ID: 1014667414

View in Genome Browser
Species Human (GRCh38)
Location 6:124256524-124256546
Sequence CAGAACTATCAGATTTAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 170}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014667414 Original CRISPR CAGAACTATCAGATTTAGGA TGG (reversed) Intronic
903126505 1:21251804-21251826 CAGATCTATCAGCTCTGGGAGGG - Intronic
906594304 1:47061039-47061061 CAGAACTAACAGTGTTAAGAGGG + Intergenic
907408292 1:54267509-54267531 CAGAACAGTCACATTTAGGCAGG + Intronic
908811173 1:67983718-67983740 CAAAACTATCATATTAGGGAAGG - Intergenic
910086105 1:83404463-83404485 CACAAATCTCAGATTTAGAAAGG - Intergenic
910145295 1:84072910-84072932 CAGAACTAGAAAATTTAGGTTGG - Intergenic
910376907 1:86582472-86582494 AAAAACTACCACATTTAGGAAGG + Intergenic
910542103 1:88371327-88371349 CATAACTATAACATTTAGGTAGG - Intergenic
916159162 1:161891163-161891185 CAGAACTGGCAGATTTTGGTTGG - Intronic
917087038 1:171314053-171314075 CAGAACTATGACGTTGAGGAGGG + Intergenic
919205715 1:194420201-194420223 CAGAACTACCAGCTGTGGGAAGG - Intergenic
919313291 1:195939479-195939501 GAAAACTATCATGTTTAGGAAGG - Intergenic
919649838 1:200136730-200136752 TAGAAGGATCAGATTTAGAATGG - Intronic
919818756 1:201459512-201459534 CAGAACTATAGGAGGTAGGATGG - Intergenic
922005732 1:221528964-221528986 CAGAACTGTCAGGATTAGAATGG + Intergenic
922350648 1:224732333-224732355 AAGAAATCTCAGATTTAGGGAGG + Intronic
922676108 1:227551401-227551423 CATAATTATCAGATTCAGCAAGG + Intergenic
924703186 1:246474925-246474947 CTGTGCTATCAGATTAAGGAGGG + Intronic
1064954040 10:20887052-20887074 CAGAACAATCAAATTTGGGGAGG - Intronic
1066159850 10:32716093-32716115 CATAATTATCAGATTTACCAAGG + Intronic
1066567064 10:36731955-36731977 CTGAATTATCATATTTAGGTGGG + Intergenic
1068610876 10:59058562-59058584 CTGAAGAATCAGTTTTAGGACGG + Intergenic
1069081029 10:64088336-64088358 AAGGACTCTCAGATTTAGAATGG - Intergenic
1069721646 10:70553670-70553692 CACAGCTGGCAGATTTAGGAGGG + Intronic
1072575188 10:96693083-96693105 GAGAACTATCAGAGTTTTGAAGG - Intronic
1073371991 10:102998680-102998702 CAAAACTATTAGGTTTAGGCCGG + Intronic
1073997967 10:109338046-109338068 CATAATTGTCAGATTTAGCAAGG - Intergenic
1075056422 10:119222292-119222314 CACATCTACCAGCTTTAGGATGG - Intronic
1075260732 10:120961993-120962015 CAGGACTAACAGATTCAGGCAGG + Intergenic
1080208313 11:29756276-29756298 CAGGACTATCAGCTGCAGGAAGG - Intergenic
1086646222 11:89224094-89224116 CAGAACAATGAAGTTTAGGAAGG + Intronic
1088071302 11:105788870-105788892 CAGAACTATAAGATTTTTCAAGG - Intronic
1089827928 11:121295750-121295772 CAGAGCTAGCAGATTTGGGTAGG - Intronic
1091501578 12:1022912-1022934 CAAAACCATCAGATCTAGGCTGG - Intronic
1096930269 12:55200264-55200286 CAGAACTACTAGGTTTAGGGTGG - Intergenic
1097393279 12:59041717-59041739 CAGAACCATGAGCTTTAGAAAGG - Intergenic
1097874481 12:64630859-64630881 AAGAAAGATCAGGTTTAGGAGGG + Intronic
1104497027 12:129250489-129250511 CAGGAGGATCAGAGTTAGGAAGG - Intronic
1105074220 12:133261329-133261351 CTGACCTATCAGATTATGGAGGG + Intergenic
1105679353 13:22709781-22709803 AAGAACTTTCAGATTTAAAATGG + Intergenic
1106236900 13:27870127-27870149 CAGCACTATAAAATTTAGAAAGG + Intergenic
