ID: 1014667008

View in Genome Browser
Species Human (GRCh38)
Location 6:124250747-124250769
Sequence GGTAATGTTAGTAAAGATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 215}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014667008 Original CRISPR GGTAATGTTAGTAAAGATAT AGG Intronic
901406801 1:9054166-9054188 GGCAATATTTGTAGAGATATTGG + Intronic
902741595 1:18442336-18442358 GGTGATGATAGTAAAGAAAAAGG - Intergenic
905153053 1:35948101-35948123 GTTAATCTAAGTAAAGATCTGGG + Intronic
905494044 1:38370511-38370533 GTTAATGTCATCAAAGATATAGG - Intergenic
906896276 1:49776327-49776349 GCTACTGCTAGAAAAGATATTGG - Intronic
909515195 1:76499203-76499225 TGTAATGTTGGTAAGAATATGGG + Intronic
911443963 1:97967674-97967696 GGAAATGTAATTAAAGATAAAGG - Intergenic
911493872 1:98605877-98605899 GTTAATATTAGAAGAGATATTGG - Intergenic
913040958 1:115022728-115022750 GGTAAAGTCAGTAAAGGAATAGG - Intergenic
915306252 1:154981102-154981124 TGTATTGCTAATAAAGATATTGG + Intergenic
915689221 1:157671475-157671497 GTCAATGTTAGTAGAAATATTGG - Intergenic
915785780 1:158609960-158609982 AGTACAGTTAGAAAAGATATAGG - Intergenic
916328417 1:163589439-163589461 AGTCATTTTAGTAAAGAGATAGG - Intergenic
916848141 1:168674318-168674340 GGTAATGTTTTTAAAAAGATGGG + Intergenic
918956964 1:191220290-191220312 GATAATGTTAGTAAATATCTTGG + Intergenic
921605135 1:217142988-217143010 AGATATGCTAGTAAAGATATGGG + Intergenic
924298567 1:242613706-242613728 GGTTAAGTTAGTAGACATATGGG + Intergenic
924310974 1:242742880-242742902 GGTACTGATAGTTTAGATATTGG + Intergenic
1063263452 10:4417127-4417149 GGTAATGCTAGAAAATAAATTGG - Intergenic
1064631852 10:17323113-17323135 GGAGATGTTAGTAAAGATGTTGG - Exonic
1065468927 10:26056121-26056143 GGCAATGTAAGTAGAGAGATGGG + Intronic
1067130321 10:43558412-43558434 GTTATTGTTAGCAAGGATATAGG - Intronic
1068372418 10:56134343-56134365 GGTATTGTTATTAAAAATAGAGG + Intergenic
1069402728 10:68066058-68066080 GATAATGTTAGTAGAAAAATGGG - Intronic
1070420015 10:76227247-76227269 AGTAATATCAGTAAATATATCGG + Intronic
1070644294 10:78190822-78190844 GGTAATGTTCTTAAAGATGCTGG - Intergenic
1071027436 10:81132208-81132230 GCTAATTTTATTAAAGAAATGGG - Intergenic
1071056322 10:81513224-81513246 GGTAATGTTTTAAAATATATTGG - Intergenic
1073752502 10:106544612-106544634 GGTAAGGCTAGTTATGATATGGG - Intergenic
1074032880 10:109706035-109706057 GATTTTGTTAATAAAGATATAGG - Intergenic
1074650910 10:115523351-115523373 GGTACTATTAGTAAAGACAATGG - Intronic
1077101130 11:822996-823018 TGTATTTTTAGTAAAGAAATAGG + Intronic
1078314317 11:10279821-10279843 GGTATTGTTAGTAGAGACAGGGG + Intronic
1078838370 11:15053954-15053976 GTCAATTTTATTAAAGATATGGG + Intronic
1080047525 11:27824917-27824939 GGTGATGTTAGTAAACATGTGGG - Intergenic
