ID: 1014665551

View in Genome Browser
Species Human (GRCh38)
Location 6:124232628-124232650
Sequence GATTCAATCAGGAAAGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 195}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014665551 Original CRISPR GATTCAATCAGGAAAGTGGG GGG (reversed) Intronic
901329678 1:8396168-8396190 TCTACCATCAGGAAAGTGGGAGG + Intronic
902730565 1:18366006-18366028 GATTAGATCAGGAACATGGGAGG + Intronic
906586718 1:46984758-46984780 GTTTCAAGCACAAAAGTGGGTGG + Intergenic
908263054 1:62353543-62353565 TTTTCAAGCAGGAAAGTGGAAGG + Intergenic
908654678 1:66375642-66375664 AATTCAATCAGAAATCTGGGAGG - Intergenic
913418897 1:118641934-118641956 CATTCAATTAGGAAAAGGGGAGG + Intergenic
916084656 1:161259475-161259497 CATTCAGTCAGGAACGTTGGAGG + Intronic
916275752 1:162991428-162991450 GGTTCAAGAAGGAGAGTGGGGGG + Intergenic
918174892 1:182035208-182035230 GATTCAATCTGTAAGGTGGGGGG - Intergenic
919333939 1:196208238-196208260 GAGTGATTCAGGAAAGAGGGAGG + Intergenic
920295206 1:204951893-204951915 CATGCAAGCAGGCAAGTGGGTGG - Intronic
921292437 1:213670969-213670991 GCTTCAGTCAGGACAATGGGTGG + Intergenic
922396761 1:225210050-225210072 GTTTCAAGCACGAAACTGGGTGG + Intronic
922677412 1:227561317-227561339 GATAAAAGGAGGAAAGTGGGAGG - Intergenic
922900260 1:229130998-229131020 GATTCAAGCAGGCAAGTGGTGGG - Intergenic
1063492463 10:6477462-6477484 GAATGAATGAGGAAAGTGGATGG - Intronic
1064283248 10:13970034-13970056 GATTCAAGCAGTAATGTGGCTGG - Intronic
1065811050 10:29444234-29444256 GATTCAATCTGTGAGGTGGGAGG - Intergenic
1066102743 10:32132483-32132505 GATTCAATCTGTGAGGTGGGGGG - Intergenic
1066724336 10:38374609-38374631 TATTCAATTAGGAAAAGGGGAGG - Intergenic
1070187575 10:74080442-74080464 GATTCAATGAGGTAAGGAGGGGG + Intronic
1071328936 10:84541754-84541776 GGTTCAATCAGTGAAGTGCGGGG - Intergenic
1072024954 10:91445935-91445957 GATTCAAGCACAAAACTGGGTGG + Intronic
1074795549 10:116939256-116939278 GATTCAAGCACAAAACTGGGTGG - Intronic
1076498155 10:130912966-130912988 GTATCAATCAAGAAAGGGGGAGG - Intergenic
1078431882 11:11294367-11294389 GCTTCCAGAAGGAAAGTGGGTGG + Intronic
1080109861 11:28554465-28554487 GAATCAGTCAGGAAAATGTGAGG - Intergenic
1080182430 11:29441527-29441549 GAAGCAAACAGGAGAGTGGGTGG + Intergenic
1080496559 11:32826490-32826512 AATTCACACAGGTAAGTGGGCGG + Intergenic
1085322667 11:75584192-75584214 GATTCAATCAGGAGACAGTGAGG - Intergenic
1090320203 11:125836557-125836579 GAGTCAGCCAGGTAAGTGGGTGG - Intronic
1090893240 11:130946220-130946242 ATTTCAGTCAGGATAGTGGGTGG - Intergenic
1095126885 12:38490035-38490057 GATTCCATCAGGAAAGTAGTGGG - Intergenic
1097948842 12:65403695-65403717 GATTCAAGCACAAAACTGGGTGG - Intronic
1099646688 12:85366630-85366652 GATTCAAAAAGGAAAATGGATGG - Intergenic
1105552513 13:21410951-21410973 GTTTCAAGCACAAAAGTGGGTGG - Intronic
1106336627 13:28789275-28789297 GTTTCAAGCACAAAAGTGGGCGG - Intergenic
1106787762 13:33124075-33124097 GAATCAATCAGAAAAGCGAGGGG - Intronic
1107812165 13:44211072-44211094 GATTCTTTCAGGGAACTGGGAGG - Intergenic
