ID: 1014672764

View in Genome Browser
Species Human (GRCh38)
Location 6:124327216-124327238
Sequence GTTTCTAAAGGAATTTTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1051
Summary {0: 1, 1: 0, 2: 18, 3: 201, 4: 831}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014672760_1014672764 -5 Left 1014672760 6:124327198-124327220 CCATAGTTGACATGTGTAGTTTC 0: 1
1: 0
2: 0
3: 8
4: 121
Right 1014672764 6:124327216-124327238 GTTTCTAAAGGAATTTTGGAGGG 0: 1
1: 0
2: 18
3: 201
4: 831

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014672764 Original CRISPR GTTTCTAAAGGAATTTTGGA GGG Intronic
900852603 1:5155850-5155872 GTTTCAACACGAATTTTGGAGGG + Intergenic
900893521 1:5466721-5466743 GTTCCAACATGAATTTTGGAGGG - Intergenic
902649952 1:17830614-17830636 GTTTCAACATGAATTTTGTAGGG - Intergenic
902907665 1:19570715-19570737 TTTTCAACATGAATTTTGGAAGG - Intergenic
903057676 1:20647778-20647800 CTTTTTAAAGGAATTTTGTGTGG + Intronic
903129131 1:21266965-21266987 GTTCCAACATGAATTTTGGAGGG - Intronic
903858200 1:26349634-26349656 GTTTCAACATGAGTTTTGGAGGG - Intronic
904725248 1:32541861-32541883 GTTTCAACATGAATTTTGGAGGG + Intronic
904801126 1:33093563-33093585 GTTTGAAAAGGAAGTTTAGAAGG + Intronic
905334787 1:37237092-37237114 GTTTCAACATGAGTTTTGGAGGG + Intergenic
905488153 1:38322117-38322139 ATTTCTGAAGGAATTTTTGGAGG - Intergenic
905760544 1:40553539-40553561 TATTCTAAAGGAATTTAGGATGG + Intergenic
906018314 1:42603401-42603423 GTTTCAATAGGAATTTTGGAGGG + Intronic
906317333 1:44794930-44794952 ATTTATATATGAATTTTGGAAGG - Intergenic
906856506 1:49312106-49312128 GTTTCTGTAAGAATTTTGGAGGG - Intronic
906857856 1:49327761-49327783 ATTTCAACATGAATTTTGGAAGG + Intronic
907026295 1:51123304-51123326 GTTTCAACATGAGTTTTGGAGGG + Intronic
907563659 1:55414160-55414182 ATTTCAACATGAATTTTGGAGGG - Intergenic
907585737 1:55616142-55616164 TTTTCCAAAGGATTTCTGGATGG + Intergenic
907703717 1:56814845-56814867 GCTTCAAGAGCAATTTTGGAGGG - Intronic
908075659 1:60514999-60515021 GTTTCAACGTGAATTTTGGAGGG - Intergenic
908142077 1:61196266-61196288 CTTTATAAAGGATTTTTGCAGGG + Intronic
908176702 1:61562888-61562910 GTTTCAACATGAATTTTGCAGGG + Intergenic
908230555 1:62100566-62100588 ATTTCAACATGAATTTTGGAGGG + Intronic
909194329 1:72597911-72597933 CTTTCTAAAGTAATTTGTGAAGG - Intergenic
909619872 1:77655267-77655289 GTTTCAACATGAGTTTTGGATGG + Intronic
909704632 1:78566881-78566903 GTTTCAACATAAATTTTGGAGGG - Intergenic
909714560 1:78692233-78692255 TTTTCAACATGAATTTTGGAGGG + Intergenic
910126144 1:83844815-83844837 GTTTCTACATGAATTCTGGAGGG - Intergenic
910134802 1:83955347-83955369 GTTTCAACATGAATTTTGGAGGG - Intronic
910722451 1:90301736-90301758 GTTTCAACATGAATTTTGGAGGG - Intergenic
910810051 1:91226799-91226821 GTTTTTAAGGGTAATTTGGAGGG - Intergenic
910832117 1:91471509-91471531 GTTTCAACATGAATTTTGGAGGG - Intergenic
911132242 1:94400817-94400839 GTTTCAACATGAGTTTTGGAAGG - Intergenic
911250525 1:95571504-95571526 GTTTCAACATGAATTTTGGAGGG - Intergenic
911271998 1:95813057-95813079 GTTTCAAAATGAGATTTGGAAGG + Intergenic
911389395 1:97220081-97220103 GTTTCAACATGAGTTTTGGAGGG - Intronic
911781120 1:101880281-101880303 GTTTCTAGAGTAGTTTTGAATGG + Intronic
911803030 1:102168183-102168205 ATTTCAACAGGAGTTTTGGAGGG - Intergenic
912653806 1:111467340-111467362 GTTTCAACATGAATTTTGAAGGG + Intergenic
912774413 1:112496282-112496304 GTTTCAACATGAATTTTAGAAGG + Intronic
912835014 1:112988415-112988437 GTTCCTACATGAATTTTGGAGGG + Intergenic
913254377 1:116940536-116940558 CTTCCACAAGGAATTTTGGATGG + Intronic
913595462 1:120371797-120371819 GTTTCAACATGAATTTTGGAGGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
913682844 1:121203160-121203182 GTTTCAACATGAGTTTTGGAGGG + Intronic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914034685 1:143990785-143990807 GTTTCAACATGAGTTTTGGAGGG + Intergenic
914091812 1:144507178-144507200 GTTTCAACATGAATTTTGGAGGG + Intergenic
914154767 1:145077183-145077205 GTTTCAACATGAGTTTTGGAGGG - Intronic
914198573 1:145464637-145464659 TTTTCTAAAGGAATCTTCTAAGG + Intergenic
914306727 1:146426686-146426708 GTTTCAACATGAATTTTGGAGGG - Intergenic
914384181 1:147151532-147151554 GTTTCACCATGAATTTTGGAGGG + Intergenic
914477679 1:148037772-148037794 TTTTCTAAAGGAATCTTCTAAGG + Intergenic
914595322 1:149146116-149146138 GTTTCAACATGAATTTTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914946273 1:152069477-152069499 GTTTCTGAAGAAATTATGTATGG + Intergenic
915152925 1:153849398-153849420 ATTTCAACATGAATTTTGGAGGG + Intronic
915874954 1:159602553-159602575 GTTTCAACATGAATTTTCGAGGG + Intergenic
915964646 1:160295753-160295775 GTATCCAAAGGATTTTTTGAAGG - Exonic
916671385 1:167024488-167024510 GTTTCAACATGAATTTTGAAGGG - Intergenic
916850007 1:168694110-168694132 GTTTATAAAGGGATTTTCTAAGG - Intergenic
916869555 1:168898073-168898095 GTTTCTAAAGGCATGAGGGAAGG - Intergenic
916884217 1:169051509-169051531 ATTTCAAAGTGAATTTTGGAAGG + Intergenic
