ID: 1014671799

View in Genome Browser
Species Human (GRCh38)
Location 6:124313720-124313742
Sequence GGTGGCCGGTTTCCCCATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014671797_1014671799 -7 Left 1014671797 6:124313704-124313726 CCAATTGTACACTCTGGGTGGCC 0: 1
1: 0
2: 0
3: 7
4: 77
Right 1014671799 6:124313720-124313742 GGTGGCCGGTTTCCCCATGCTGG 0: 1
1: 0
2: 0
3: 13
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014671799 Original CRISPR GGTGGCCGGTTTCCCCATGC TGG Intronic
902065426 1:13681764-13681786 GGGGGCAGTTTCCCCCATGCTGG - Intergenic
903167874 1:21533732-21533754 GATGGGCGGTTTCACCATGTTGG - Intronic
907067583 1:51501219-51501241 GGAGACGGGTTTCCCCATGTTGG - Intronic
907107532 1:51897523-51897545 GGTGGGTGGTTTCACCATGTTGG + Intergenic
912480743 1:109980667-109980689 GCTGGAGGGTTTGCCCATGCTGG + Intergenic
916058776 1:161085195-161085217 GGTGGGCGTTTTGCCCAGGCTGG - Intronic
917853445 1:179083595-179083617 GGGGGCGGGTTTCACCATGTTGG + Intronic
918491028 1:185081595-185081617 GGGGGGCGGTTTCACCATGTTGG + Intronic
919813692 1:201424683-201424705 GGAGGCCTGCTTCCCCCTGCAGG - Intronic
919838797 1:201594509-201594531 GGTGGCAGAGCTCCCCATGCAGG + Intergenic
1067111456 10:43404108-43404130 GGTGGGGGGTTTCACCATGTTGG - Intronic
1077736304 11:4795244-4795266 GGTGGCAGATTTCCCAATTCTGG - Intronic
1088672656 11:112158173-112158195 GGGGGCGGGTTTCTCCATGTTGG + Intronic
1091587662 12:1825380-1825402 TGAGGCCGGATTCCCCATCCAGG - Intronic
1099740197 12:86625002-86625024 GAGGGCGGTTTTCCCCATGCTGG + Intronic
1104387001 12:128359395-128359417 GGAGGCAGTTTCCCCCATGCTGG - Intronic
1104643566 12:130482149-130482171 GGTGTCAGGTTTCCCCATGAGGG + Intronic
1109216612 13:59596834-59596856 GGGGGCAGTTATCCCCATGCTGG - Intergenic
1111949043 13:94695348-94695370 GGGGGCGGTTTTCCCCATACTGG + Intergenic
1113635805 13:111918219-111918241 GCTGGCCGGTTTCCCGACGTCGG - Intergenic
1114476093 14:22996002-22996024 GGCTGACCGTTTCCCCATGCAGG - Exonic
1115014497 14:28593785-28593807 GGTGGCCGGTTTGGCCATAAGGG + Intergenic
1119303495 14:73589503-73589525 GGAGGCGGGTTTCACCATGTTGG + Intergenic
1121977574 14:98419773-98419795 GCTGGCCGGGTTCCACAGGCAGG + Intergenic
1123407396 15:20029422-20029444 GGTGCTCGGCATCCCCATGCAGG - Intergenic
1123473311 15:20570397-20570419 GGTGGCTGGTTTCCAGATTCTGG - Intergenic
1123516723 15:21036078-21036100 GGTGCTCGGCATCCCCATGCAGG - Intergenic
1123644697 15:22429956-22429978 GGTGGCTGGTTTCCAGATTCTGG + Intergenic
1123666014 15:22609864-22609886 GGTGGCTGGTTTCCAGATTCTGG + Intergenic
1123733611 15:23165408-23165430 GGTGGCTGGTTTCCAGATTCTGG - Intergenic
1124319837 15:28704277-28704299 GGTGGCTGGTTTCCAGATTCTGG + Intronic