1080768533 11:35318999-35319021 GAGAATGTTAGTCAAAATATAGG + Intronic
1081028102 11:38041002-38041024 AGAAATGTTAATAGAGATATGGG + Intergenic
1082040907 11:47684062-47684084 GGTATTTTTAGTAGAGATGTAGG - Intronic
1086288997 11:85283726-85283748 AATAATGCTACTAAAGATATAGG + Intronic
1088385071 11:109245134-109245156 GGCAATATTATTCAAGATATAGG + Intergenic
1089907798 11:122062287-122062309 ATGAATGTTAGTAAACATATTGG + Intergenic
1090839716 11:130477303-130477325 GGAAATGTTAGCAAATATACAGG + Intergenic
1091193034 11:133710108-133710130 GGTAGTGTTGGTGAAGATGTGGG - Intergenic
1092465488 12:8728109-8728131 GATAATGTAAGGAGAGATATGGG - Intronic
1093864198 12:24205137-24205159 TGTAATGTGAGTATAGATCTTGG - Intergenic
1094165451 12:27438314-27438336 ATTAATGGTAGTAAAGCTATAGG - Intergenic
1094765746 12:33592656-33592678 GGTAATATTAATATATATATAGG - Intergenic
1095464015 12:42471751-42471773 GTTAATCATTGTAAAGATATTGG + Intronic
1097553020 12:61099168-61099190 GGTATTCTTAGTAAAGCTAGGGG + Intergenic
1097859453 12:64504290-64504312 TGTAAGGTTAGGAAAGAAATGGG + Intergenic
1101461613 12:104902387-104902409 GGTAATGTTAATAAACTGATAGG + Intronic
1105532687 13:21234378-21234400 GATAATGTTAGTAAATAAAAAGG - Intergenic
1107642322 13:42456256-42456278 GTGGATATTAGTAAAGATATGGG - Intergenic
1107647801 13:42513293-42513315 GTGGATATTAGTAAAGATATGGG + Intergenic
1111213545 13:85112292-85112314 GGTGTTGTGAGTTAAGATATAGG - Intergenic
1111652262 13:91106663-91106685 GGTATTGTTAGTACATATACAGG - Intergenic
1111815731 13:93150242-93150264 AGTACTGTAAGTAAACATATAGG + Intergenic
1115454525 14:33586643-33586665 GGGAATGTTAGAAAATGTATTGG - Intronic
1115796045 14:36936687-36936709 GGTAATATAAGTAAACGTATTGG + Intronic
1116730890 14:48621341-48621363 GGTAATATTTGTTAAGACATAGG - Intergenic
1118013866 14:61638711-61638733 GGTACTGTTTATAAAGATGTGGG + Intronic
1120026854 14:79596279-79596301 GGTCATGTTAGTATATATCTGGG - Intronic
1121227534 14:92332359-92332381 GGTATTGGTAGTGAAGTTATTGG + Intronic
1121292681 14:92790110-92790132 GGGAATATCAGTAAAGAGATAGG - Intergenic
1128361670 15:66965890-66965912 GGTAAAGTTCTTAAAGATATCGG - Intergenic
1128906879 15:71475132-71475154 GGGATTATTAGTAAAGTTATAGG - Intronic
1129131296 15:73499496-73499518 GGTAACGGTAATAAAGATGTAGG - Intronic
1130787889 15:87120396-87120418 GGGAAAATTAGTAAAGATATGGG + Intergenic
1133158287 16:3891172-3891194 GCTAATGTTGGCAAAGATGTGGG - Intergenic
1133463126 16:6004394-6004416 GTTAATATTTGTAAAGATTTAGG + Intergenic
1135055164 16:19226079-19226101 GTGAATGTTAGCAATGATATAGG - Intronic
1135951744 16:26920646-26920668 GGAAACTTTAGTACAGATATAGG - Intergenic
1138002636 16:53298136-53298158 AGAAATGTGAGTAAGGATATTGG + Intronic
1138957686 16:61991100-61991122 AGTATTGTTAGTGAAGATATTGG - Intronic