917282121 1:173387215-173387237 GTTTCAACATGAATTTTGAAGGG - Intergenic
917532157 1:175845108-175845130 TTTTCTCAAGGATGTTTGGAGGG + Intergenic
917594612 1:176516462-176516484 GTTTCAACATGGATTTTGGAGGG - Intronic
918538888 1:185605736-185605758 GTTTCTACATGAATTTTGGAGGG - Intergenic
919213121 1:194514028-194514050 GTTTTTAAAAGAACTTTGTAAGG + Intergenic
919349438 1:196430910-196430932 GTTTCAACATGAATTTTGGAGGG - Intronic
919536902 1:198798415-198798437 ATTTCAAACTGAATTTTGGAGGG - Intergenic
920265928 1:204722629-204722651 GTTCCAATATGAATTTTGGAGGG + Intergenic
920470154 1:206221673-206221695 GTTTCAACATGAGTTTTGGAGGG + Intronic
920554253 1:206892510-206892532 GTTTCAACATGAGTTTTGGAGGG + Intergenic
920735464 1:208529311-208529333 GTTTCTATAGCAATTATGGGGGG + Intergenic
920790404 1:209084462-209084484 ATTTCTACATGAATTTTGGAGGG + Intergenic
921829536 1:219711631-219711653 GTTTCCACATGAATTTTGGTGGG - Intronic
921855565 1:219979345-219979367 TTTACTAAAGGAAATTTGAAAGG - Intronic
922217370 1:223531296-223531318 GTTTCAACATGAATTTTAGAGGG + Intergenic
922255027 1:223886136-223886158 ATTTCAACAGGCATTTTGGAGGG + Intergenic
922273836 1:224058265-224058287 GTTACCAATGGAATTTTGTAGGG - Intergenic
922277499 1:224092664-224092686 ATTTCAACATGAATTTTGGAGGG - Intergenic
923556424 1:235004291-235004313 ATTTCCACATGAATTTTGGAGGG - Intergenic
923670484 1:236036584-236036606 GTTTCAATATGAGTTTTGGAGGG - Intronic
923859219 1:237876382-237876404 ATTTCAACAGGAGTTTTGGAAGG - Intergenic
924034552 1:239923172-239923194 GTTTTTAAGGGGATTATGGAAGG + Intergenic
924163417 1:241257389-241257411 GTTTCAACATAAATTTTGGAGGG + Intronic
924328693 1:242921251-242921273 GTTTTTAAGGGAATTATAGAAGG + Intergenic
924842228 1:247724774-247724796 GTTTATAAAGGAATTTTGACAGG + Intergenic
924909108 1:248489716-248489738 AATTGTAAAAGAATTTTGGATGG - Intergenic
924914997 1:248558342-248558364 AATTGTAAAAGAATTTTGGATGG + Intergenic
1062826877 10:576458-576480 GTTTCTGAAGGAATGCCGGATGG - Intronic
1064446183 10:15395527-15395549 GTTTCTACTAGAATTTTGGAAGG - Intergenic
1064691186 10:17920062-17920084 GTTTCTTAAGGATTATTTGATGG - Intergenic
1064908514 10:20373428-20373450 GTTTCTTAAAGAAGTTAGGATGG + Intergenic
1065060356 10:21894701-21894723 GTTTCTACATGAATTTTGGAGGG - Intronic
1065238882 10:23685785-23685807 GTTTCAACATGAATTTTGGAGGG + Intergenic
1065771667 10:29083927-29083949 GTTTCAACATGAGTTTTGGAGGG - Intergenic
1065909721 10:30291596-30291618 GTTCCTAAAGGAATCTTACATGG - Intergenic
1066054592 10:31668599-31668621 ATTTCAATATGAATTTTGGAGGG + Intergenic
1066162154 10:32745650-32745672 GTTTCTACATGACCTTTGGAGGG + Intronic
1066506634 10:36051832-36051854 GTTTCCATAGGAATTTGGCAGGG + Intergenic
1067218403 10:44322839-44322861 GTTTCAACATGAGTTTTGGAGGG + Intergenic
1067492788 10:46727831-46727853 GTTTCAACATGAGTTTTGGAGGG + Intergenic
1067733617 10:48831980-48832002 GTTTCAACATGAATTTTGGAGGG + Intronic
1067914078 10:50377439-50377461 CTTTCAACAAGAATTTTGGAGGG + Intronic
1068124639 10:52824117-52824139 ATTTCAAAATGAGTTTTGGAGGG + Intergenic
1068197447 10:53735525-53735547 GTTTCAACATGAATTTTGAAGGG + Intergenic
1068343711 10:55742646-55742668 GTTTCAAAGTGAGTTTTGGAGGG + Intergenic
1068510355 10:57958057-57958079 GTTTCAACATGAATTTTGGAGGG - Intergenic
1068771904 10:60831038-60831060 GTTTCAACATGAATTTTGGAGGG + Intergenic
1068824318 10:61417130-61417152 ATCTGTAAAGGAATTTTGGGTGG + Intronic
1069059941 10:63884936-63884958 GTTTCAACATGAATTTTGAAGGG - Intergenic
1069730248 10:70606867-70606889 GTTTCAACATGAATCTTGGAGGG - Intergenic
1070213808 10:74354362-74354384 GTTTATGAAGGAATTGTGTAGGG - Intronic
1070477100 10:76839802-76839824 ATTTCAACATGAATTTTGGAGGG - Intergenic
1071054651 10:81495028-81495050 GTTTATGAAGGAGTTTGGGAAGG + Intergenic
1071339883 10:84635861-84635883 GTTTCAACATGAGTTTTGGAGGG - Intergenic
1071653402 10:87420152-87420174 GTTTCAACATGAGTTTTGGAGGG - Intergenic
1071804285 10:89099832-89099854 GTTTCTAAATTAATTTTAAATGG + Intergenic
1072162236 10:92779270-92779292 GTTTCAACATGAATTTTGTAGGG - Intergenic
1072483253 10:95829767-95829789 GTTTCAACATGAGTTTTGGAGGG - Intronic
1073148502 10:101295921-101295943 GTTTCAACATGAATTTTGGAGGG - Intergenic
1074035717 10:109736236-109736258 ATTTCAACATGAATTTTGGAGGG + Intergenic
1074244960 10:111680558-111680580 GTTTCAACATGAATTTTGAAGGG - Intergenic
1074568551 10:114603534-114603556 TTATCTAAAGGAATTAAGGAGGG + Intronic
1074625405 10:115178559-115178581 GTTTCAACATGAATTTTGGAGGG - Intronic
1074915669 10:117952529-117952551 GTCTCTAAAAGAATTTTAGCTGG - Intergenic
1075212356 10:120502031-120502053 TGCTCTAGAGGAATTTTGGAGGG + Intronic
1075238326 10:120753144-120753166 GTTTCAACATGAATTTTGAAGGG - Intergenic
1075872368 10:125780114-125780136 GTTTCAACATGAATTGTGGAGGG - Intergenic
1076229663 10:128809578-128809600 GTTTCAACATGAGTTTTGGAGGG - Intergenic
1077396893 11:2328677-2328699 TTTTCAACATGAATTTTGGAGGG + Intergenic
1077558090 11:3236513-3236535 TTTTCTAAAAGAGTTTTGCAGGG - Intergenic