1108192596 13:47957515-47957537 GAGGCAATCAGGAATGTGGTTGG - Intronic
1109012511 13:56969976-56969998 GATTCAATCAGCCCGGTGGGAGG + Intergenic
1109647878 13:65283813-65283835 TATCCAATCAGAAGAGTGGGGGG + Intergenic
1111784745 13:92772169-92772191 GTTGGAATCAGGGAAGTGGGAGG - Intronic
1114171613 14:20278606-20278628 GATTCAAACAGGAAGTGGGGAGG - Intronic
1114817627 14:25979209-25979231 GTTTCAATCACAAAACTGGGTGG + Intergenic
1115359853 14:32488621-32488643 GTTTCAAGCAGAAAACTGGGCGG - Intronic
1115637059 14:35299958-35299980 GATTAAATAAGGAAATTTGGGGG + Intronic
1115993728 14:39174812-39174834 GATTTAATTAGGAAAGGGCGCGG - Intergenic
1116629789 14:47315561-47315583 GTTTCATTAAGGAATGTGGGAGG - Intronic
1117008375 14:51445323-51445345 GATGACATCAGGAAAGAGGGAGG - Intergenic
1117237934 14:53798257-53798279 GTTTCAATCACAAAACTGGGCGG + Intergenic
1117659500 14:57988680-57988702 CTTTCCATCAGGAAAGGGGGTGG + Intergenic
1118124367 14:62883823-62883845 GATACAAAGAGGAAAGTTGGAGG + Intronic
1118474579 14:66104755-66104777 GATTCAATCTGGGAGGTGGGGGG + Intergenic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1120104419 14:80478067-80478089 GATTCAAGCAGAAAAAAGGGGGG - Intronic
1120678664 14:87452843-87452865 GATTAAGTCAGTGAAGTGGGTGG - Intergenic
1124407420 15:29404740-29404762 GTTTCCATCAGGCCAGTGGGTGG - Intronic
1125057854 15:35383873-35383895 GATTCATTAAAGAAAGTGGCTGG - Intronic
1125100380 15:35905500-35905522 GATTCATTCAGGGACTTGGGAGG + Intergenic
1125242716 15:37594757-37594779 AACTCAAACAGGAGAGTGGGAGG - Intergenic
1126551541 15:49936284-49936306 GAATCAATTAAGAAAGGGGGTGG - Intronic
1127684054 15:61324507-61324529 GAGTCAATCAGAAGAGTGAGAGG - Intergenic
1129383427 15:75182478-75182500 GTTTCAAACAGGAATGGGGGTGG + Intergenic
1131712031 15:95066403-95066425 GATTCAATCAGGTTAGTTAGTGG - Intergenic
1135482775 16:22835880-22835902 GATTCAACCACAAAAGTGAGTGG + Intronic
1135489767 16:22899233-22899255 AATTCAGGCAGGAAACTGGGAGG + Intronic
1137368972 16:47887155-47887177 AATCCTGTCAGGAAAGTGGGTGG - Intergenic
1143427184 17:6849293-6849315 GTTTCAAGCATAAAAGTGGGTGG - Intergenic
1147607971 17:41785102-41785124 AATTCTTTCAGGAAAGCGGGTGG + Intronic
1148675128 17:49440518-49440540 GATTCAGTGAGGAAAGAGGTGGG - Intronic
1149602335 17:57901198-57901220 GTTTCCATCCGGAAAATGGGAGG + Intronic
1150220461 17:63493189-63493211 GAGTCATTCAGGAAAATGGGAGG + Intronic
1152208808 17:78991944-78991966 GATGCAATCAGGAAGGTTGGGGG - Exonic
1152346059 17:79752580-79752602 GAATTAATCAGGGAAGTGGGTGG + Intergenic
1155231578 18:23779737-23779759 GAGTCATCCAGGAATGTGGGTGG + Intronic
1155997247 18:32343221-32343243 GATACAAACTGGAAAGCGGGTGG + Intronic
1157233378 18:45940272-45940294 GATGAAATCAGAAAAGTGGCAGG + Intronic
1157569420 18:48702754-48702776 GATTCAGAAAGGAAAGTCGGGGG - Intronic
1158205939 18:54992546-54992568 GATTAATTCAGGAGGGTGGGTGG + Intergenic
1159479466 18:68969191-68969213 GATTCAGTCAGGAACCTGGATGG - Intronic
1161281532 19:3448391-3448413 GATTCACTGAGGAAGGTGTGAGG + Intronic
1162530307 19:11232110-11232132 GATGCAGCCAGGAAGGTGGGAGG + Intronic