1140961214 16:79914932-79914954 GGAAATGTTAGCAAAGACAGAGG + Intergenic
1141265758 16:82495486-82495508 GGTAATGTTATTAAGGACAGTGG + Intergenic
1141789513 16:86225050-86225072 GGTAATGGTGGTAAGGATAAAGG + Intergenic
1143932443 17:10443746-10443768 GCTAATTTTAGTAAAGATGGGGG - Intronic
1145026007 17:19468295-19468317 GGTATTTTTAGTAGAGATTTTGG + Intergenic
1147694826 17:42343751-42343773 TGTAATGAAAGTAAAGATCTGGG - Intronic
1149189360 17:54040433-54040455 GGTAATGATAGGAAAGAAACAGG - Intergenic
1149196150 17:54123721-54123743 GATAACCTTAGTAAATATATAGG + Intergenic
1149903662 17:60505621-60505643 GGTAACATTAATAAAGATTTTGG - Intronic
1152131326 17:78478428-78478450 GGTAATGTTGGTAATGATGGTGG - Intronic
1153123410 18:1760225-1760247 AGTAATATGAGTAGAGATATTGG + Intergenic
1156800192 18:41101649-41101671 GTTAATGTTGGTAAAGAGCTTGG - Intergenic
1160825632 19:1079328-1079350 TGTAATTTTAGTAGAGATACAGG - Intronic
1163498090 19:17658404-17658426 GGTCATGTTAATAGAGATATAGG + Intronic
1166578622 19:43870059-43870081 GGCAATCTTAGTAAAGAAATAGG + Intergenic
1167809265 19:51814414-51814436 GTTAATCTTGGTAATGATATTGG + Intronic
1168381223 19:55925369-55925391 AGGTATGTTATTAAAGATATAGG - Intronic
1168658740 19:58149755-58149777 GGTAATTTTAATAAAGGTTTAGG + Intronic
925546581 2:5023396-5023418 GGTAATGGTAGTAGTGATAGTGG - Intergenic
925620608 2:5788791-5788813 AATAATGTTAGTAAAGATAAAGG + Intergenic
926154672 2:10447268-10447290 GATAATGTTAGAAGAGATAGGGG + Intronic
926208127 2:10848366-10848388 TGTAATGTTAATGAAGGTATTGG + Intronic
927049892 2:19316996-19317018 TGTAATTTTAGTAAAGATTGGGG + Intergenic
931388863 2:61822308-61822330 TGTATTGTTAGAAAAGTTATAGG - Intergenic
931441849 2:62295571-62295593 TGTATTGTTAGTAGAGATGTGGG - Intergenic
932062573 2:68522316-68522338 GTTAATGTAAGTAATGATATTGG + Intronic
932962953 2:76436732-76436754 ACTAATGTTAACAAAGATATGGG - Intergenic
934017385 2:87902457-87902479 AGTTATATTAATAAAGATATTGG + Intergenic
935470864 2:103458852-103458874 GTAAATCTAAGTAAAGATATAGG + Intergenic
935512762 2:103996185-103996207 GGTAATTTTAAAAACGATATAGG - Intergenic
939217384 2:139256478-139256500 GGAAATGTAAGTAAATATAGAGG + Intergenic
939921933 2:148126443-148126465 GGAAAAGTTACTAAAGATTTTGG + Intronic
940207396 2:151218377-151218399 GGTATTATTAGTATAGAGATAGG - Intergenic
943197458 2:184772760-184772782 GGAAAGGTTGGTAAGGATATGGG - Intronic
943331541 2:186565623-186565645 ATTAATGTTCATAAAGATATTGG - Intergenic
943488477 2:188519107-188519129 TGTAATGTTAGAAAACCTATAGG - Intronic
944493461 2:200282533-200282555 GGTTATGTTATTAATAATATTGG - Intergenic
944524876 2:200608801-200608823 GGTAATGGTAGTAATGAAAGTGG - Intronic
946785604 2:223240336-223240358 AGTACTGTTAATAAAAATATAGG - Intergenic