1124482674 15:30091153-30091175 GGTGGCTGGTTTCCAGATTCTGG - Intronic
1124489131 15:30143245-30143267 GGTGGCTGGTTTCCAGATTCTGG - Intronic
1124520903 15:30406065-30406087 GGTGGCTGGTTTCCAGATTCTGG + Intronic
1124537759 15:30560154-30560176 GGTGGCTGGTTTCCAGATTCTGG - Intronic
1124544214 15:30612215-30612237 GGTGGCTGGTTTCCAGATTCTGG - Intronic
1124754398 15:32395079-32395101 GGTGGCTGGTTTCCAGATTCTGG + Intronic
1124760897 15:32447432-32447454 GGTGGCTGGTTTCCAGATTCTGG + Intronic
1124777737 15:32601631-32601653 GGTGGCTGGTTTCCAGATTCTGG - Intronic
1130420148 15:83737392-83737414 GGGGGCAGTTTCCCCCATGCTGG + Intronic
1130435700 15:83896998-83897020 GGGGGCAGTTTTCCCCATGCTGG - Intronic
1130731371 15:86496134-86496156 GGGGGCGGTTTCCCCCATGCTGG + Intronic
1131176476 15:90212365-90212387 TGCGGCCGGTTTTCCCATTCAGG - Intronic
1132262495 15:100438745-100438767 AGGGGCTGGTTTCTCCATGCTGG + Intronic
1132729265 16:1352857-1352879 GGTGAGCGGTTTCCCAGTGCAGG + Intronic
1133040275 16:3056976-3056998 TGTGGCCCCTTTCCCCAAGCAGG + Intronic
1133997724 16:10761106-10761128 GGGGGCAGTTTCCCCCATGCTGG - Intronic
1134605494 16:15567965-15567987 GGTGTCCTGTTTCCCCAGGATGG + Exonic
1136624800 16:31455792-31455814 GGTAGCCTGTTTCCCCTTGAAGG - Intergenic
1137252030 16:46747764-46747786 GGTGGCGGATTTCCTCATGCAGG - Exonic
1138689356 16:58753155-58753177 AGAGACGGGTTTCCCCATGCTGG + Intergenic
1142289779 16:89188189-89188211 GGTGGCCAGGTTCACCATCCTGG + Exonic
1142879575 17:2873960-2873982 GGGGGCGGGTTTCACCATGTTGG + Intronic
1145001892 17:19311199-19311221 GGTGGCCTGTTTCCCACTGCAGG - Intronic
1149822888 17:59797143-59797165 GGGGGGGGGTTTCACCATGCTGG - Intronic
1150212182 17:63447245-63447267 GGAGGCCGGTTTCCCTCTGCGGG - Intergenic
1150276225 17:63899469-63899491 GGTGGCGAGGCTCCCCATGCAGG + Intergenic
1152325424 17:79633244-79633266 GGCGGCCACTTTGCCCATGCAGG - Intergenic
1152659139 17:81534456-81534478 GGTGCCTGCTGTCCCCATGCTGG + Intronic
1153003524 18:477751-477773 GTTGGCAGGTGTCCCCCTGCTGG + Intronic
1160809276 19:1006331-1006353 GTTGGCGGGTTTCACCATGTTGG + Intronic
1162951682 19:14074891-14074913 GGTGGTCAGTTTCCCAATGGGGG - Exonic
1164426416 19:28145887-28145909 GGTGCAAGGTTTCTCCATGCTGG - Intergenic
1168157012 19:54479897-54479919 GGAGACCAGTTTCCCCATGTAGG - Intergenic
925450898 2:3968478-3968500 GGGGGCGGTTTCCCCCATGCTGG + Intergenic
925598912 2:5588258-5588280 GATGGCCGGCAGCCCCATGCTGG + Intergenic
927125710 2:20011321-20011343 GGTGGCTGGTTGCTCCAGGCCGG - Intronic
928547475 2:32341871-32341893 GGGGGCAGGTTTCACCATGTTGG - Intergenic
932283723 2:70515694-70515716 GGTGGCAGCTGTCCCCATTCTGG - Intronic
935336570 2:102022290-102022312 GGTGCCTGGTATCCCAATGCAGG + Intronic
935540732 2:104345180-104345202 TGTGGCCGGATTACCCTTGCTGG - Intergenic