1077871464 11:6265752-6265774 GCTTCTAAAGGAAATATAGATGG + Intronic
1078422784 11:11225855-11225877 GTTTCAAAATACATTTTGGAGGG + Intergenic
1078824617 11:14917062-14917084 GTTTCAACATAAATTTTGGAGGG + Intronic
1078831664 11:14983100-14983122 GTTTCCATATGAGTTTTGGAGGG + Intronic
1079143535 11:17830814-17830836 GTTTTAACATGAATTTTGGAGGG + Intronic
1079488971 11:20966383-20966405 ATTTCAACATGAATTTTGGAGGG + Intronic
1079685161 11:23350534-23350556 GTTTCAACATGAATTTTGGAGGG - Intergenic
1079918861 11:26406375-26406397 GTTTCAACATGAATTTTGGAGGG + Intronic
1080205593 11:29725444-29725466 GTTTCAACATGAATTTTGGAGGG - Intergenic
1080312566 11:30911921-30911943 GTTTCAACATGAGTTTTGGAGGG - Intronic
1080532702 11:33192440-33192462 ATTTCTACATGAGTTTTGGAGGG + Intergenic
1080858214 11:36130459-36130481 GGTTCGGAAGGAAGTTTGGAGGG + Intronic
1080991547 11:37543024-37543046 GTTTCAATATGAGTTTTGGAGGG - Intergenic
1081439162 11:43061406-43061428 GTTTCAACATGAGTTTTGGAGGG + Intergenic
1081496688 11:43618382-43618404 ATTTCAAGAAGAATTTTGGATGG + Intronic
1081684717 11:45034292-45034314 GTTTCAACATGAATTTTGGAGGG + Intergenic
1083145189 11:60752866-60752888 GTTTCAACATGAATTTTGGAGGG + Intergenic
1083701273 11:64479279-64479301 GTTTCAACATGAATTTTGGAGGG + Intergenic
1083916447 11:65747471-65747493 GTTTCAACATGAAGTTTGGAGGG - Intergenic
1084194671 11:67517744-67517766 GTTTCAACATGCATTTTGGAGGG - Intergenic
1084574727 11:69981759-69981781 GTTTCCAAAGGGTCTTTGGAAGG - Intergenic
1085969988 11:81577082-81577104 TTTTCTAAAGGACATTTTGAAGG + Intergenic
1086040557 11:82472213-82472235 GTTTCTACATTAATTTTGGAGGG + Intergenic
1086265233 11:84990277-84990299 GTTTCAAAATGAATTTAAGAGGG - Intronic
1086553615 11:88083581-88083603 GTTTCAACATGAATTTTGAAAGG - Intergenic
1087265034 11:96051184-96051206 GATTCTAAATAAATATTGGACGG - Intronic
1087277816 11:96177860-96177882 GTTTTTGAGGGAATTTTTGAGGG + Intronic
1087398665 11:97635530-97635552 GTTTCAGAAGGAATGGTGGAAGG + Intergenic
1087472508 11:98594977-98594999 TTTTTTAAAGGAATTTTTGTAGG - Intergenic
1087499014 11:98928146-98928168 ATTTCAACATGAATTTTGGAAGG - Intergenic
1087669993 11:101094797-101094819 GTTTCAATATGAATTTTGAAGGG - Intronic
1087826588 11:102771448-102771470 TACTCTGAAGGAATTTTGGAGGG - Intronic
1088278569 11:108114921-108114943 GTTTCAACATGAATTTTGGAGGG - Intergenic
1088357199 11:108956565-108956587 GTTTCAACATAAATTTTGGAGGG + Intergenic
1088545621 11:110955957-110955979 CTTTATAAAGGAATTTGAGAAGG + Intergenic
1089878035 11:121744944-121744966 GTTTTAACATGAATTTTGGAGGG - Intergenic
1089910680 11:122097317-122097339 GTTGCAAAAGGAATTTTGGCTGG + Intergenic
1090052795 11:123395033-123395055 ATTTCAAAATGAATTTTGGAGGG + Intergenic
1090134447 11:124182749-124182771 GTTTCAACACGAATTTTTGAAGG + Intergenic
1090565578 11:127988553-127988575 GTTTCAATATGAGTTTTGGAGGG - Intergenic
1090733153 11:129589140-129589162 CTTACTGTAGGAATTTTGGACGG + Intergenic
1090769988 11:129911477-129911499 GTTTGGAAAGGAAGTTGGGAGGG - Intronic
1090980487 11:131716306-131716328 CTTTCAACATGAATTTTGGAGGG + Intronic
1091200420 11:133776075-133776097 TTTTCTAAAGTAATGATGGAGGG + Intergenic
1091464508 12:671949-671971 GTTTTTAAAGATATTTTAGATGG + Intergenic
1091490174 12:926043-926065 GTTTCAACATGAAATTTGGAGGG - Intronic
1091738922 12:2946037-2946059 GTTTATAAAGCAAATTTAGATGG + Intergenic
1091747319 12:3000615-3000637 ATTTCAACATGAATTTTGGAGGG + Intronic
1091757422 12:3063389-3063411 GTTTCTCAAGGAATGTTTGCTGG - Intergenic
1092361389 12:7839659-7839681 GTTTCTGCATTAATTTTGGAGGG - Intronic
1092375833 12:7954923-7954945 GTTTCTGCATGAATTTTGGAGGG - Intergenic
1092495325 12:8987667-8987689 GTTACTGAAAGAAGTTTGGAGGG - Intronic
1093031017 12:14288478-14288500 GTTTCAACATGAATTTTGGGGGG + Intergenic
1093204768 12:16234293-16234315 ATTTCAACATGAATTTTGGAGGG + Intronic
1093412678 12:18885198-18885220 ATTTCAACAGGAGTTTTGGAGGG - Intergenic
1093567355 12:20623614-20623636 TTTACTAAAGGAATTTATGATGG + Intronic
1094172869 12:27512733-27512755 TTTTCTAAAGAAATTTCTGATGG + Intergenic
1094195150 12:27741366-27741388 TTTTCCTAAGGATTTTTGGATGG + Intronic
1094620770 12:32078385-32078407 GTTTCAACATGAATTTTGGAGGG + Intergenic
1094649303 12:32359640-32359662 GTATCAACATGAATTTTGGAGGG + Intronic
1095668288 12:44828417-44828439 GATTCGAAAGAAATTTTTGAAGG - Intronic
1096727488 12:53576375-53576397 GTTTCAACATGAATTTTGCAAGG - Intronic
1096835977 12:54351646-54351668 GTTTTTAAAGGCATTTTTGTGGG - Intronic
1097074727 12:56384422-56384444 GTTTTAACAGGATTTTTGGAGGG - Intergenic
1097449208 12:59714995-59715017 GCTTCAACATGAATTTTGGAGGG + Intronic
1097574112 12:61370001-61370023 ATTTCAACAGAAATTTTGGAGGG - Intergenic
1097590873 12:61573786-61573808 GTTTCAACATGAATTTTGGAGGG - Intergenic
1098217865 12:68238939-68238961 GTTTCAACATGAATCTTGGAGGG + Intergenic
1098346221 12:69506781-69506803 GTTTCAACATGAGTTTTGGAGGG - Intronic
1098414489 12:70217517-70217539 GTTTCAACATGAATTTTGGAGGG - Intergenic
1098611543 12:72464496-72464518 ATTTCAACATGAATTTTGGAGGG + Intronic
