGG - Intergenic
1102641757 12:114372934-114372956 TTATAAAATGAAATGATGCATGG + Intronic
1103013978 12:117479944-117479966 GATTAAAATGAGACAGTGCGTGG + Intronic
1106539667 13:30678996-30679018 TTTTAAAATTAGGTGGGGCATGG + Intergenic
1108486661 13:50933887-50933909 ATTTAAATTGAGATAGTTCATGG + Intronic
1109352026 13:61195129-61195151 GCATAAAATGAGATGGTGCCCGG + Intergenic
1109436477 13:62310332-62310354 GTTAAAAATCAAATGGTGCAAGG - Intergenic
1110909967 13:80946839-80946861 GTTTAAAATAATATGATACAGGG - Intergenic
1114966020 14:27960819-27960841 TTTTAAAATGAGAAAATGCATGG - Intergenic
1115189705 14:30733984-30734006 TTTCAAAATGAGATGGTATATGG - Intronic
1115693295 14:35869253-35869275 GTTTAAAAAGAGATGAGGCCAGG + Intronic
1116074108 14:40088136-40088158 GTTTAAAAAGGAATGGTGCCAGG + Intergenic
1116127995 14:40813828-40813850 TTTTAAAATGTGAGGGTGCAAGG + Intergenic
1116651154 14:47594741-47594763 TTTAAAAATGAAAGGGTGCATGG - Intronic
1116746272 14:48823287-48823309 ATTTAACATGAGATGTGGCAAGG + Intergenic
1117560910 14:56937632-56937654 GTTTAATAAGAGAGGGTGTATGG - Intergenic
1117881492 14:60317287-60317309 GATTTAAATGAGATGCTACACGG - Intergenic
1118839900 14:69502291-69502313 GTTTAAAATGGCCTGGGGCAAGG - Intronic
1119149842 14:72348661-72348683 GTTTTAAAATAGATGGTGGATGG + Intronic
1119488440 14:75008667-75008689 GTTTTCTATGAGCTGGTGCAGGG + Intronic
1120008788 14:79389713-79389735 GTTGAATATGAGAAGGTTCAAGG + Intronic
1120549968 14:85858446-85858468 CCTTAAAATGAGATGCTGCCTGG - Intergenic
1120717216 14:87852794-87852816 GTATAAAAGGAGAAGGGGCAAGG - Intronic
1121899641 14:97682233-97682255 GTTAAAAATGAGATGCAGCTTGG - Intergenic
1121915205 14:97832220-97832242 GTTTCAATTCAGATGGTCCAGGG - Intergenic
1122057865 14:99117133-99117155 GGATTAAATGAGATAGTGCATGG - Intergenic
1123458726 15:20448431-20448453 GCTAAAACTGAGATGCTGCAGGG - Intergenic
1123583697 15:21738553-21738575 GTATGCAATGAGAGGGTGCAGGG + Intergenic
1123620347 15:22181156-22181178 GTATGCAATGAGAGGGTGCAGGG + Intergenic
1123659335 15:22551984-22552006 GCTAAAACTGAGATGCTGCAGGG + Intergenic
1124265020 15:28224606-28224628 GCTAAAACTGAGATGCTGCAGGG - Intronic
1124313199 15:28646475-28646497 GCTAAAACTGAGATGCTGCAGGG + Intergenic
1124572658 15:30879890-30879912 GTTTAAAATGAGATGACAGAAGG + Intergenic
1126402118 15:48282715-48282737 TTTTAAAATGACATGTTGGATGG + Intronic
1126755937 15:51924771-51924793 GTCCAGAATGAGATGGTGCCAGG + Intronic
1127790918 15:62398078-62398100 GTTCAAGATGAGATTCTGCATGG - Intronic
1131006986 15:88986369-88986391 GTTAGAAAAGAGATGGTTCAGGG + Intergenic
