ID: 1014670261

View in Genome Browser
Species Human (GRCh38)
Location 6:124295034-124295056
Sequence GTGTACACAAAGATTTCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 127}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014670261 Original CRISPR GTGTACACAAAGATTTCCCT TGG Intronic
904187826 1:28719827-28719849 GACTACACAAAAATTTCCCAGGG - Intergenic
905762412 1:40571023-40571045 GTGTGCACAGAGTTGTCCCTAGG - Intergenic
906358136 1:45126553-45126575 TTGGGCACAAGGATTTCCCTTGG - Intronic
906543778 1:46607538-46607560 GGGGACACAAAGATTCTCCTGGG - Intronic
906582796 1:46950324-46950346 GGGAACACCAAGATGTCCCTTGG + Intergenic
912633447 1:111269377-111269399 GTCTTCACAAAGTCTTCCCTAGG - Intergenic
913226680 1:116706845-116706867 CAGTACACAAAGATTTCTGTGGG - Intergenic
915519597 1:156434131-156434153 GTGCACACACAGAGTTCCATAGG - Intergenic
917577316 1:176337442-176337464 GTGTACACAAAGATCTCACTGGG + Intergenic
917703148 1:177601461-177601483 ATGTAAAGAAAGATTTCACTGGG - Intergenic
921703031 1:218288801-218288823 CTGAACACAAAAATGTCCCTTGG - Intronic
921945266 1:220881849-220881871 GAGTAGACAAAAATGTCCCTTGG - Intronic
1064962008 10:20975805-20975827 ATGGACACATAGATTTCCTTTGG - Intronic
1065726386 10:28671304-28671326 GTATATAAAAAGAGTTCCCTGGG - Intergenic
1070670956 10:78376897-78376919 GTGTCCACACAGACTTTCCTGGG - Intergenic
1073591264 10:104759668-104759690 GTGTAGAAAAAGATATCCCAAGG - Intronic
1074377990 10:112953916-112953938 GTGTACACAAAGATGTCTGCTGG - Intronic
1076054301 10:127358761-127358783 GTGTATACAGAGATTTTTCTGGG + Intronic
1079265477 11:18927723-18927745 TTCACCACAAAGATTTCCCTTGG - Intergenic
1079345370 11:19647119-19647141 TTGTCCAGATAGATTTCCCTTGG + Intronic
1084069265 11:66723555-66723577 ATGTGCACAAAGATTTTTCTTGG + Intronic
1084239937 11:67812213-67812235 GTGTACACAGTGATTTCCTTAGG + Intergenic
1084749389 11:71194173-71194195 TTGAACACAAAACTTTCCCTGGG - Intronic
1084832501 11:71780621-71780643 CTGTACACAGTGATTTCCTTAGG - Intergenic
1085587263 11:77721303-77721325 ATGTAAACAAACATTACCCTTGG - Intronic
1086289405 11:85290338-85290360 ATGTACACAAAAATTTCCTGGGG + Intronic
1090603211 11:128394080-128394102 GTATATGCAAAGCTTTCCCTTGG + Intergenic
1090991093 11:131817641-131817663 GTATATACAAAGGTTTTCCTGGG + Intronic
1091321959 11:134657922-134657944 GTGGGCACGAAGATCTCCCTTGG + Intergenic
1093588416 12:20870632-20870654 GTATACACACAGATTTCTCTGGG + Intronic
1095319716 12:40812309-40812331 GTGTACACACAGCATTCTCTAGG - Intronic
1095599595 12:44000350-44000372 GAGTACACAAAGACTGCCCCGGG - Intronic
1104816644 12:131649979-131650001 GTCTTCACCAAGAATTCCCTTGG + Intergenic
1106462923 13:29989056-29989078 GTGGACACAGAGATTTTTCTTGG + Intergenic
1107128268 13:36868166-36868188 GTGTACACAAAAATTGCCAGTGG + Intronic
1112040826 13:95546233-95546255 CTGTACACAAAGAGTTGTCTTGG + Intronic
1112327669 13:98453677-98453699 GTCTGCACAAAGATGTCTCTCGG + Intronic
1113048415 13:106181983-106182005 GTATACACAAATATTTCTTTTGG - Intergenic
1119650901 14:76382138-76382160 GTGCACACACAGGTTTCCCACGG - Intronic
1124067368 15:26357002-26357024 CTGCACACAAAGTTTTCCTTTGG - Intergenic
1125054999 15:35348453-35348475 ATATACATAAAGATTTCTCTGGG + Intronic
1125747336 15:42005889-42005911 GTGTACACAGAGAAGACCCTGGG + Intronic
1130052477 15:80495312-80495334 GTGTACACAAAGAGTGTACTGGG - Intronic
1130318824 15:82822308-82822330 GTGTACACAAAGATTTATACAGG + Intronic
1131214824 15:90528826-90528848 ATGTGCACAAAGATGTCCCGGGG - Intergenic