947944130 2:234085193-234085215 GATAATGTAAGCAAAGAGATAGG + Intergenic
1169691872 20:8341136-8341158 GGTAATGTGAGTGAAGGCATGGG - Intronic
1170398261 20:15951943-15951965 GGTAATGTAAGATGAGATATGGG - Intronic
1170461225 20:16578339-16578361 AGTAATTTTAGTAAAGCTTTAGG + Intergenic
1170903265 20:20486937-20486959 GCTAATGTAAGTAGAGAGATAGG - Intronic
1172975751 20:38904477-38904499 GGCATTGTTAGTAAAAATAATGG - Intronic
1173767619 20:45628011-45628033 AGTAAATTTAGTAAAGAGATGGG - Intronic
1177294614 21:19158658-19158680 TGTATTGTTAGTAGAGACATGGG - Intergenic
1178712211 21:34927702-34927724 GGTACTGTTAGTATAGACAGAGG + Intronic
1179227759 21:39470433-39470455 GGTATTTTTAGTAGAGATAGGGG + Intronic
1181835516 22:25604482-25604504 GGTAATTTTAGTGATGAAATTGG + Intronic
1183413593 22:37670110-37670132 TGTATTTTTAGTAAAGATAGGGG + Intergenic
1184970235 22:48014521-48014543 GGTAATGTAAGCAGAGAGATGGG - Intergenic
1203289520 22_KI270735v1_random:20701-20723 GGTCATGTGAGCAAATATATGGG - Intergenic
949764768 3:7514402-7514424 GGTAAGCTTACTGAAGATATAGG - Intronic
952101976 3:30024533-30024555 TGTAATGTTGCTAAAGAAATGGG - Intergenic
952620250 3:35329440-35329462 GGTCATGTTAGTAAGGAAAGTGG + Intergenic
953111179 3:39940332-39940354 TGTAAGGTGAGTAAAGATACTGG + Intronic
954546561 3:51440948-51440970 GGTAAAGTTCTTAAAAATATTGG - Exonic
956951906 3:74292820-74292842 GGCAATGGAGGTAAAGATATAGG - Intronic
958106962 3:89087465-89087487 GGTAATGTTAGTTGAGAGAAGGG + Intergenic
958804228 3:98790363-98790385 GCAAATGTGAGTAAAGATACAGG + Intronic
963573746 3:147032508-147032530 AGTAATGTTAGTAAATATGAGGG + Intergenic
964410935 3:156397303-156397325 GGTAATATATGTAAAGAAATTGG + Intronic
964553248 3:157908615-157908637 GGTAATGGTAGGAATGATACAGG + Intergenic
967258261 3:187615534-187615556 GGTAATCTGAGTAAATAAATTGG - Intergenic
970053140 4:11939056-11939078 GGTAATATTAATAGAGATTTTGG + Intergenic
977380555 4:96267968-96267990 GGAAAAGTCAGTAAAGAAATGGG - Intergenic
977907515 4:102495320-102495342 GGAAATGTTACAAAAGATAATGG + Intergenic
978644634 4:110915439-110915461 GGTGATGTGGATAAAGATATGGG + Intergenic
979960269 4:127011242-127011264 GTCAATTTTAGTAAAAATATGGG + Intergenic
980494675 4:133575514-133575536 GGAAAGGGTAGTAAAGACATAGG + Intergenic
980544606 4:134243177-134243199 AGTAATGTTATTAAAGGTGTAGG - Intergenic
981369242 4:143939949-143939971 TGTAATTTTAGTAGAGATAGGGG + Intergenic
981378984 4:144049890-144049912 TGTAATTTTAGTAGAGATAGGGG + Intergenic
981528176 4:145728290-145728312 GCTAATGTTAGAGAGGATATAGG - Intronic
981777217 4:148383562-148383584 GGTAATGTTAGTTTACATTTTGG - Intronic
982584170 4:157216450-157216472 GGTAATGAGAGTAAGGATTTAGG - Intronic
982895081 4:160910550-160910572 GGTAATTTTTCTAAAGGTATAGG + Intergenic