1106959992 13:34987445-34987467 CATAATTGTCAGATTTAGCAAGG - Intronic
1109226169 13:59698787-59698809 CAGACCTAAAAGAATTAGGATGG + Intronic
1109505890 13:63302721-63302743 CAGAATTATCACATTTTGTAAGG + Intergenic
1109724585 13:66323012-66323034 CAGAACTATTAAAATAAGGAAGG + Intronic
1111399674 13:87718256-87718278 TGGAACTTTGAGATTTAGGATGG + Intergenic
1113416749 13:110134409-110134431 CAGAACTATCCCATTTGGAAAGG + Intergenic
1114005092 14:18303599-18303621 CTGAATTATCATATTTAGGTGGG + Intergenic
1115477231 14:33827158-33827180 CATAACTGTCAGATTTACCAAGG + Intergenic
1117914511 14:60663081-60663103 AAGAACTACCAGATCTAGGTGGG - Intergenic
1123389550 15:19855835-19855857 CTGAATTATCATATTTAGGTGGG + Intergenic
1131693130 15:94847405-94847427 CAGGATAATCAGATGTAGGAGGG - Intergenic
1133050752 16:3115959-3115981 CAGAACCAGCAGATGCAGGAAGG - Intronic
1133326090 16:4943262-4943284 TAGAATTAGCAGATTTAGGGAGG + Intronic
1134872407 16:17663832-17663854 CAGAGCTAGCAGATTGAGGTGGG + Intergenic
1138222395 16:55263911-55263933 CAGAAGTATGAGACTAAGGAAGG - Intergenic
1138974012 16:62181588-62181610 TAGAACTAACATATTGAGGAAGG - Intergenic
1141063285 16:80894724-80894746 CAGAAGTTGCAGCTTTAGGAAGG + Intergenic
1141723227 16:85768459-85768481 CAGAACAATCAGATTCTGGGAGG + Intergenic
1144596254 17:16572585-16572607 TAGAACTCTGAGATTTGGGATGG + Intergenic
1147453385 17:40519821-40519843 CAGCACTCTCAGACTTTGGATGG + Intergenic
1149225362 17:54464344-54464366 CATAACTATCAGATTGACCAAGG - Intergenic
1149614122 17:57983871-57983893 CAGAAAACTCAGATTGAGGAAGG + Intronic
1153757890 18:8302063-8302085 CAGGACCATCAGCTTCAGGAGGG - Intronic
1153850703 18:9091596-9091618 CACAAATATCAGATTTCAGAGGG + Intergenic
1154532332 18:15360263-15360285 CTGAATTATCATATTTAGGTGGG - Intergenic
1155108574 18:22691017-22691039 CAGAACTCTCCTATTTAGGGTGG - Intergenic
1155192424 18:23441948-23441970 TAGAACTATTAGATTTTGGCTGG - Intergenic
1155236761 18:23827603-23827625 CTGAACTATCTGATTTAGGGTGG + Intronic
1159438491 18:68447796-68447818 AAGAGCTATCAGAATCAGGAAGG - Intergenic
1160296147 18:77638786-77638808 CATAATTATCAGATTCAGCAAGG + Intergenic
1160610665 18:80082527-80082549 GAGAACAAACAGATTTAGAAAGG - Intronic
1168511250 19:56975195-56975217 CAGCAGTTTCAAATTTAGGATGG + Intergenic
925871766 2:8277987-8278009 CAGCACTTTCAGATTTACAAGGG + Intergenic
927408893 2:22802931-22802953 CAGATCTTTCAGATTCAAGAAGG - Intergenic
930860742 2:56070527-56070549 CAGAGCTACTAGGTTTAGGATGG + Intergenic
932056866 2:68454471-68454493 ATGAACTACCAGATATAGGAAGG + Intergenic
932862672 2:75310989-75311011 AAGGACTATCAGATGTAAGAAGG + Intergenic
936034277 2:109098171-109098193 CAGAGCAGGCAGATTTAGGAAGG - Intergenic
937491849 2:122377743-122377765 CAAAAATATTAGTTTTAGGAAGG - Intergenic
938531430 2:132191491-132191513 CTGAATTATCATATTTAGGTGGG - Intronic
938879807 2:135573510-135573532 AAGAATTTTCAGACTTAGGATGG - Intronic
941801967 2:169669927-169669949 TAGAGTTATCAGATTTAGGATGG + Intronic
942645514 2:178106661-178106683 CAGAAAAATCAGATTGAGGCTGG + Intronic
943540532 2:189208395-189208417 CAGAACTCTCAGTTTAATGAAGG + Intergenic
947738572 2:232473938-232473960 CAGAGCTAGGAGGTTTAGGATGG + Intergenic