1098833123 12:75387835-75387857 GTTTCAACATGAATTTTGAAAGG + Intronic
1099013862 12:77323117-77323139 GTTTCTACATGAATTTTGGAAGG - Intergenic
1099432283 12:82602110-82602132 GTTTCAATATGAATTTTGGAGGG - Intergenic
1099539254 12:83885286-83885308 GTTTTAAAAGGAAGTTTCGAAGG - Intergenic
1099570134 12:84306600-84306622 CTTTCAAAATGAGTTTTGGAGGG + Intergenic
1099738209 12:86597787-86597809 CTTTTTAAAGGGATTGTGGATGG - Intronic
1099852954 12:88126694-88126716 GTTTATAAATGAGTTTTGAAAGG - Intronic
1099934091 12:89104985-89105007 GTTTCAACATAAATTTTGGAGGG + Intergenic
1099997173 12:89790960-89790982 GTTTCTAATGGAAGTGTGGGTGG + Intergenic
1100087124 12:90925188-90925210 GTATGTATAGGAATTATGGAAGG + Intronic
1100130360 12:91485098-91485120 GTTTCAACATGAATTTTGGAGGG + Intergenic
1100273276 12:93046639-93046661 CATTGTAAAGGCATTTTGGAGGG - Intergenic
1100596482 12:96076722-96076744 GTTTCAACATGAATTTTGGAGGG + Intergenic
1100794901 12:98171642-98171664 GTTTCAATATGACTTTTGGAGGG - Intergenic
1100994612 12:100290691-100290713 ATCTTTCAAGGAATTTTGGAAGG + Intronic
1101049153 12:100842884-100842906 GTTTCAACAAGACTTTTGGAGGG + Intronic
1101557619 12:105824939-105824961 GTTGCAACAGGAAATTTGGAGGG + Intergenic
1101769232 12:107733166-107733188 GATGCCAAAGGATTTTTGGAAGG - Exonic
1101919893 12:108923959-108923981 GTTTCAACATGAATTTTGGAGGG - Intronic
1102732666 12:115126603-115126625 GTTTCAACATGAGTTTTGGAGGG + Intergenic
1102879468 12:116473362-116473384 GTTTCAACATGAATTTTGGAGGG - Intergenic
1103857258 12:123981297-123981319 GTTTCAACATGAGTTTTGGAGGG - Intronic
1105064499 12:133184822-133184844 GTTTCAACATGAATTTTGGAGGG + Intronic
1105548089 13:21366303-21366325 GGTTCAACACGAATTTTGGAGGG - Intergenic
1105788115 13:23769766-23769788 GTTTCAACATGAGTTTTGGAAGG - Intronic
1105941847 13:25154637-25154659 GTTTCAACATGAGTTTTGGAGGG - Intergenic
1106194330 13:27480420-27480442 ATTTCAACATGAATTTTGGATGG - Intergenic
1106428001 13:29651658-29651680 GTTTCAACATGAATTTTGAAGGG + Intergenic
1106591223 13:31100436-31100458 GTTTTTAAAGGAAATAAGGAAGG - Intergenic
1107094666 13:36522552-36522574 ATTTCAATATGAATTTTGGAGGG + Intergenic
1107391112 13:39965184-39965206 ATTTCAACATGAATTTTGGAGGG + Intergenic
1107515248 13:41122721-41122743 GTTGTTAAAGGAGTTTTGAAAGG - Intergenic
1107697705 13:43016575-43016597 GTTTCAACACGAGTTTTGGAGGG + Intergenic
1108135131 13:47348402-47348424 GTTTCAACATGAATTTTGAAGGG + Intergenic
1108790137 13:53960320-53960342 ATTTCAACATGAATTTTGGAGGG - Intergenic
1108801258 13:54098335-54098357 GTTTCAATGTGAATTTTGGAGGG + Intergenic
1109586512 13:64411517-64411539 GTTCCAACAGGAGTTTTGGAGGG - Intergenic
1109602898 13:64656605-64656627 GTTTCAACTTGAATTTTGGAGGG - Intergenic
1109752859 13:66719304-66719326 GTTTCAACCTGAATTTTGGAGGG - Intronic
1109861299 13:68202011-68202033 GTTTCAACATGAATTTTGGAGGG + Intergenic
1109920308 13:69048848-69048870 ATTTCTAAATGAATATTGGTGGG - Intergenic
1109995012 13:70111610-70111632 ATTTCAACATGAATTTTGGAGGG + Intergenic
1110303429 13:73956515-73956537 ATTTCTGAAGGCATTTTTGATGG - Intronic
1110305410 13:73981671-73981693 GATTCAACACGAATTTTGGAGGG - Intronic
1110404215 13:75131168-75131190 GTTTCTAAAGCTATTTTTGAGGG + Intergenic
1110412083 13:75215511-75215533 ATCGCTAAAGGAATTTGGGAAGG - Intergenic
1110792589 13:79601872-79601894 GTTTCAACATGAATTTTGGGGGG - Intergenic
1110813200 13:79833564-79833586 GTTTCGAAAGTAATTAGGGAAGG - Intergenic
1111316072 13:86561783-86561805 GTTTCTCAATAACTTTTGGAAGG + Intergenic
1111628534 13:90819724-90819746 GTTTTAAAGTGAATTTTGGAAGG + Intergenic
1112248418 13:97755296-97755318 GTTTCAACATGAATTTTAGAGGG + Intergenic
1112262133 13:97886600-97886622 GTTTCAACATGAATTTTGGAGGG + Intergenic
1112462957 13:99619122-99619144 GTTTCAACATGAATTTTGGAGGG - Intronic
1112764235 13:102723862-102723884 ATTTCAACATGAATTTTGGAGGG - Intergenic
1112842993 13:103602573-103602595 TTTTCACAAGGAATTGTGGAAGG + Intergenic
1113296993 13:108969983-108970005 GTTTCTAATGTAATATTGAAAGG + Intronic
1115870449 14:37795172-37795194 CTTTCTACAGAAATTTTGCAGGG - Intronic
1115979615 14:39035920-39035942 TTTTCAAAATGAGTTTTGGAAGG - Intronic
1116223915 14:42123342-42123364 ATTTCAACATGAATTTTGGAGGG + Intergenic
1116756815 14:48958434-48958456 GTTTCAACATGAATTTTGGAGGG - Intergenic
1116809303 14:49524027-49524049 GTTTCAATGTGAATTTTGGAAGG - Intergenic
1116981833 14:51179454-51179476 GTTTCAATATTAATTTTGGAGGG + Intergenic
1117249214 14:53918539-53918561 ATTTCAACATGAATTTTGGAGGG + Intergenic
1117281541 14:54246165-54246187 ATTTCCATAAGAATTTTGGAGGG + Intergenic
1117447014 14:55813760-55813782 GTTTCAGCATGAATTTTGGAGGG - Intergenic
1117514291 14:56485185-56485207 GTTTCAATATCAATTTTGGAGGG - Intergenic
1117518423 14:56525915-56525937 GTTTGAATATGAATTTTGGAGGG - Intronic
1117865500 14:60144344-60144366 GTTTCGACATGAATTTTGGAGGG - Exonic
1117896354 14:60491418-60491440 GTTTCAACATGAATTGTGGAGGG + Intronic
1117899475 14:60516980-60517002 GTTTCAACATGAATTTTGGAGGG - Intergenic