982964329 4:161884222-161884244 TGTATTTTTAGTAGAGATATTGG + Intronic
983320935 4:166195621-166195643 GGTAATTTTTGTAGAGATAGGGG + Intergenic
983950654 4:173636666-173636688 GGTAATATTTGAAAAGATAATGG - Intergenic
984569709 4:181377075-181377097 GAGAATCCTAGTAAAGATATTGG - Intergenic
986894175 5:12345796-12345818 GTTAATGTTATTAAAAAGATTGG - Intergenic
986951355 5:13088898-13088920 GATAATGTAAGTCAATATATGGG + Intergenic
987387097 5:17340236-17340258 TGTAATTTTAGGAAAGACATAGG + Intergenic
987556385 5:19456530-19456552 GCTAATGCTACTACAGATATAGG + Intergenic
987871255 5:23620486-23620508 GGTAATCGAAGTACAGATATTGG + Intergenic
989007113 5:36827182-36827204 GGTAATGTTAATAAACACATGGG - Intergenic
989303380 5:39921381-39921403 GTTAATGTTAGAAAATTTATAGG - Intergenic
990969716 5:61491101-61491123 GGTGATCTTAGACAAGATATGGG + Intronic
992990970 5:82283051-82283073 TGTATTTTTAGTAAAGAGATGGG - Intronic
993069648 5:83144397-83144419 GGTGAAGTTTGTAAGGATATTGG - Intronic
993943491 5:94090860-94090882 GATAATTTTAGTGATGATATGGG - Intronic
994717292 5:103336913-103336935 GGAAATGTTAGAAATAATATGGG - Intergenic
994787214 5:104180305-104180327 TGCAATGTTTGCAAAGATATGGG - Intergenic
996497203 5:124172940-124172962 GATAATGTTTGTAAAGAGTTTGG - Intergenic
998531871 5:142892526-142892548 GGTAATGTATGTACAGCTATGGG + Intronic
998960171 5:147477881-147477903 TGCAATTTTAGTAAAGATTTAGG - Intronic
999039700 5:148393827-148393849 AATAATGTTGGTACAGATATAGG - Intronic
999541250 5:152574448-152574470 GGTAAGGCTAGAAAAGACATGGG - Intergenic
999545105 5:152620061-152620083 GCTATTGTTAGTAAAGCTTTTGG - Intergenic
999992236 5:157060247-157060269 AGTAATTTGAGTAAAGATTTAGG - Intergenic
1000158353 5:158574491-158574513 GGTCATTTTAGTAAAGACTTGGG + Intergenic
1003389574 6:5701754-5701776 GATAATGTTAGTAAATAAAAAGG + Intronic
1003731277 6:8827669-8827691 GGTAATGGTAGTAATGGTAGTGG + Intergenic
1005509591 6:26500572-26500594 GGCAATGATAATAAAGATAAGGG - Intergenic
1006042516 6:31268100-31268122 GGCTATGTTAATAAAGATACTGG - Intergenic
1010816914 6:80368837-80368859 TGTAATTTTAGTAAAGACAAAGG - Intergenic
1013826789 6:114221275-114221297 GGTAATTTTATTAAAAATGTAGG - Intronic
1014667008 6:124250747-124250769 GGTAATGTTAGTAAAGATATAGG + Intronic
1015061562 6:128972910-128972932 GGTTATTTTAGTTATGATATTGG + Intronic
1015159811 6:130140410-130140432 GGTAATTATAGTAAAGATGCTGG - Exonic
1017952023 6:159143152-159143174 GATAATGTTGGCAATGATATTGG + Intergenic
1018965248 6:168480400-168480422 GAAAATGTTAATAAAGATATAGG + Intronic
1023034588 7:36119272-36119294 GCTAGTGTTAGCAAAGCTATGGG + Intergenic
1024130954 7:46353000-46353022 GGTACTGTGGGTAAAGAAATAGG + Intergenic
1024513924 7:50227292-50227314 AGTAATGTTAGATAACATATAGG + Intergenic