1172539162 20:35697994-35698016 CAGAACAATCCGAGTTGGGATGG - Intronic
1176716424 21:10354129-10354151 CAGAATTATCAGATTCACCAAGG - Intergenic
1176765028 21:13007938-13007960 CTGAATTATCATATTTAGGTGGG + Intergenic
1176898354 21:14410339-14410361 AAAAACTAACAGATTTTGGAAGG - Intergenic
1180429605 22:15234391-15234413 CTGAATTATCATATTTAGGTGGG + Intergenic
1180512216 22:16102732-16102754 CTGAATTATCATATTTAGGTGGG + Intergenic
950310145 3:11950025-11950047 AAGAACTGTCGGATTTGGGAGGG + Intergenic
954490438 3:50899924-50899946 CATAATTATCAGATTTACCAAGG - Intronic
954527433 3:51284414-51284436 TAGAACTAAGAGGTTTAGGATGG - Intronic
955384465 3:58468379-58468401 CAGAAATATGAGATTTAGCAGGG + Intergenic
957414803 3:79887708-79887730 GAGAACAAACAGATGTAGGAAGG - Intergenic
958112538 3:89167390-89167412 CATAACTACAAGATTTAGCATGG + Intronic
958604545 3:96340364-96340386 CAGAACTTTCAAATTTAGTCAGG + Intergenic
959086050 3:101851688-101851710 TAGAACTATGAGAGTCAGGATGG + Intronic
959874509 3:111366246-111366268 CAGCACTCTCAGATTTAAAATGG + Intronic
961083126 3:124043423-124043445 CAGAAGTAATAGATTGAGGAAGG + Intergenic
961842337 3:129725796-129725818 CAGAACTAAAAAATTTAGTACGG - Intronic
962385646 3:134930199-134930221 GAGAACTACCAGATATAGGAAGG + Intronic
962780184 3:138706992-138707014 CAAAACTAACAGAGTTAAGAAGG + Intronic
965205179 3:165713036-165713058 CAAGACTACCAGCTTTAGGAAGG - Intergenic
966665338 3:182465100-182465122 CAGAGCTACTAGGTTTAGGATGG + Intergenic
967450506 3:189617743-189617765 AAGAACTATCAGAGTCAGAAAGG - Intergenic
967773622 3:193361439-193361461 CAGAATTATCAGAATTATGAGGG + Intronic
970397476 4:15683384-15683406 ATGAACTGTCTGATTTAGGAGGG + Intronic
970472953 4:16394694-16394716 CAGAACAATCTAATTTATGAGGG - Intergenic
971239400 4:24874166-24874188 CAGAACAATCAGTGTTGGGAGGG + Intronic
971698052 4:29931520-29931542 CAGAATTATCAGATTCACCAAGG + Intergenic
971831242 4:31698631-31698653 AAGAAGTATCAGAATTATGAAGG - Intergenic
972788208 4:42346640-42346662 CAGGACTATCAGCTGCAGGAAGG + Intergenic
973715838 4:53675072-53675094 CAGCACTATCCCAGTTAGGATGG - Intronic
977876610 4:102157376-102157398 CAGCACTATCAGATATAGCCTGG - Intergenic
978480970 4:109190380-109190402 CAAAACATTCAGATTGAGGAAGG + Intronic
980512668 4:133813774-133813796 CATAACTATCAGATTTTCCAAGG + Intergenic
980735542 4:136882216-136882238 AAGAACTGTCAGCTTCAGGAGGG + Intergenic
980971233 4:139569033-139569055 CACAAATATCAGATATAGGGGGG - Intronic
983621510 4:169766158-169766180 CAGAAGAAACAGATTTGGGAAGG + Intergenic
983783019 4:171696913-171696935 CAGAGCTGACAGTTTTAGGAAGG - Intergenic
984782953 4:183542313-183542335 CAGAAATATGAGTTTTGGGACGG + Intergenic
985750346 5:1670011-1670033 CAGCACTCTCAGCTTGAGGAAGG + Intergenic
990626100 5:57613127-57613149 CAGAAATATCAGGTTCAGAATGG - Intergenic
992053954 5:72968562-72968584 AAGAACTAGCAGATTTTGTAAGG + Exonic
993345403 5:86776762-86776784 CATAACTGTCAGATTCAGCAAGG - Intergenic
995386639 5:111596181-111596203 CAGGACTATCAGCTGTGGGAAGG + Intergenic
998496337 5:142593478-142593500 CTGAACTGTCATATTTAGAATGG - Exonic
999123656 5:149229997-149230019 CAGAGCTATCACATTTAAGGGGG - Intronic
999733185 5:154491896-154491918 TAAATCTATCAGATATAGGAAGG - Intergenic