1163399465 19:17083324-17083346 AAATCAATCAGAAAAGTGGCTGG - Intronic
1164818253 19:31223732-31223754 GATAAAATATGGAAAGTGGGGGG + Intergenic
1165767737 19:38361545-38361567 GATTCGATACGGGAAGTGGGTGG + Intronic
1166676324 19:44743250-44743272 GATTAAATAAGAAAAGTGTGTGG - Intergenic
1167576359 19:50319890-50319912 AATTCAATCAGGAAAACGGAGGG - Intronic
929378011 2:41314129-41314151 AATTCAATCAGCAAAGGGAGAGG - Intergenic
930165200 2:48197463-48197485 CATTCTAGCAGGAAAGTGTGGGG + Intergenic
932984956 2:76714672-76714694 GAGACAGTCAGCAAAGTGGGTGG + Intergenic
937143091 2:119618637-119618659 GTTTCAATCACAAAACTGGGTGG + Intronic
937562682 2:123244808-123244830 GTTTCAAGCACAAAAGTGGGTGG + Intergenic
938000405 2:127730189-127730211 GATTACCTCTGGAAAGTGGGTGG + Intronic
938646477 2:133336069-133336091 CCTTCAATCAGGACAGAGGGTGG + Intronic
942301869 2:174570822-174570844 GATTCAATTTTAAAAGTGGGTGG + Intronic
942434507 2:175957059-175957081 GATACAATCAGAAAATTGGCTGG + Intronic
943416093 2:187606437-187606459 GATTTAATACAGAAAGTGGGTGG + Intergenic
947288567 2:228545915-228545937 GCCTAAATCAGGAAAGTGTGTGG + Intergenic
1169956410 20:11108029-11108051 AATTCACGCAGGAAAGAGGGTGG + Intergenic
1171762443 20:29219563-29219585 TATTCAATTAGGAAAATAGGAGG + Intergenic
1173487394 20:43451385-43451407 GATTGAATCATGAATGGGGGTGG - Intergenic
1174059059 20:47819500-47819522 GATTCAATCAGGGGAGTGAGAGG - Intergenic
1174791993 20:53487503-53487525 GTTTGTAACAGGAAAGTGGGGGG + Exonic
1177050247 21:16224654-16224676 GCTTCAAACATGAAACTGGGCGG + Intergenic
1177647288 21:23915892-23915914 GATTCAGGCAGCAAAGTGTGTGG + Intergenic
1178129749 21:29558814-29558836 CATTCATTTAGGAAAGTGGTAGG + Intronic
1179419493 21:41224014-41224036 GAGGAAATCAGGAAAGTGTGGGG + Intronic
1179420422 21:41231713-41231735 CAATCAATCAGGGATGTGGGTGG - Intronic
1179471464 21:41613429-41613451 GATTCAATAAGGCACGTGTGCGG - Intergenic
1181118756 22:20651032-20651054 GGTTAAATCAGGACAGTGCGTGG - Intergenic
1182320360 22:29474999-29475021 GATGGAATCAGGAAAGTGCTGGG + Intergenic
1182571746 22:31244359-31244381 AATTCAATCAGGCAAGAAGGGGG - Intronic
1182930781 22:34172399-34172421 GATTCAATCACATAATTGGGAGG + Intergenic
1184264477 22:43339755-43339777 GATAGAATGAGGAGAGTGGGGGG - Intronic
1185220886 22:49628694-49628716 GATGCACTCAGGAATCTGGGTGG + Intronic
949156401 3:831748-831770 GATACAATCAAGAAAGTGAAAGG + Intergenic
949543544 3:5053208-5053230 TATTCAGTCAGGAATGTTGGTGG + Intergenic
952391577 3:32885146-32885168 GATTCAATCAGGAGGGTGTCAGG - Intronic
955254363 3:57314675-57314697 GATTCCATCAGTAAAATGAGAGG + Intronic
959074512 3:101735748-101735770 GTTTCAAGCACAAAAGTGGGTGG + Intronic
962765672 3:138560412-138560434 GTTTCAATCACAAAACTGGGCGG + Intronic
963481472 3:145879786-145879808 GTTTCAAGCACAAAAGTGGGAGG - Intergenic
963740311 3:149073294-149073316 GATTCAATTTGGAAAGTGGTTGG - Exonic
964721836 3:159775256-159775278 GCTTCTATCAGGAAAGTGTGTGG + Intronic
967715545 3:192758096-192758118 GTTTCAATCACAAAACTGGGCGG + Intronic
967873779 3:194252541-194252563 AATTCAAACAGGAAAAGGGGAGG + Intergenic