1118140719 14:63079185-63079207 GATTCTAAATGAATTTAGCAAGG + Intronic
1118595879 14:67435431-67435453 GTTTCAACATGAATTTTGGAGGG + Intergenic
1118815586 14:69311419-69311441 GTTTCAACAGGAATTTTGGAGGG + Intronic
1119238333 14:73038414-73038436 GTTTCAACATGAATTTTCGAGGG - Intergenic
1119298320 14:73551255-73551277 GTTTTTAAAGGGATCATGGAGGG - Intronic
1119302616 14:73583442-73583464 GTTTTTAAAGGGATCATGGAGGG - Intergenic
1119558057 14:75568463-75568485 GTTTCTAAAGGCACTTGGGGCGG + Intergenic
1119789032 14:77332555-77332577 GTTTCAACATGAATTTTAGAGGG + Intergenic
1120178315 14:81318275-81318297 CTGTCTAATGGAATTTTGAAGGG - Intronic
1120239065 14:81928447-81928469 CTTTATAATGGAATTTTGAAAGG + Intergenic
1121182176 14:91937459-91937481 GTTTCAATATGAGTTTTGGAGGG - Intronic
1121288721 14:92757134-92757156 ATTTCAACATGAATTTTGGAGGG + Intergenic
1121811920 14:96898918-96898940 GTTTCAACATGAATTTTGGAGGG + Intronic
1121920524 14:97876678-97876700 GTGTCTGAAGGGAATTTGGAGGG + Intergenic
1121954693 14:98203270-98203292 GTTTCAACATGAGTTTTGGAGGG + Intergenic
1121967150 14:98320943-98320965 GTTTCAACATGAGTTTTGGAGGG + Intergenic
1122038887 14:98968102-98968124 GTTGCAACAAGAATTTTGGAAGG - Intergenic
1122776886 14:104121123-104121145 GTTTCAACATGAATTTTGGAGGG + Intergenic
1123049870 14:105536016-105536038 ATTTCCATATGAATTTTGGAGGG + Intergenic
1123964695 15:25443381-25443403 GTTTCAACATGAATTTTGAAGGG - Intergenic
1124099304 15:26678656-26678678 GATTCTAAAGGAAATATGGATGG + Intronic
1124888985 15:33713950-33713972 ATTTCAACATGAATTTTGGAGGG + Intronic
1125132502 15:36300144-36300166 CTTACTAAAGAAATCTTGGAAGG + Intergenic
1125268148 15:37908053-37908075 GTTTCAACATGAATTGTGGAGGG + Intergenic
1125548607 15:40527519-40527541 GTTTCAACAAGAGTTTTGGAGGG - Intergenic
1125765343 15:42131831-42131853 CTTTCAACATGAATTTTGGAGGG + Intergenic
1125776829 15:42223453-42223475 GTTTCAACATGAGTTTTGGAGGG - Intronic
1126209329 15:46082010-46082032 GTTTCTAAAGGAATCTCAAAAGG + Intergenic
1126597915 15:50400156-50400178 GTTTCAACATAAATTTTGGAAGG - Intergenic
1126701535 15:51372289-51372311 GTTTCAACATGAGTTTTGGAAGG + Intronic
1127230067 15:56981538-56981560 GTTTCAACATGAGTTTTGGAGGG + Intronic
1127506552 15:59603587-59603609 ATTTTTAAAGGTATTTTGGTGGG - Intronic
1127522219 15:59754332-59754354 GTTTCAACATGAGTTTTGGAGGG + Intergenic
1128686707 15:69691672-69691694 ATTTCAACATGAATTTTGGAGGG + Intergenic
1128713475 15:69889514-69889536 ATTTCGACATGAATTTTGGAGGG - Intergenic
1128787512 15:70408974-70408996 CTTTCTAAAGAAATTTAGCATGG - Intergenic
1128902499 15:71437313-71437335 GTTTCCAAATGCAATTTGGAGGG + Intronic
1129095231 15:73199997-73200019 GTTTCAGCATGAATTTTGGAGGG + Intronic
1129592217 15:76926883-76926905 GTTTCAATGTGAATTTTGGAGGG - Intergenic
1130741586 15:86606285-86606307 GTTTCTAAGGAGATTGTGGAAGG - Intronic
1131351377 15:91703339-91703361 GTTTCTACAGGAAACTTGAATGG + Intergenic
1131379063 15:91948865-91948887 GTTATTAAAGGAATTGAGGATGG - Intronic
1131740833 15:95389613-95389635 GTTTCAACATGAATTTTGGGGGG - Intergenic
1131843253 15:96460995-96461017 ATTTCAACATGAATTTTGGAGGG + Intergenic
1131977719 15:97961839-97961861 GTCTCTAAAGGCATTTTGAGTGG - Intronic
1132252747 15:100346497-100346519 GTTTCACCATGAATTTTGGAGGG - Intergenic
1132324967 15:100961326-100961348 GTTTCAACATGAATTTTGGAGGG + Intronic
1133439213 16:5806537-5806559 CTTTCAACAGGAATTTTGGAGGG + Intergenic
1133809439 16:9149676-9149698 ATTTCAACATGAATTTTGGAGGG + Intergenic
1134067723 16:11239945-11239967 GTTTCAACATGAGTTTTGGAGGG + Intergenic
1134361786 16:13537636-13537658 GTTTACAAAGGAATTTTTGGCGG + Intergenic
1136563575 16:31055986-31056008 GTTTCTAAGGGGACTGTGGAGGG + Intergenic
1138038542 16:53634299-53634321 GTTTCAACATAAATTTTGGAGGG + Intronic
1138323690 16:56142273-56142295 ATTTCAACAGGAGTTTTGGAGGG + Intergenic
1138331693 16:56220620-56220642 GTTTCTACATGAATTTTGTAGGG - Intronic
1138859010 16:60732476-60732498 GATTCTAAAGGAATTTTTAAGGG - Intergenic
1138918588 16:61498907-61498929 GTTTCAACATGAATTTTGCAGGG + Intergenic
1139615815 16:68090302-68090324 GTTTTTAAAGAAATGTTGGGGGG - Intronic
1139666787 16:68462950-68462972 GTTTCAACATGAATTTTGGAGGG - Intergenic
1140653152 16:77110419-77110441 GTTTCTAATGAAATAATGGAGGG + Intergenic
1141277315 16:82600422-82600444 GTTTCAACGTGAATTTTGGAGGG - Intergenic
1143756512 17:9071825-9071847 GTGTCTTTAGGAATTCTGGAGGG - Intronic
1145756601 17:27396370-27396392 GTTTTAACATGAATTTTGGAGGG - Intergenic
1146190250 17:30759110-30759132 CTTTAAAAAGGAATTTTGGAGGG - Intergenic
1146324182 17:31871449-31871471 GTTTATAAAGAATTTTTGGCTGG + Intronic
1146335419 17:31965763-31965785 CTTTAAAAAGGAATTTTGGAGGG - Intronic
1146549116 17:33764778-33764800 GTTTCTACATGAACTTTGGAGGG + Intronic
1146928137 17:36759026-36759048 GTTTCAACATGAATTCTGGAGGG - Intergenic
1148220774 17:45860261-45860283 GTCTCTAAGGGGATTGTGGAGGG + Intergenic
1148654327 17:49271971-49271993 GTTACAACATGAATTTTGGAGGG + Intergenic
1148665802 17:49373798-49373820 GATTCTAAAGGAATAGGGGAGGG - Intronic