1131302924 15:91215304-91215326 GTGAGCACAAAAATTACCCTGGG + Intronic
1135898516 16:26432963-26432985 ATGGACACAAAGATTTTCTTAGG - Intergenic
1135963855 16:27019918-27019940 CAATACATAAAGATTTCCCTCGG - Intergenic
1136080192 16:27847306-27847328 GTGTTCTCCAAGATTTCCTTGGG - Intronic
1138055616 16:53830066-53830088 ATCTACAAGAAGATTTCCCTGGG - Intronic
1138303656 16:55955127-55955149 GTGTACACTGAGCTCTCCCTGGG - Intronic
1140272348 16:73478501-73478523 GTATACACCAGGATTCCCCTGGG + Intergenic
1144811523 17:18003142-18003164 TTGTTCACACAGATTCCCCTTGG + Intronic
1146296727 17:31655930-31655952 GTCTACACAAATATTTCCACTGG - Intergenic
1146427041 17:32750307-32750329 GAGTCCACAAAAGTTTCCCTGGG + Intronic
1146898709 17:36566230-36566252 GTGTAAACCCACATTTCCCTTGG + Intronic
1147782224 17:42951782-42951804 GAGTCCACAAAGAATTACCTGGG + Exonic
1149018040 17:51931575-51931597 GTGTACACAAAGTTTTTCTTTGG + Intronic
1149743072 17:59066700-59066722 GTGTCCAAAAAATTTTCCCTAGG - Intronic
1150986070 17:70198466-70198488 GTGCAGACAAAAGTTTCCCTGGG + Intergenic
1155271479 18:24145576-24145598 GTTTGCACAAAAATTTCCCTTGG + Intronic
1157278649 18:46331144-46331166 GTGGACTCATAGATTTCCCTTGG + Intronic
1158492705 18:57924605-57924627 GTGGACACAAAGATGTCACAAGG - Intergenic
1159565276 18:70041303-70041325 GTGCACACAACTATTTCCTTAGG - Intronic
927056064 2:19366717-19366739 GTGTTTATAAAGATTTCCTTAGG + Intergenic
928210216 2:29318499-29318521 GTTTCCTCAAAGATATCCCTAGG - Intronic
929635592 2:43517801-43517823 GAAAACACAAAGATTTCCCAGGG + Intronic
930402314 2:50905811-50905833 ATTTACACATAGAGTTCCCTGGG + Intronic
931681463 2:64752585-64752607 GTGAACACAAAGGTTTACTTTGG + Intergenic
931736109 2:65196133-65196155 GTGTACATAAGTATTTCCTTAGG - Intergenic
932841373 2:75085875-75085897 GTGTACATAAAGAATTCCAGAGG - Intronic
933325382 2:80829731-80829753 GTGTACATATAGACTTTCCTGGG + Intergenic
934961422 2:98678965-98678987 TAGTCCTCAAAGATTTCCCTAGG + Intronic
935121302 2:100185770-100185792 GTGTGAACAATGATTGCCCTTGG - Intergenic
935310881 2:101782061-101782083 GTGATCATAATGATTTCCCTGGG + Intronic
937429936 2:121829823-121829845 GGGTTCACAATGATGTCCCTGGG - Intergenic
938885657 2:135645232-135645254 TTGAAAACAAAGATTTCCTTAGG - Intronic
946420722 2:219563091-219563113 CTGTCCCCAGAGATTTCCCTTGG + Intronic
947159716 2:227200298-227200320 GTATTCACAAAGTTTTTCCTGGG + Intronic
947498131 2:230653773-230653795 GTGTACATAAAAATCACCCTAGG + Intergenic
1178884582 21:36475246-36475268 GTGTGCACGCATATTTCCCTTGG - Intronic
950140698 3:10613160-10613182 GTGAACACAATGATGTTCCTGGG + Intronic
950543894 3:13627709-13627731 ATGGCCACAAAGATCTCCCTGGG - Intronic
953231057 3:41065443-41065465 CTGTAGACAATGATTGCCCTTGG + Intergenic
955117529 3:56020665-56020687 GTGTACACAAATGTATCCATGGG - Intronic
960640249 3:119816501-119816523 TTGTACACAGAGACTTCCGTGGG - Intronic
961115504 3:124325808-124325830 TTGTAGAAAAAGATTTCCCTTGG + Intronic
961298975 3:125909721-125909743 CTGTACACAGTGATTTCCTTAGG - Intergenic
965612384 3:170558022-170558044 TGGTATACAGAGATTTCCCTAGG + Intronic
965758401 3:172049250-172049272 GTGTAAATGGAGATTTCCCTAGG + Intronic
965770894 3:172180160-172180182 GTGTGCACAGTGTTTTCCCTTGG + Intronic
966296553 3:178430528-178430550 GTGTACAGAAAAATTTCTATAGG + Intronic
972710861 4:41593179-41593201 GTGTATAAAAACATTTCCCAAGG - Intronic
973088660 4:46102975-46102997 GTGTAAACCAAGATTTTCCTTGG - Intronic
976058033 4:81092328-81092350 GTGTACAAAAACAAATCCCTGGG + Intronic