999960596 5:156752123-156752145 CAGAAACATCATATTGAGGAGGG + Intronic
1001318952 5:170664428-170664450 CTGCACTATAAGATCTAGGAGGG + Intronic
1001792225 5:174467603-174467625 CATAACTGTCAGATTTACAAAGG + Intergenic
1003372344 6:5540684-5540706 CAGAACTCTCAGGTTTAGATGGG + Intronic
1009652237 6:66490726-66490748 CATAACTATCAGATTCACCAAGG + Intergenic
1010407428 6:75521017-75521039 CAGAACTATAAGGTCAAGGAAGG - Intergenic
1012881979 6:104801407-104801429 CATAACTGTCAGATTTATCAAGG + Intronic
1014607892 6:123500532-123500554 CAGAACTATGAAAGTTAGAATGG - Intronic
1014667414 6:124256524-124256546 CAGAACTATCAGATTTAGGATGG - Intronic
1016412789 6:143801146-143801168 CATAACTGTCAGATTCACGAAGG - Intronic
1019068219 6:169320613-169320635 CAGAGCTATCAGACCTAGGGAGG - Intergenic
1020486172 7:8723679-8723701 CAGATATATAATATTTAGGAAGG + Intronic
1023601924 7:41888996-41889018 CTAAACTTTCAGGTTTAGGAAGG - Intergenic
1024941623 7:54768863-54768885 CAGCACTATCAGTCTTAGGTGGG - Intergenic
1027302986 7:76860931-76860953 CACAAATCTCAGATTTAGAAAGG - Intergenic
1027734903 7:81920337-81920359 CAGGACTACCAGCTTCAGGAAGG - Intergenic
1028015316 7:85703471-85703493 CACAACAATGAGATTTAAGAAGG - Intergenic
1028948869 7:96611341-96611363 CCCAGCTATCAAATTTAGGAAGG + Intronic
1030870598 7:114751091-114751113 CACAATTGTCAGATTAAGGATGG - Intergenic
1032640971 7:133767725-133767747 CAGAACTATCTGATTTTGCAGGG - Intronic
1033882933 7:145909345-145909367 CTGAATTATAAGATTTAGTATGG + Intergenic
1033908785 7:146239703-146239725 CACAAGTATCAGATTTACCAGGG - Intronic
1035496544 7:159332574-159332596 CTGACCTATCAGATTATGGAGGG + Intergenic
1037498776 8:19465594-19465616 CAGAAGGATCAGATTTAAAAGGG - Intronic
1038174513 8:25168105-25168127 CAAAACTATCAAAATTAGCAGGG - Intergenic
1040723653 8:50355423-50355445 CATAATTATCAAATTTAGGCAGG - Intronic
1041767159 8:61431094-61431116 CAGATCTATCAGAATTGAGATGG - Intronic
1042675786 8:71320052-71320074 AAGAACTAGCAGAGTGAGGATGG - Intronic
1047524912 8:125624670-125624692 CAGAACAGTCAGACTTATGAAGG + Intergenic
1047670081 8:127136574-127136596 AGGAACTGTCAGATTAAGGAGGG - Intergenic
1048081005 8:131127005-131127027 CACAAATAGCAGATGTAGGATGG + Intergenic
1051401110 9:16683755-16683777 CAGAAGAAGCACATTTAGGAAGG + Intronic
1054419943 9:64918782-64918804 CTGAATTATCATATTTAGGTGGG - Intergenic
1057105276 9:92408911-92408933 CATAAGTATGAGATTTAAGACGG - Intronic
1062069031 9:134545484-134545506 CACAAAGTTCAGATTTAGGAGGG - Intergenic
1062456708 9:136643247-136643269 CAGAATTATCAGATTGAAGGTGG - Intergenic
1188296545 X:28456879-28456901 CATAACCATCAGATTCACGAAGG + Intergenic
1188545655 X:31303396-31303418 AAGAAAGATCAGATTTAGGGTGG - Intronic
1189209089 X:39267679-39267701 CAGGACTATCAACTTTTGGAAGG - Intergenic
1190851704 X:54250666-54250688 CAGAAAAATAAGATATAGGAAGG + Intronic
1191112484 X:56816298-56816320 CAGAATTCTCAGTTTTAGAAAGG + Intergenic
1194668704 X:96704503-96704525 CAGCACTATCACATTTATGAAGG - Intronic
1198562731 X:137868241-137868263 CAAAGCTATCATAGTTAGGAGGG - Intergenic
1198610209 X:138390814-138390836 CAGAACTATCAGTTGGATGAAGG + Intergenic
1200803477 Y:7408369-7408391 CATAATTATCAGATTTACCAAGG + Intergenic
1201383688 Y:13414197-13414219 AAGAACTAACATATTTATGACGG + Intronic