1027392730 7:77721627-77721649 GGATATATTAGTAAAAATATTGG + Intronic
1032271781 7:130415255-130415277 GGTAATCTGAGTAAAGTGATGGG + Intronic
1032288307 7:130561435-130561457 GGTAATGTTAGAAAGGTTAGAGG - Intronic
1033122824 7:138680968-138680990 GATATTGTTAGTAATAATATTGG + Intronic
1034347259 7:150394786-150394808 GGTAATGTTATAAATTATATTGG + Intronic
1034376036 7:150645143-150645165 GGTAATGTCAGCAGAGAGATGGG - Intergenic
1039727719 8:40237784-40237806 GGCAATGTTAGTGAAAAAATAGG + Intergenic
1039784224 8:40818492-40818514 GATGATGTTAGTACAGTTATTGG - Intronic
1041357830 8:57020465-57020487 GGTCATTATAGTAAATATATAGG + Intergenic
1041607051 8:59793594-59793616 GGTGGTGTTAGGTAAGATATTGG - Intergenic
1041696073 8:60737803-60737825 GCTTATGTTATTAAAAATATAGG - Intronic
1043291460 8:78606675-78606697 GGTAAAGTCAGTAAAGAAAAAGG - Intergenic
1043451350 8:80370594-80370616 GGGAAAATTAGTAAAGATATAGG + Intergenic
1043642289 8:82470188-82470210 GGTAATGTTAAAAAAGTTACTGG + Intergenic
1045894659 8:107200246-107200268 GATATTGTAAGTAAAGATTTGGG + Intergenic
1046373438 8:113343284-113343306 GGAAATGTTGGTACAGAAATGGG + Intronic
1046607128 8:116383644-116383666 GGTAATTTCAGTAAAGCTCTGGG - Intergenic
1050008728 9:1163114-1163136 TGTAATGTTTGTAAAGTTCTTGG + Intergenic
1052463469 9:28798157-28798179 GTTAAGGTAAGAAAAGATATAGG + Intergenic
1052485288 9:29090158-29090180 GGTTATATTAGCAAAGATATGGG - Intergenic
1052741220 9:32394784-32394806 GGTAAAATCAGTAAATATATGGG + Intronic
1055251493 9:74312860-74312882 GATAATTTTAGTAATGGTATAGG - Intergenic
1057013457 9:91629553-91629575 GAAAATATCAGTAAAGATATAGG - Intronic
1057972553 9:99571680-99571702 GGTAATTTTTTTAAAGAGATGGG - Intergenic
1058719139 9:107747919-107747941 GCTAAGGTTAGTAAACATAGTGG + Intergenic
1060186198 9:121565611-121565633 TGTATTTTTAGTAGAGATATGGG + Intergenic
1060488877 9:124067251-124067273 GGTAAAGTTACTAAAGCCATTGG + Intergenic
1185804237 X:3042668-3042690 TGTAATTTTAGTAGAGATAGGGG + Intronic
1187147190 X:16647739-16647761 TGTCATCTTAGTAACGATATAGG - Intronic
1188207961 X:27382127-27382149 GGTAATGTAAGAAAACAGATGGG + Intergenic
1190791260 X:53702766-53702788 GGCTATGTTAGTTAGGATATAGG - Intergenic
1192829862 X:74740585-74740607 GGCAATGTTGGACAAGATATAGG + Exonic
1193380936 X:80815182-80815204 TGTAATGTTAGTATTGATGTAGG - Intergenic
1193744700 X:85262026-85262048 GATAAAATTATTAAAGATATTGG - Intronic
1194382764 X:93216000-93216022 GGTAATGTTGGTAAAACTTTCGG - Intergenic
1196220320 X:113106371-113106393 AGTAAAGTTAGTTAAGCTATTGG - Intergenic
1197687863 X:129461577-129461599 GCTAATGTTGGTAAAGGGATTGG + Intronic
1199127098 X:144136088-144136110 AGTTATATTAATAAAGATATTGG - Intergenic
1199511107 X:148623672-148623694 AGTTATGTTAATAAATATATAGG + Intronic