1148891335 17:50809541-50809563 GTTTCAACATGAATTTTGGAGGG - Intergenic
1149249395 17:54750572-54750594 GTTTGAACATGAATTTTGGAGGG - Intergenic
1149816118 17:59725376-59725398 GTTTTCAAGGGAATTTTGAAAGG + Intronic
1150159262 17:62881155-62881177 ATTTCAAAATGAATTTTGAAGGG + Intergenic
1150162513 17:62910627-62910649 GTTTCAACATGAAATTTGGAGGG + Intergenic
1150453901 17:65291904-65291926 GTTTCTCTAGGAATTGGGGAGGG - Intergenic
1150660655 17:67073614-67073636 GTTTCTAAAAATTTTTTGGAGGG - Exonic
1150725636 17:67649303-67649325 ATTTCTAAAGGAGTTTTTGAAGG + Intronic
1150954610 17:69843413-69843435 ATTTCAACATGAATTTTGGAGGG + Intergenic
1151515060 17:74588338-74588360 GTTTCAACACGAGTTTTGGAGGG + Intronic
1152346497 17:79755606-79755628 GTTTCAACGTGAATTTTGGAGGG + Intergenic
1152411011 17:80123142-80123164 GTTTCAACAGGAATTTGGGGCGG + Intergenic
1152835446 17:82527330-82527352 GCTTTTAAAGAAATTTTGGCTGG + Intronic
1153126277 18:1795751-1795773 GTTTCAACATGAATTTTGAAGGG + Intergenic
1153166788 18:2270807-2270829 ATTTCAACATGAATTTTGGAGGG - Intergenic
1153519773 18:5940697-5940719 GTGTCAACATGAATTTTGGAGGG - Intergenic
1153557404 18:6329869-6329891 GTTTCGACAGGAGTTTTGGAGGG + Intronic
1153638974 18:7138674-7138696 ATTTCAACATGAATTTTGGAGGG - Intergenic
1153674836 18:7447627-7447649 GTTTCAACATGAATTTTGGAGGG + Intergenic
1153850396 18:9088798-9088820 GTTTCAAGATGAATTTTGGAAGG + Intergenic
1154183493 18:12158494-12158516 ATTTCTAAAGCAATTTTGTAGGG - Intergenic
1154266921 18:12886560-12886582 GTTTCAACGTGAATTTTGGAGGG - Intronic
1156010219 18:32488659-32488681 ATTTGTAAAGGAAATTTGTAAGG - Intergenic
1156139612 18:34090947-34090969 GTTTCAATATCAATTTTGGATGG - Intronic
1156167304 18:34437840-34437862 GTTTCTAAATGAATGTTACATGG - Intergenic
1157436914 18:47678033-47678055 GTTTCAACATGAATTTTGGAGGG + Intergenic
1157532379 18:48432287-48432309 GTTTCAACATGAGTTTTGGAGGG - Intergenic
1157632286 18:49110458-49110480 GTTTTTAAAGACATTTTTGAGGG + Intronic
1157636590 18:49162598-49162620 GTTTCAACATGAGTTTTGGATGG + Intronic
1157688950 18:49665156-49665178 GTTTCAACATGAGTTTTGGAGGG - Intergenic
1158044949 18:53145014-53145036 GTTTCAACATGAATTTTAGAGGG - Intronic
1158094746 18:53757927-53757949 GTTTTAACATGAATTTTGGAAGG + Intergenic
1158328814 18:56339092-56339114 GTTCCTGAAGGATTGTTGGATGG + Intergenic
1158861657 18:61598449-61598471 GTTTCAAAATGAGATTTGGAGGG - Intergenic
1158872632 18:61703147-61703169 GTTTTTAAGGGGATTCTGGAGGG - Intergenic
1159071919 18:63633671-63633693 ATTTTTAAAGAAATTTTGGTAGG - Intergenic
1159232865 18:65631686-65631708 CTTCCTAACGGAATTTTGGTGGG - Intergenic
1159368834 18:67505686-67505708 TTTTTTGAAGGAATTTTGAATGG - Intergenic
1159536288 18:69719196-69719218 GTTTTTAAAGAAAATTTGGAGGG + Intronic
1159571552 18:70119981-70120003 ATTTCAACATGAATTTTGGAGGG - Intronic
1160178281 18:76613347-76613369 GTTTCAACATGAGTTTTGGAGGG + Intergenic
1160669364 19:349812-349834 GTTTCAACATGAATTTTGGAAGG + Intergenic
1161564073 19:4989975-4989997 GTTTCTAAAGGAAATTAACAAGG - Intronic
1162611766 19:11760862-11760884 GTTTCAACAAGCATTTTGGAGGG - Intergenic
1162835466 19:13314345-13314367 GTTTCAACGTGAATTTTGGAGGG - Intronic
1164528708 19:29030711-29030733 GTTTCAACATGAATTTTGGAGGG - Intergenic
1167754695 19:51404871-51404893 GTTTCAACATGAATTTTGGAGGG + Intergenic
1168019615 19:53599680-53599702 GTTTTTAAAGTTATTTTGGCTGG + Exonic
925503983 2:4539886-4539908 GTTCCAAAAAGAATTCTGGAAGG - Intergenic
925604151 2:5641152-5641174 GTTTCAACATGAATTTTGGAGGG - Intergenic
925622820 2:5810392-5810414 GTTTCATCATGAATTTTGGAGGG + Intergenic
925675548 2:6357769-6357791 GTTTCTATGTGCATTTTGGAGGG - Intergenic
925677718 2:6383185-6383207 GTGTCTACAGGAATTCTGAATGG - Intergenic
925712250 2:6752833-6752855 GTTTCAATAGGAACTTTGGAGGG - Intergenic
926637224 2:15195158-15195180 ATTTCAACATGAATTTTGGAAGG - Intronic
926819369 2:16835652-16835674 GTTTCAACATAAATTTTGGAGGG - Intergenic
926962151 2:18369375-18369397 TTTTTTAAAAGAATTTTGGAAGG + Intergenic
927057073 2:19375201-19375223 GTTTCAACATAAATTTTGGAGGG + Intergenic
927119010 2:19936564-19936586 GTTTTAACATGAATTTTGGAGGG - Intronic
927326935 2:21815875-21815897 GTTTCAATATGAATTTTGCAGGG - Intergenic
927431879 2:23033384-23033406 GTTTCAAAGTGAATTTTGGAAGG + Intergenic
928332884 2:30371094-30371116 GTTTCTAAAGAAAGTTGGGATGG - Intergenic
928745693 2:34411790-34411812 TTTGCTTAAGGAATTTTAGAAGG + Intergenic
928769624 2:34691136-34691158 GTTTCAACATGAGTTTTGGAGGG + Intergenic
928844151 2:35648872-35648894 GTTTCAACATAAATTTTGGAGGG + Intergenic
929018898 2:37530821-37530843 GTTTCAGCATGAATTTTGGAGGG - Intergenic
929139583 2:38655218-38655240 GTTTCAACATGAATTTTAGAGGG + Intergenic
929166553 2:38887628-38887650 GTTTAAACATGAATTTTGGAAGG - Intronic
929183047 2:39064359-39064381 GTTTCAACATGAATTTGGGAGGG + Intronic
929901346 2:46006266-46006288 GTTATTAAATGAATTTTGGAAGG - Intronic
929942091 2:46342000-46342022 GTTTTTAAAGGAAGGATGGATGG - Intronic
930239671 2:48923026-48923048 GTTTCAACGTGAATTTTGGAGGG + Intergenic