1133370702 16:5243612-5243634 GTTTCAAATGCCATGGAGCAAGG + Intergenic
1133699317 16:8294404-8294426 GTTTTAAATGAGATGCTCAAAGG + Intergenic
1133858578 16:9573080-9573102 GGATTAAATGAGATCGTGCATGG - Intergenic
1133915759 16:10108059-10108081 CTTTAAAATGATTTGATGCAAGG - Intronic
1135745490 16:25013325-25013347 TTTTAAAATGTGAAGGTGCCAGG + Intronic
1136703158 16:32161710-32161732 GCTAAAACTGAGATGCTGCAGGG - Intergenic
1136764541 16:32765888-32765910 GCTAAAACTGAGATGCTGCAGGG + Intergenic
1136803558 16:33104496-33104518 GCTAAAACTGAGATGCTGCAGGG - Intergenic
1137757437 16:50913864-50913886 CTTTAAAATGAGAAGGTGGAGGG + Intergenic
1138912208 16:61414801-61414823 GTTTAAAATGAGATGTTGTGAGG - Intergenic
1139058199 16:63213961-63213983 GTTAAAAATGAAAAGGTGCCAGG + Intergenic
1141621875 16:85240616-85240638 GACTTAAACGAGATGGTGCATGG + Intergenic
1203066898 16_KI270728v1_random:1028013-1028035 GCTAAAACTGAGATGCTGCAGGG + Intergenic
1142493133 17:291370-291392 TTTTAAAATGAGATGGGGGGTGG - Intronic
1143424945 17:6828238-6828260 GTTAAAAATGAGAAGGCGCCCGG - Intronic
1145161543 17:20578522-20578544 GATTCAAATGCGATGGTGGATGG + Intergenic
1148935133 17:51159151-51159173 GTCTAAAATGAGATAGTTGAGGG + Intronic
1153860380 18:9197853-9197875 GTTCAAAATCAGGTGGTTCAAGG + Intronic
1153982989 18:10328448-10328470 ATATAAGATGAGATGGAGCAGGG + Intergenic
1154005483 18:10523897-10523919 GTTAGAAAAGAGATGGTTCAGGG + Intergenic
1154074979 18:11191433-11191455 TTTTAAAAGTAGATGTTGCATGG - Intergenic
1156370321 18:36467029-36467051 GTCCAAACTGAGATGGGGCAGGG - Intronic
1157350097 18:46876328-46876350 GTGCAAAATCAGATAGTGCAGGG + Intronic
1157691876 18:49689964-49689986 GCTCAAAAAGAGATGGGGCATGG + Intergenic
1158304120 18:56085783-56085805 GTGTTCAATGAGATGATGCATGG + Intergenic
1158372735 18:56827898-56827920 GGATTAAATGAGATGATGCATGG + Intronic
1159587032 18:70290772-70290794 GTTTCAAAAGAGATGCTGAATGG - Intronic
1159871705 18:73766179-73766201 GTTAGAAAAGAGATGGTTCAGGG + Intergenic
1160445194 18:78922142-78922164 GGTTAGATTGACATGGTGCATGG - Intergenic
1161920277 19:7260721-7260743 GGGTTGAATGAGATGGTGCAGGG - Intronic
1164909450 19:31993589-31993611 GTTTAAAATGTGAAAGGGCAGGG + Intergenic
1164968108 19:32504813-32504835 GTTTAAAATAAGTAGGTGCCGGG + Intergenic
1168182673 19:54672729-54672751 GTTAGAAAAGAGATGGTTCAGGG - Intronic
1168183128 19:54677184-54677206 GTTAGAAAAGAGATGGTTCAGGG - Intronic
927450836 2:23208022-23208044 GTCTAAATTGAGATGAGGCAGGG - Intergenic
928493854 2:31811992-31812014 CTGTAAAATGAGATCTTGCAGGG + Intergenic
929049670 2:37825408-37825430 GTTGAAAAACAGATGGTCCAGGG + Intergenic