968112828 3:196063470-196063492 GATACAGTGAGGGAAGTGGGAGG - Intronic
968541056 4:1168657-1168679 GTTTCAGTCAGGAAGCTGGGGGG - Intronic
969358102 4:6643088-6643110 GCTTCAATCTGGAAGGAGGGTGG - Intergenic
973290729 4:48467878-48467900 GATACACACAGGAAAATGGGAGG + Intergenic
973562609 4:52151549-52151571 GTTTCAAGCACAAAAGTGGGTGG + Intergenic
975458401 4:74620695-74620717 AATTCAATCAGAAAACTGGGGGG - Intergenic
976648890 4:87414181-87414203 GATTCAAACAGGAAAGGGGAAGG + Intergenic
976728250 4:88237127-88237149 TGTTCAATGATGAAAGTGGGGGG + Intergenic
979115242 4:116815161-116815183 GATTCAAGCACAAAAATGGGCGG + Intergenic
979935482 4:126689369-126689391 GATGCAATTAGGATAGTGTGTGG - Intergenic
982815429 4:159878030-159878052 GTTTCAAGCAGAAAACTGGGCGG - Intergenic
983179412 4:164630486-164630508 GATTCAAGCACAAAACTGGGAGG + Intergenic
986094478 5:4541092-4541114 AATTGAATGTGGAAAGTGGGTGG - Intergenic
986594108 5:9402804-9402826 GATTCAACCAGGATACTGGCTGG - Intronic
989173872 5:38501058-38501080 GCTGCAGTCAGGAATGTGGGTGG - Intronic
991430342 5:66538193-66538215 GAATTAATCAGGAAAGTATGAGG + Intergenic
992280667 5:75173413-75173435 GATTCAATTAGGAAAAGAGGAGG + Intronic
994977653 5:106830498-106830520 GATTAAATCTGGAAGGTGGAAGG + Intergenic
996193371 5:120572643-120572665 CATTTAATGAGGAAAGTAGGTGG + Intronic
996221043 5:120933582-120933604 GATTCCCTCAGGAAATAGGGAGG - Intergenic
996670201 5:126108722-126108744 GATTCAATCTGTGAGGTGGGGGG + Intergenic
997663463 5:135607554-135607576 GCTTCAATCAGAAAAGTGTAGGG + Intergenic
999847745 5:155504139-155504161 AATTCAATCAGTAAAATGAGAGG + Intergenic
1000208981 5:159093524-159093546 AATTCTATCAGGAAAGAGGGAGG - Intronic
1000652176 5:163831195-163831217 AAGTGATTCAGGAAAGTGGGAGG + Intergenic
1001267330 5:170283432-170283454 GATTTAATCAGAACAGTGGAAGG - Intronic
1001901951 5:175438706-175438728 GTTTCATTCAGGAAAGTGACTGG - Intergenic
1003078527 6:3002710-3002732 GATGCAGTCAGGGAGGTGGGAGG - Intronic
1003370488 6:5521005-5521027 GATTTTATCAGGAAAGAGGCAGG - Intronic
1007744730 6:44036558-44036580 AAAACAATCAGGAAAGTGGAAGG + Intergenic
1008701897 6:54110513-54110535 GATTCTATTAGCACAGTGGGAGG - Intronic
1010377775 6:75192995-75193017 AATTCAATCAGGAAACCTGGTGG + Intronic
1010439891 6:75881429-75881451 TATTCAATAACAAAAGTGGGGGG - Intronic
1012499711 6:99875134-99875156 GCTGCAATGAGGGAAGTGGGAGG + Intergenic
1013877316 6:114848545-114848567 GATTCAGTCATCAAAGTGGTGGG - Intergenic
1014274417 6:119370687-119370709 TGTTCAATCAGGATATTGGGGGG - Intergenic
1014665551 6:124232628-124232650 GATTCAATCAGGAAAGTGGGGGG - Intronic
1015366923 6:132406302-132406324 GATACAAGCAGGAAGGTTGGTGG + Intergenic
1016117180 6:140301699-140301721 GATTCAATCTGTGAGGTGGGGGG + Intergenic
1016367037 6:143330544-143330566 GATTAAATCAGAAAAGTGCGGGG + Intronic
1016501613 6:144726700-144726722 CATTCAATAAGGTAGGTGGGTGG + Intronic
1016638744 6:146324514-146324536 GATTCAAGCACAAAACTGGGTGG - Intronic
1017103649 6:150868199-150868221 AATTCCTTCAGGAAAATGGGAGG + Intronic
1022646225 7:32230680-32230702 GACTCAAGCAGGAAAAGGGGTGG - Intronic