930559478 2:52943019-52943041 GTTTCAACATGAATTTTGGAGGG - Intergenic
931580120 2:63762846-63762868 GTTTCAACATGAATTTTGGAGGG + Intronic
932084469 2:68746066-68746088 GTTTCAACATGAATTTTGGAGGG + Intronic
932170070 2:69546684-69546706 GTTTTAACATGAATTTTGGAGGG - Intronic
932364542 2:71140551-71140573 GTTTCCACATGAGTTTTGGAGGG + Intronic
932455738 2:71848795-71848817 ATTTCAACAGGAAGTTTGGAGGG + Intergenic
932545848 2:72708600-72708622 TAGTATAAAGGAATTTTGGAAGG + Intronic
932675890 2:73780743-73780765 GTTTCTACATTATTTTTGGAGGG - Intergenic
933558219 2:83858408-83858430 ATTTCAAAATGAATTTAGGAGGG - Intergenic
935153614 2:100462321-100462343 GTTTCAACATGAATTTTGGAGGG + Intergenic
935277003 2:101483783-101483805 GTTCCAACATGAATTTTGGAGGG - Intergenic
935825848 2:106948424-106948446 GTGTCAACATGAATTTTGGACGG + Intergenic
935974634 2:108565981-108566003 GTTTCAACATGAATTTTGGAGGG + Intronic
937006794 2:118524012-118524034 GTTTCAACATGAATTTTGCAGGG - Intergenic
937401014 2:121583751-121583773 GTTTCAACATAAATTTTGGAGGG - Intronic
937617390 2:123941852-123941874 GTTTCTTAAGGTATATTTGAAGG + Intergenic
938179433 2:129166754-129166776 CTTTCAACAGGAACTTTGGAGGG - Intergenic
938564580 2:132507143-132507165 ATTTCAACATGAATTTTGGAGGG + Intronic
938706340 2:133930886-133930908 GTTTCAACATGAATTTTGGAGGG + Intergenic
938786328 2:134633097-134633119 GTTTCAACATGAATTTTGGAGGG + Intronic
939188323 2:138886303-138886325 GTTTCAACATAAATTTTGGAAGG - Intergenic
940075997 2:149742951-149742973 GTTTCAACACGAATTTTGAAGGG + Intergenic
940181265 2:150936067-150936089 GTGCCTAAAGGAATTCTGGAAGG + Intergenic
940218559 2:151326370-151326392 ATTTCTACATGAGTTTTGGAGGG + Intergenic
940752597 2:157643694-157643716 GATTTTAAAGTAATTTTGCATGG - Intergenic
940941973 2:159571979-159572001 GTTTCAACATGATTTTTGGAAGG + Intronic
940982609 2:160020461-160020483 GTTTCAACCTGAATTTTGGAGGG - Intronic
941055921 2:160788060-160788082 GTTTCAACATAAATTTTGGAGGG - Intergenic
941092808 2:161197841-161197863 GTTTCAACATGAATTTTGGTGGG + Intronic
941426869 2:165357895-165357917 GTTTCTAAATGACTTTTGACTGG + Intronic
941529549 2:166649993-166650015 GTTTCAACATGAATTTTGGAGGG - Intergenic
941590494 2:167415112-167415134 GTTTCAACATGAGTTTTGGAGGG - Intergenic
942151517 2:173080651-173080673 GTTTCAACATGAATTTTGGTGGG + Intronic
942180915 2:173379702-173379724 GTTTCAACATGAGTTTTGGAGGG + Intergenic
942226885 2:173824204-173824226 GTTTCAACAGGAATTTTGGAGGG - Intergenic
942709136 2:178812931-178812953 ATTTCAACATGAATTTTGGAAGG - Intronic
942870953 2:180733351-180733373 GTTTCAACATGAATTTTAGAGGG - Intergenic
943275060 2:185855872-185855894 GTTTCACCATGAATTTTGGAAGG + Intergenic
943322691 2:186465263-186465285 ATTTCAACATGAATTTTGGAGGG - Intergenic
943356910 2:186867504-186867526 GTTTCAACATGAATTTTGGAGGG + Intergenic
943395130 2:187324223-187324245 GTTTCAACATGATTTTTGGAGGG + Intergenic
943547989 2:189305299-189305321 GTTTCAACATAAATTTTGGAGGG - Intergenic
943610115 2:190022189-190022211 ATTTCAACATGAATTTTGGAGGG + Intronic
943644852 2:190399221-190399243 GTTTCAACATGAATTTTAGAAGG + Intergenic
943868402 2:192959099-192959121 GTTTATATATGAATTTTTGAAGG - Intergenic
944167046 2:196734337-196734359 GTTTCAACATGAATTTTGGAGGG - Intronic
944225008 2:197341006-197341028 GTTTCAACATGGATTTTGGAGGG - Intergenic
944299719 2:198109392-198109414 GTTCCAACATGAATTTTGGAAGG + Intronic
944309975 2:198222797-198222819 GTTCCTAAATCAATTTTTGAAGG - Intronic
944425136 2:199573428-199573450 AATGCTAAAGTAATTTTGGAGGG + Intergenic
944660248 2:201915837-201915859 GTTTCAACATGAGTTTTGGAGGG + Intergenic
944978022 2:205079623-205079645 GTTTCAACATGAATTTTGGAGGG + Intronic
945124461 2:206492802-206492824 ATTTCCACATGAATTTTGGAGGG + Intronic
945511614 2:210709850-210709872 ATTTCAAAATGAGTTTTGGAGGG + Intergenic
945515304 2:210756685-210756707 GCTTCTGAAGTTATTTTGGAAGG + Intergenic
946380239 2:219343026-219343048 ATTTCAACATGAATTTTGGAGGG + Intergenic
946535419 2:220622419-220622441 GTTTCAACAAAAATTTTGGAGGG + Intergenic
946765582 2:223037103-223037125 GTTTTTAAAGATAATTTGGAGGG + Intergenic
947368687 2:229423115-229423137 GGTTCTACTGGAATTTAGGAGGG + Intronic
947495057 2:230629202-230629224 GTTTCAACAGGAATTTTGGAGGG - Intergenic
948215921 2:236231304-236231326 GTTTCAACATGAATTTTGGAGGG - Intronic
948827739 2:240581399-240581421 ATTTCAACATGAATTTTGGAGGG - Intergenic
1168920905 20:1535356-1535378 ATTTCAACATGAATTTTGGAGGG - Intronic
1169241157 20:3982239-3982261 GTTTCAAGAGGAGTTTGGGAGGG - Intronic
1169500097 20:6151216-6151238 GTTTCAACATGAAGTTTGGAGGG + Intergenic
1169621759 20:7514957-7514979 CTTTCTAAAGGATTTTGTGAGGG + Intergenic
1169696389 20:8392087-8392109 GTTTCAACATGAATATTGGAGGG - Intronic
1169718793 20:8649488-8649510 GTTTCAACATGAGTTTTGGAGGG - Intronic
1169866563 20:10206769-10206791 GATTCTATATGAATTTTAGAGGG + Intergenic
1169929017 20:10812045-10812067 GCTTGTAAAAGAATTTTGGCAGG - Intergenic
1170110539 20:12799613-12799635 GTTTTAACATGAATTTTGGAGGG + Intergenic