977355507 4:95941299-95941321 GTGAAAACAGAGATTTCCCTAGG - Intergenic
982372083 4:154644951-154644973 GTGTATACAATGATTTTCTTAGG + Intronic
983180017 4:164636722-164636744 GTGTGAACAAAGATTTCCTTTGG - Intergenic
983326163 4:166259578-166259600 GTGTACAGAAAGATTTTACAAGG + Intergenic
984680060 4:182597064-182597086 TTGGTCACAAAGATTTCCCTGGG + Intronic
986620246 5:9665380-9665402 ATGTACAGTAACATTTCCCTGGG + Intronic
989582732 5:43048078-43048100 GCGCAGAGAAAGATTTCCCTTGG - Intergenic
990290169 5:54341911-54341933 GTGTACAGGAAGATTTGCATAGG + Intergenic
993394845 5:87372966-87372988 GTGTATACTTAAATTTCCCTGGG - Intronic
993542192 5:89165811-89165833 GTGTGCACAAACATTTTCCATGG - Intergenic
994589116 5:101751870-101751892 GTATACAGAAAGATGTCCATAGG + Intergenic
996094418 5:119383047-119383069 GTGTACACAAAGGTCCCCTTTGG - Intronic
996926423 5:128832256-128832278 GTGCACACACAGATTAGCCTAGG - Intronic
999075207 5:148789094-148789116 GTGTCCACACAGATCTCCATCGG + Intergenic
1000884254 5:166733360-166733382 ATGCACACAAAGATATCCCATGG + Intergenic
1005418327 6:25624705-25624727 GTGTACACACAGCTTACACTGGG + Intergenic
1005993111 6:30915571-30915593 GTGTCTCCAAAGATTTCTCTTGG + Intronic
1007201480 6:40113428-40113450 GTGTACACTTAGATGTCCCCAGG - Intergenic
1008260167 6:49356242-49356264 GTATACAGGAAGATTTCCATTGG + Intergenic
1008861929 6:56159261-56159283 GTTTTCTCAAAGTTTTCCCTTGG + Intronic
1014195285 6:118550513-118550535 GTGTACACAAATATTTCATTTGG + Intronic
1014670261 6:124295034-124295056 GTGTACACAAAGATTTCCCTTGG + Intronic
1015487228 6:133786805-133786827 CTGTACATAAAGCTTACCCTAGG + Intergenic
1016995739 6:149961462-149961484 GTGTCCACAAAGATTTTCCAAGG - Intergenic
1017002885 6:150008007-150008029 GTGTCCACAAAGATTTTCCAAGG + Intergenic
1017012450 6:150071705-150071727 GTGTCCACAAAGATTTTCCAAGG + Intergenic
1017533440 6:155321093-155321115 GTCTACAAAAAGATCTACCTAGG - Intergenic
1018957356 6:168419197-168419219 TTGAACACAAAGATTTGCCTGGG + Intergenic
1034849843 7:154483291-154483313 GTCTACACAAACACGTCCCTGGG - Intronic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1039447961 8:37647798-37647820 TTTTACACAATGATTTCCCTTGG + Intergenic
1039828565 8:41195079-41195101 GCCTACACAAAGATGTCCATGGG + Intergenic
1041263952 8:56045863-56045885 GAGTGCACAAAGATATCCTTTGG - Intergenic
1045189766 8:99871236-99871258 CTGGGAACAAAGATTTCCCTTGG - Intronic
1046358930 8:113125210-113125232 GTGTACACAATGATTACACAAGG + Intronic
1047851912 8:128866155-128866177 GTGTAGACAAAGAAGTCACTGGG + Intergenic
1054737401 9:68769240-68769262 CAGAACAGAAAGATTTCCCTGGG - Intronic
1055382263 9:75721310-75721332 GTGTTCACAAAGCTTTACCATGG - Intergenic
1057429757 9:94982849-94982871 GTCCAAACAAAGGTTTCCCTCGG + Intronic
1060245908 9:121946186-121946208 GTGGACACACAGAGTGCCCTGGG + Intronic
1061432244 9:130538371-130538393 GTGGACAGAAAGATCGCCCTGGG - Intergenic
1061653638 9:132070677-132070699 GTGTGCACAAATATCTGCCTGGG + Intronic
1061907663 9:133707169-133707191 GGGTGAACCAAGATTTCCCTGGG + Intronic
1187660632 X:21543254-21543276 TTGAACACAAAAATTTCCCATGG - Intronic
1188254008 X:27936916-27936938 TTTTAGACAAAGATTGCCCTAGG - Intergenic
1188873486 X:35401837-35401859 TTTTACACAAAGATATGCCTGGG + Intergenic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1189195863 X:39151991-39152013 GTGACTACAAAGATTTCTCTGGG - Intergenic
1196686100 X:118511850-118511872 CAGTTCACAAACATTTCCCTTGG - Intronic
1200889142 Y:8304516-8304538 ATGTTCACAAAGAATTCCTTTGG + Intergenic