930064512 2:47317414-47317436 GATGAAAATGAGATGGTGGAGGG - Intergenic
931084551 2:58814953-58814975 GTTGGAGATGAGTTGGTGCAGGG + Intergenic
931161116 2:59691600-59691622 GGTTAAAAGGGGATGGTGGAAGG + Intergenic
931745960 2:65292345-65292367 GAATAAAATGAGATGATGCATGG - Intergenic
934528608 2:95069802-95069824 GGATCAAATGAGATGATGCAGGG + Intergenic
935120984 2:100183289-100183311 GCATAAAATGAGATAGCGCATGG - Intergenic
936793409 2:116178687-116178709 GTTTAAAGTGAGATTTTGTAGGG - Intergenic
939755141 2:146100847-146100869 TTTTAAAATGAAAGGATGCAGGG + Intergenic
941171612 2:162144837-162144859 GAAGAAAATGAGATGGTTCAGGG + Intronic
941898513 2:170655090-170655112 GTTTAGAATTACATTGTGCACGG - Intronic
941976176 2:171407583-171407605 GATTAACATAAGATGGTGGACGG - Intronic
942707730 2:178795497-178795519 TTTTAATGTGAGAAGGTGCAAGG - Intronic
943027061 2:182642769-182642791 TTCTAAAATGAGATGATGGAAGG - Intergenic
943262329 2:185682099-185682121 GTGTGGAATGAGATAGTGCAGGG - Intergenic
943817614 2:192276686-192276708 ATTTAACATGAGATTGAGCAGGG + Intergenic
944330232 2:198457131-198457153 GCTTTCAATGAGATGGTGAATGG + Intronic
945950028 2:216030453-216030475 GGCTAAAATGAGATAATGCATGG + Intronic
947024856 2:225725903-225725925 GATTAATATGGGATGGTGAATGG + Intergenic
1170839595 20:19913436-19913458 GTTTAAAATGTGACTGGGCATGG - Intronic
1172602802 20:36195454-36195476 GTTGAAGCTGAGATGGTGCCAGG - Intronic
1175600294 20:60267342-60267364 GTGGAAAGTGAGATGGAGCAGGG + Intergenic
1175744704 20:61447642-61447664 TTTTAGCTTGAGATGGTGCATGG + Intronic
1176524994 21:7859386-7859408 CTTACAAATGAGATGGAGCAGGG - Intergenic
1177468061 21:21515918-21515940 GTTTAAAATTACATGGCCCATGG - Intronic
1177949222 21:27512811-27512833 GTTGAAAATGAGATGCTGCCAGG + Intergenic
1178410270 21:32358098-32358120 GGTTAAAATGAGATGAGGTAAGG - Intronic
1178659014 21:34489399-34489421 CTTACAAATGAGATGGAGCAGGG - Intergenic
1181043779 22:20205132-20205154 GCTGAAAATGACACGGTGCAAGG + Intergenic
1182478832 22:30593189-30593211 GTTAAAAATGAGATGAAGCCGGG + Intronic
950310574 3:11954310-11954332 GGATTAAATGAGATAGTGCATGG + Intergenic
950313987 3:11984245-11984267 GGATTAAATGAGATGATGCATGG + Intergenic
950830866 3:15874783-15874805 GTTGATAATGGGCTGGTGCAGGG + Intergenic
951229502 3:20160555-20160577 GTGTAGTGTGAGATGGTGCAGGG + Intergenic
951451717 3:22847349-22847371 TTTAATAATGAGATGGAGCATGG - Intergenic
951456265 3:22895681-22895703 GTTTAAAAAGTCATGGTGCTGGG - Intergenic
952042047 3:29272467-29272489 ATTCAACATGAGATTGTGCAGGG + Intergenic
952286038 3:31970641-31970663 CTTTAAAATGAGATGGAGGTGGG - Intronic