937295374 2:120806909-120806931 GGTGTCTGGTTTCTCCATGGGGG - Intronic
938295940 2:130179571-130179593 AGAGGCGGGTTTCCCTATGCTGG + Intronic
938921503 2:135999460-135999482 GGAGGCTGGTTTCTCCATGTTGG + Intergenic
939454816 2:142420438-142420460 GGGGGGCGGTTTCTCCATGTTGG + Intergenic
940122211 2:150279255-150279277 TGAGGGCAGTTTCCCCATGCTGG + Intergenic
941967733 2:171316236-171316258 GGTGCCCGGCAGCCCCATGCCGG - Intergenic
942025783 2:171909170-171909192 GGTGGGGGGTTTCACCATGTTGG - Intronic
942116848 2:172736151-172736173 GGTGGCCGGGGTCCCCGAGCGGG + Intronic
945818114 2:214630519-214630541 GGGGGCGGTTTCCCCCATGCTGG - Intergenic
946557379 2:220873681-220873703 GGGGGCAGTTTCCCCCATGCTGG - Intergenic
948296515 2:236864651-236864673 GGGGGCAGTTTCCCCCATGCTGG - Intergenic
948487010 2:238287822-238287844 GGTGGCCTGCTTCCCCCTTCAGG - Intronic
1173873688 20:46356973-46356995 GGAGGCCGGATTCCCCGTGGAGG - Intronic
1175731540 20:61357582-61357604 GGTGGCCAGGTTCCCCCTGGGGG - Intronic
1177131470 21:17261401-17261423 GGGGGCGGGTTTCACCATGTTGG + Intergenic
1180142936 21:45903276-45903298 CGTGGCCAGTTGCCCCATGCAGG + Intronic
1181569093 22:23757474-23757496 GTTGGTCGGTTTCACCATGTTGG + Intergenic
1182552961 22:31111213-31111235 GGTGGGGGGTTTCACCATGTTGG - Intronic
1183050728 22:35258239-35258261 GGTGGGCGCCTTCTCCATGCAGG + Intronic
1185183922 22:49381269-49381291 GGTGTCCGCTCTCCCCATCCAGG + Intergenic
1185315269 22:50176351-50176373 GGTGTCTGGTGTCCCCAGGCTGG + Intronic
953023889 3:39133884-39133906 GGTGCCCTGTATCCCCATGCAGG - Intronic
955459843 3:59169964-59169986 GGGGACAGTTTTCCCCATGCTGG + Intergenic
957834792 3:85573376-85573398 GGAGACGGGTTTCACCATGCTGG + Intronic
958904396 3:99925896-99925918 GGTGGCAGCTTACCCCGTGCTGG - Intronic
959270883 3:104208187-104208209 GGGGGCAGTTTCCCCCATGCTGG + Intergenic
959299299 3:104577943-104577965 TGGGGGCAGTTTCCCCATGCTGG - Intergenic
963266996 3:143249698-143249720 GGGGGCAGTTTTCCCCATGCTGG - Intergenic
965044688 3:163561356-163561378 GGTTTCCGCTTTCACCATGCAGG - Intergenic
968015922 3:195332674-195332696 GGGGGCGGTTTCCCCCATGCTGG + Intronic
969033220 4:4229677-4229699 GAGGTGCGGTTTCCCCATGCTGG + Intergenic
969663458 4:8543715-8543737 GGGGGCGGTTTCCCCCATGCTGG + Intergenic
970164070 4:13217836-13217858 AGAGGCCGGTTTCACCATGTTGG - Intergenic
971092460 4:23361132-23361154 GGTAGCCGTTTTCCACAGGCAGG - Intergenic
974538277 4:63197812-63197834 GATGACCAGATTCCCCATGCTGG + Intergenic
975117988 4:70700475-70700497 GATGGGCGGTTTCACCATGTTGG + Intergenic
980292980 4:130869561-130869583 GGGGGCAGTTTTCCCCATGCTGG + Intergenic
983504371 4:168536687-168536709 GGAGGTCGTTTCCCCCATGCTGG - Intronic