1024361504 7:48473567-48473589 GAATGAATCAGGAGAGTGGGTGG + Intronic
1024681884 7:51698901-51698923 GATAAACTCACGAAAGTGGGTGG - Intergenic
1025235849 7:57234526-57234548 GATTCAATCAGGGGAGTGAGAGG + Intergenic
1026531979 7:71207518-71207540 GACTTAATCAGCAAAGTGGAGGG + Intronic
1028476365 7:91257967-91257989 GATTCAAGCACAAAACTGGGTGG - Intergenic
1029791873 7:102852027-102852049 GATCTAATCATGAAAGTTGGGGG - Intronic
1030975901 7:116122810-116122832 GCCACAATGAGGAAAGTGGGGGG - Intronic
1031534219 7:122913857-122913879 GAATCGGTCAGGAAAGGGGGCGG + Intergenic
1032459550 7:132100418-132100440 GATGCAATCAGGAAAATAGGTGG - Intergenic
1034697660 7:153068400-153068422 GAACCAATCAGGAAACTGGTCGG - Intergenic
1036055671 8:5251229-5251251 GATTCAATCATTAAAGTGCATGG + Intergenic
1038017029 8:23524014-23524036 GAGTCAAGCAGCAGAGTGGGAGG + Intergenic
1038641271 8:29331008-29331030 TATACAATTTGGAAAGTGGGAGG - Intergenic
1040597422 8:48852953-48852975 GATTCCTGCTGGAAAGTGGGTGG + Intergenic
1044013982 8:87028264-87028286 GAGGCAATCAGGAATGTGGTTGG + Intronic
1044792506 8:95862648-95862670 GATACACTCAGGAAATTGTGGGG - Intergenic
1044940296 8:97335229-97335251 GTTTCAAGCATGAAACTGGGTGG - Intergenic
1048829594 8:138463396-138463418 AATTGTATCAGGAAAGGGGGTGG + Intronic
1050593331 9:7182156-7182178 CATTCAATCAGGCAAGTGTCTGG - Intergenic
1052506319 9:29358991-29359013 GTTTCAATCACAAAACTGGGTGG + Intergenic
1052994330 9:34542380-34542402 GATTCCAACAGGAGAGAGGGAGG - Intergenic
1054728490 9:68676751-68676773 GATTCAGTCAGGTAACTGGTGGG - Intergenic
1059221396 9:112623777-112623799 AATTCAGGCAGGGAAGTGGGAGG + Intronic
1059864309 9:118497442-118497464 TATTCAATTAGGAAAAGGGGAGG - Intergenic
1061618918 9:131798280-131798302 GAATTAATCAGGAAACTCGGTGG - Intergenic
1203357954 Un_KI270442v1:179696-179718 TATTCAATTAGGAAAATAGGAGG + Intergenic
1186812896 X:13207636-13207658 CACTGAATCTGGAAAGTGGGGGG - Intergenic
1189298767 X:39937371-39937393 GCTTCAATCAGGAAGGTGCAGGG - Intergenic
1189415598 X:40809947-40809969 GATTCAATCTGTGAGGTGGGGGG + Intergenic
1190476884 X:50836965-50836987 GTTTCAATCAGTAAAGTGCAGGG - Intergenic
1190596261 X:52054559-52054581 GATGCAGCCAGGAAAGAGGGAGG - Intergenic
1190612563 X:52199514-52199536 GATGCAGCCAGGAAAGAGGGAGG + Intergenic
1191005033 X:55702472-55702494 GTTTCAAGCACAAAAGTGGGTGG + Intergenic
1191788810 X:64946204-64946226 GATTCAAGCACAAAACTGGGTGG - Intronic
1191809964 X:65175939-65175961 GTTTCAAGCACAAAAGTGGGTGG + Intergenic
1192198817 X:69050518-69050540 GATTAAATCAGGAAAGTGACAGG - Intergenic
1193334610 X:80273777-80273799 GATTCAAGCACAAAACTGGGTGG + Intergenic
1194419886 X:93660761-93660783 GTTTCAAGCACAAAAGTGGGCGG + Intergenic
1195833765 X:109089350-109089372 GATTCAAGCACAAAACTGGGCGG - Intergenic
1197299446 X:124760149-124760171 GATTCAATCTGTGAAGTGGAGGG + Intronic
1200966372 Y:9042958-9042980 AATTAAATCAGGAAAGTGACAGG - Intergenic
1201945589 Y:19506453-19506475 GATAGAATCAGAAAAGTGGAGGG - Intergenic
1202147065 Y:21809218-21809240 AATTAAATCAGGAAAGTGACAGG + Intergenic