953187104 3:40648267-40648289 GTGTAAAACCAGATGGTGCTTGG + Intergenic
953763676 3:45715857-45715879 TTTCAAAATGAGATTGTGAATGG + Intronic
956571205 3:70697282-70697304 GTTTAAGATGAGGAGATGCATGG + Intergenic
959477721 3:106831848-106831870 GTTAAAAGTGATATAGTGCATGG - Intergenic
961574604 3:127824040-127824062 GTGTAAAAGCAGATGGTGCATGG + Intergenic
962424560 3:135258306-135258328 GGTTTAAATGAGATAGTGTATGG + Intronic
963271525 3:143290223-143290245 GCATAAAATGGGATGGTCCAAGG + Intronic
964115524 3:153132717-153132739 GTTTAAAATGCAATGGTGGCCGG - Intergenic
965195844 3:165593016-165593038 GTTTAAAATCACATGCTGCAGGG + Intergenic
965661087 3:171042545-171042567 GTTTAAAATGAGGTGGGGCAGGG - Intergenic
965870739 3:173261476-173261498 CTTTAAAATGAAATGGTAAAAGG + Intergenic
966500819 3:180636780-180636802 GTTAAAGATGAGATGGTGGTAGG - Intronic
966549922 3:181193594-181193616 GTTGGAAATGAAAAGGTGCATGG + Intergenic
967215382 3:187205141-187205163 ATTTACAATGAGATGTTTCAAGG + Intergenic
967841655 3:194009689-194009711 GTTTAAAATGACATGGAGTGGGG - Intergenic
967895765 3:194395467-194395489 TTTCAAAATGACATGTTGCATGG + Exonic
969015838 4:4103773-4103795 GTTTCAAATGCCATGGAGCAAGG - Intergenic
969231314 4:5833619-5833641 GGATTAAATGAGATGATGCATGG + Intronic
969738118 4:9004579-9004601 GTTTCAAATGCCATGGAGCAAGG + Intergenic
969797306 4:9536123-9536145 GTTTCAAATGCCATGGAGCAAGG + Intergenic
975237546 4:72016864-72016886 TTTTAAAATGAGAGGGTGTTTGG + Intergenic
975486478 4:74939221-74939243 ATTTCTAATGAAATGGTGCAGGG - Intronic
976517864 4:85992020-85992042 GTATAAAATTATATGGTTCAGGG + Intronic
978903228 4:113978592-113978614 GATGAAAATGAGATGGGGCTGGG + Exonic
979232450 4:118360907-118360929 TTTTAAAATGAGTTGGGGCTGGG - Intergenic
979834654 4:125349384-125349406 GTTTCAAATGAGTTTGTGAATGG + Intronic
979909917 4:126350803-126350825 GTTTACAATGAAATGCTGCTTGG + Intergenic
980654207 4:135760540-135760562 GTTTAAAATGAGATTTGGGATGG + Intergenic
981052841 4:140328090-140328112 GTTTTAAATGGGAAGATGCAGGG + Intronic
981253822 4:142637097-142637119 GTTTAGAAAGGGATGGTTCATGG - Intronic
982645472 4:158019327-158019349 CTTGAAAATGAGATAGTGTATGG + Intergenic
983219922 4:165034125-165034147 ATTTAAAATAAAAAGGTGCAGGG - Intronic
985271865 4:188200959-188200981 TTGTAAAATGAGATGGTGTCTGG + Intergenic
986047197 5:4050515-4050537 GTTTGCAATGAAATGTTGCAAGG - Intergenic
988923686 5:35967501-35967523 GTTTAAAAGGTGAAGGTTCAAGG + Intronic
989237623 5:39167198-39167220 TTTTGAAATGAGATGATGCGGGG + Intronic
992376330 5:76191382-76191404 GTTTATAAATAAATGGTGCAAGG + Intronic