987611375 5:20208299-20208321 GGGGGCAGTTTCCCCCATGCTGG - Intronic
993799754 5:92318454-92318476 GGTGAGCAGTTTCCCCATGCTGG + Intergenic
997435480 5:133871062-133871084 AGTGGCCTGTTTCCCCACACCGG - Intergenic
1009238547 6:61156160-61156182 GGGGGCAGTTTCCCCCATGCTGG - Intergenic
1010046973 6:71456481-71456503 GGGGGCGGTTTCCCCCATGCTGG - Intergenic
1014671799 6:124313720-124313742 GGTGGCCGGTTTCCCCATGCTGG + Intronic
1017607494 6:156149375-156149397 GGTGGGGGGTTTCACCATGTTGG - Intergenic
1019039227 6:169089739-169089761 GGGGGCAGTTTCCCCCATGCTGG + Intergenic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1025057487 7:55776727-55776749 GGAGACGGGTTTCACCATGCTGG + Intergenic
1025200987 7:56961559-56961581 GGGGGGCGGTTTCACCATGTTGG + Intergenic
1025670956 7:63615373-63615395 GGGGGGCGGTTTCACCATGTTGG - Intergenic
1027188877 7:75986684-75986706 GGAGCCCGGTGCCCCCATGCAGG - Exonic
1028918758 7:96288242-96288264 AGAGACGGGTTTCCCCATGCTGG - Intronic
1030183169 7:106731999-106732021 GGTTGCTGGTTTCCTCATGCTGG - Intergenic
1034516939 7:151588544-151588566 GGAGGACGGTTTCGCCATGTTGG + Intronic
1035644841 8:1210806-1210828 TGTGGTCGGTTTTCCCATGTGGG + Intergenic
1037009981 8:13829598-13829620 AATGGCAGGTTTGCCCATGCAGG + Intergenic
1038292650 8:26263718-26263740 GGGGCCCAGTTTCCCCATGCTGG + Intergenic
1038496118 8:28004197-28004219 GGGGGCAGTTTCCCCCATGCTGG + Intergenic
1039981085 8:42410580-42410602 GGTCGGGGGTTTCACCATGCTGG + Intergenic
1043390849 8:79790373-79790395 GGGGGCAGTTTTCCCCATGCTGG - Intergenic
1044462760 8:92465165-92465187 GGTGGCCAGGTTCCCCACTCTGG + Intergenic
1046094319 8:109539696-109539718 GGGGGCGGGTTTCCCGATGAAGG + Intronic
1047568859 8:126075548-126075570 GGGGGCAGTTTCCCCCATGCTGG + Intergenic
1048347862 8:133591222-133591244 GGTGGCAGGTGTCCCCAGCCAGG + Intergenic
1049681418 8:143920248-143920270 GGTGGCCGGCTCCCCTGTGCTGG + Exonic
1049732862 8:144187748-144187770 GGTGGCCAGTGGCCCCATGAAGG + Intronic
1053543064 9:38994304-38994326 GGTGCACGGTTGCCCCTTGCAGG + Intergenic
1057363830 9:94399995-94400017 GATGGGAGGTTTCCCCATGTTGG + Intronic
1057659505 9:96988079-96988101 GATGGGGGGTTTCCCCATGTTGG - Intronic
1057813833 9:98279346-98279368 GTGGGCCGGTATCTCCATGCAGG - Intergenic
1060111705 9:120911288-120911310 TGGGGCCTGTTTCCCCAGGCAGG + Intronic
1060932009 9:127495137-127495159 GGTGGGGGGTTTCTCCATGTTGG + Intronic
1062008733 9:134255836-134255858 GGTGGCAGGTTCCCCTTTGCTGG + Intergenic
1062481062 9:136752072-136752094 GGAGGCAGATTTCCCCTTGCTGG - Intergenic
1188370664 X:29365850-29365872 GATGGGGGGTTTCACCATGCTGG - Intronic
1192410613 X:70929714-70929736 GGTGCCCGGGTTCCCCGTTCTGG - Exonic
1194524546 X:94962747-94962769 GATGGCCGGTTTTACAATGCAGG + Intergenic