994208551 5:97062440-97062462 GTTTGAAAAGAGATGCTTCAGGG + Intergenic
998010267 5:138689381-138689403 GTTAAATTTGAGATGCTGCAGGG - Intronic
998998266 5:147890874-147890896 GTTTCAAATGAGATGGGAAATGG + Intronic
999017459 5:148123050-148123072 TATTAAAATGAGATGGGACAGGG + Intronic
999408850 5:151332160-151332182 CTTAAAAATGAGATGGAGCCGGG - Intronic
999596769 5:153214117-153214139 TTTTAAACTGAGATGGTCTAAGG + Intergenic
1000351067 5:160353423-160353445 GTATGAAATGAAATGGTGAAGGG - Intronic
1000461231 5:161521133-161521155 CATTAAAATGAAATGGTGCTTGG + Intronic
1001559741 5:172661249-172661271 GTTGAATATCAGATTGTGCATGG + Intronic
1001559751 5:172661305-172661327 GTTGAATATCAGATTGTGCATGG + Intronic
1002790105 6:431030-431052 GTTTAAAAAGACATGGTTCCTGG + Intergenic
1002860367 6:1074550-1074572 GCTAAAACTGAGATGGTCCAAGG + Intergenic
1004222050 6:13755650-13755672 GTTAGAAATGAGATGGTTCCAGG - Intergenic
1006514609 6:34538962-34538984 AATTAATATGAGATGGTGGAGGG + Intronic
1007283478 6:40730144-40730166 GGATAAAATGAGATGATGCAGGG + Intergenic
1007684519 6:43657392-43657414 GATTAAAATGAGATAAGGCATGG - Intronic
1007742942 6:44023810-44023832 GTGTACAGTGAAATGGTGCAGGG + Intergenic
1011199894 6:84824400-84824422 GTTTAGTATGACATTGTGCAAGG - Intergenic
1011401972 6:86973158-86973180 ATTTAAAAGGAGAAGGTGGAGGG - Intronic
1012971389 6:105735517-105735539 GTTTGGAATGAGAAGGGGCATGG + Intergenic
1013297708 6:108774184-108774206 ATTTAAAAGGAAATTGTGCAAGG + Intergenic
1014496628 6:122132285-122132307 GTATAAAAGGGCATGGTGCAAGG - Intergenic
1014588447 6:123231044-123231066 TTTTAAAATGTGTTGCTGCAGGG - Intronic
1014664825 6:124223940-124223962 GTTTAAAATGAGATGGTGCATGG + Intronic
1015186033 6:130416958-130416980 CTTGAAACTGAGATAGTGCAGGG - Intronic
1017910669 6:158789968-158789990 GGCTCATATGAGATGGTGCATGG - Intronic
1020765022 7:12308540-12308562 GCTGAAAATGAGATGTTTCAAGG - Intergenic
1021847419 7:24776295-24776317 CTTCAAAATGAGAAGATGCAGGG + Intergenic
1022140678 7:27491156-27491178 GATTAAAATGGGAGGCTGCAGGG - Intergenic
1022244402 7:28544405-28544427 TATTAAAAAGAGATGGTGCCAGG - Intronic
1022815720 7:33912394-33912416 GTTTGAAATGGGATGGGGAAGGG - Intronic
1022935233 7:35168697-35168719 GTTGAAAATCAGATGGTTCTAGG - Intergenic
1023098366 7:36686939-36686961 TGTTTAAATGAGATAGTGCAAGG + Intronic
1028920992 7:96309903-96309925 AGTTAAAATGAGATGATGAAGGG + Intronic
1029074510 7:97925417-97925439 GTTTCAAATGTCATGGAGCAAGG - Intergenic
1029831187 7:103261473-103261495 GTTGAAAATCAGATGGTTCTAGG - Intergenic
1031100173 7:117470383-117470405 TTTTAAAATGAGATGATCTAAGG + Intronic
1031523221 7:122792173-122792195 GTTTAAAATGAAATGTTTTATGG - Intronic
1031727101 7:125253438-125253460 GTTAAAAATGAGATGTGGCTTGG - Intergenic
1031736516 7:125369238-125369260 ATTTATTATGAGTTGGTGCAAGG + Intergenic
1033622483 7:143074708-143074730 GTTTAGAATGAGTTGGGACAAGG - Intergenic
1033943699 7:146687383-146687405 GGTTTAAATGAGATAGTACATGG + Intronic
1036829532 8:12011319-12011341 GTTTCAAATGCCATGGAGCAAGG - Intergenic
1038114727 8:24540576-24540598 GTTTAAAATGACCTAATGCAAGG - Intergenic
1038702718 8:29864044-29864066 GTTGCAAATGAGACGGAGCATGG - Intergenic
1038720939 8:30034786-30034808 GTTAGAAAAGAGATGGTTCAGGG + Intergenic
1041218670 8:55627179-55627201 GTTTAAAATTAGTTGTTTCATGG - Intergenic
1041327965 8:56689324-56689346 GTTGAAAATGATCTGGTGCAAGG + Intergenic
1042526593 8:69770901-69770923 GTTAAAAATGTGATGGTAAATGG - Intronic
1045861180 8:106816475-106816497 TTTTACAATGTGATGCTGCAGGG + Intergenic
1047787999 8:128172971-128172993 GATGAAAATGAGATTGTGTAAGG + Intergenic
1049934756 9:491113-491135 TTTAAAAATTAGATGGGGCATGG - Intronic
1050528668 9:6568446-6568468 GTTTAAAATGAAGTAGTGAATGG + Intronic
1051720861 9:20035807-20035829 GTTTAAAAGTTGATGGTGCTAGG + Intergenic
1052242844 9:26295368-26295390 CTTTGAAATTAGATGGTGCTTGG + Intergenic
1053423485 9:37996026-37996048 GTTTAAAATGAAATGTACCAGGG + Intronic
1056842158 9:90006948-90006970 GACTAAAGTGAGATAGTGCATGG + Intergenic
1058209091 9:102144849-102144871 GTTCAAGATGAGATGTTGGATGG + Intergenic
1058843789 9:108935386-108935408 GTGTAAAGTAAGATGGAGCAAGG + Intronic
1059744776 9:117189267-117189289 GTTTAAAATGAATGGGTGAATGG - Intronic
1060034419 9:120242643-120242665 TTTTAAAATGAGATGGCAGATGG - Intergenic
1060472565 9:123960744-123960766 AGTTCAAATGAGATGATGCATGG + Intergenic
1060846767 9:126843348-126843370 GTTCAAAATGAAATGGGGCCAGG - Intergenic
1188312013 X:28628882-28628904 GTTTTAGATGAGATAATGCAAGG - Intronic
1188388268 X:29588811-29588833 GTTTTAAATCAGCTGGTGCCTGG - Intronic
1189859358 X:45257358-45257380 GGATGAAATGAGATGATGCAGGG + Intergenic
1190436007 X:50426186-50426208 CTGTAAAATGAGCTGGTACAGGG - Intronic
1193447894 X:81627442-81627464 GGTTAAAATGATATTGTGGAGGG - Intergenic
1194821698 X:98515345-98515367 GTTTAAATTGAGAAGGGGAAGGG + Intergenic
1196242473 X:113359023-113359045 TTTCAGAATGAGATGGTACATGG - Intergenic
1196307447 X:114121361-114121383 CTTTTAAATAAGATGGTGCTAGG + Intergenic
1198493392 X:137166175-137166197 GTTCAATAAGACATGGTGCATGG + Intergenic
1198804358 X:140479023-140479045 TTTTAAAATTAGATTGTGCATGG - Intergenic
1201668836 Y:16492026-16492048 GTAAAAAAGGAGATGGTGCAAGG + Intergenic