1170126023 20:12965167-12965189 ATTTCAACAGGAGTTTTGGAGGG + Intergenic
1170297338 20:14842323-14842345 ATTTCAACATGAATTTTGGAGGG + Intronic
1170610383 20:17907900-17907922 ATTTCAACAGGAATTTTGGAGGG + Intergenic
1170637562 20:18121724-18121746 GTTTCAACATGAATTTGGGAAGG - Intergenic
1171054802 20:21895848-21895870 GTTTCAACATGAAATTTGGAGGG + Intergenic
1171145535 20:22778137-22778159 GTTTCAACATGAATTTTGGAGGG + Intergenic
1171723122 20:28585822-28585844 GTTTATAAAGAAATTTTAGGAGG + Intergenic
1171787730 20:29485259-29485281 GTTTATAAAGAAATTTTAGGAGG + Intergenic
1171860229 20:30394114-30394136 GTTTATAAAGAAATTTTAGGAGG - Intronic
1171950892 20:31420695-31420717 GTTTCAACATGAATTTTGGAGGG + Intergenic
1173131618 20:40399374-40399396 GTTTCTTAAAGAGATTTGGAGGG + Intergenic
1173378307 20:42510884-42510906 GTTTCAACATGAGTTTTGGAGGG - Intronic
1173594516 20:44249952-44249974 TCTTCTAAAGGAATTCTGCAGGG - Intronic
1173755157 20:45509162-45509184 CTCTCCCAAGGAATTTTGGAAGG + Intergenic
1173937905 20:46883630-46883652 GTTTCAACATGAGTTTTGGAGGG + Intergenic
1174181059 20:48675088-48675110 ATTTCAACAAGAATTTTGGAAGG - Intronic
1174236367 20:49096206-49096228 GTTTCTGGAGAATTTTTGGATGG + Intronic
1174549494 20:51351718-51351740 GTTTCTGAAGCAATTATTGATGG - Intergenic
1174722363 20:52826598-52826620 GTTTCAATAAGAATTCTGGAGGG + Intergenic
1174919505 20:54686676-54686698 GTTTCAACATGAGTTTTGGAGGG - Intergenic
1175081991 20:56428445-56428467 GTTTGCAAAGGAAATCTGGATGG + Intronic
1175408278 20:58749379-58749401 GCTCTTAAAGCAATTTTGGATGG - Intergenic
1175548493 20:59798348-59798370 GTTTCAACATGAATTTTGGAAGG + Intronic
1176887069 21:14269822-14269844 ATTTCAACATGAATTTTGGAGGG - Intergenic
1177218183 21:18156156-18156178 TTTTCTGAAGAAATTTTGCACGG + Intronic
1177376381 21:20275372-20275394 ATTTCAACATGAATTTTGGAGGG + Intergenic
1178241315 21:30904148-30904170 GTTTTTAAAGATATTTTGGCGGG - Intergenic
1178447289 21:32657850-32657872 GTTTTTAGAGGATTTTTAGAAGG - Exonic
1178760066 21:35393759-35393781 GTTTCAACAGGAGTTTTGGAGGG - Intronic
1178780210 21:35595730-35595752 CTTTTAAAAGGAATTTTGGGGGG - Intronic
1179076548 21:38127772-38127794 GTTTCAACATGAAATTTGGAGGG - Intronic
1179083476 21:38195371-38195393 TTTTCTACATGAATATTGGAGGG + Intronic
1179138488 21:38701151-38701173 GTTTCAGCAAGAATTTTGGAGGG + Intergenic
1179196026 21:39163201-39163223 GTTTCGACATGAGTTTTGGAGGG + Intergenic
1179278374 21:39912438-39912460 GTTTGTAAAAGCTTTTTGGATGG + Intronic
1180172447 21:46066867-46066889 GTTTCTAAAGGGCTCCTGGATGG - Intergenic
1180210308 21:46291991-46292013 GTTTCTACAGGCAATTTGGCAGG + Intronic
1180296680 22:10944494-10944516 GTTTATAAAGAAATTTTAGGAGG + Intergenic
1180589494 22:16924296-16924318 GTTTCAACAGGAACTTTGGAGGG + Intergenic
1181175070 22:21030651-21030673 GTTTCTTCAGAAACTTTGGAAGG - Intronic
1181307718 22:21926541-21926563 GTTTCTAGAGGACTTGTGGGTGG - Intronic
1182908597 22:33960175-33960197 GTCTCAACATGAATTTTGGAGGG - Intergenic
1182939167 22:34258027-34258049 GTTTCAACATGAGTTTTGGAAGG - Intergenic
1183972965 22:41492338-41492360 ATTTATAAAGGAATTTAGGCCGG + Intronic
1184319123 22:43725568-43725590 GTTTCAACATGAGTTTTGGAGGG + Intronic
1184346326 22:43915767-43915789 GTTTCCACATGAGTTTTGGAGGG - Intergenic
1184435487 22:44472218-44472240 GTTTCAACACGAATTTTGGAGGG - Intergenic
1185356886 22:50378621-50378643 GTTTCAATATGAATTCTGGAGGG - Intronic
949260003 3:2095061-2095083 GTTTATAAAGGAATCTTGGCTGG + Intergenic
949338187 3:2999779-2999801 GTTTCAACATGAATTTTGGAAGG + Intronic
949527056 3:4915345-4915367 GTTTTAACATGAATTTTGGAGGG + Intergenic
949578658 3:5364208-5364230 GTTTCAACATGAATTTTGGAGGG - Intergenic
949707431 3:6835055-6835077 GTTTCAACAGGAGTTTTGAAGGG + Intronic
949740143 3:7223001-7223023 GTTACTAAACTAATGTTGGAGGG + Intronic
949901685 3:8820218-8820240 ATTTCAACATGAATTTTGGAGGG + Intronic
949904199 3:8844817-8844839 GTTTTAACATGAATTTTGGAGGG - Intronic
951264985 3:20554210-20554232 CCTTCAAAAGGTATTTTGGATGG - Intergenic
952105856 3:30068463-30068485 GTTTCAACATGAATTTTGGAAGG + Intergenic
952154743 3:30630639-30630661 GTTTCAACATAAATTTTGGAGGG - Intronic
952467262 3:33602649-33602671 GTTTCTAAGGGGGTTTGGGAAGG - Intronic
952643867 3:35632231-35632253 GTTTATAAAGGTCTTTTTGAGGG - Intergenic
952702890 3:36344419-36344441 GTTTCAATATGAATTTTGGAGGG - Intergenic
952766732 3:36960854-36960876 TTTTCAATATGAATTTTGGAGGG - Intergenic
953188168 3:40657651-40657673 GTTACTAAAGGAATTCTGGAAGG - Intergenic
953437941 3:42894590-42894612 GTTTCAACATGAATTTTGGAAGG + Intronic
953506894 3:43494838-43494860 ATTTGTATATGAATTTTGGAAGG - Intronic
954717810 3:52535009-52535031 GTTTCTACAGGAGGTTTTGACGG - Intronic
955104289 3:55882030-55882052 ATTTCAATAGGAGTTTTGGAGGG - Intronic
955319216 3:57962200-57962222 GTTGCAACATGAATTTTGGAGGG - Intergenic
955653486 3:61219777-61219799 GTTTGTAAAGATTTTTTGGAGGG - Intronic
955859119 3:63308557-63308579 TTTTCTAAAGAAATTTTTGTTGG + Intronic
955951557 3:64247727-64247749 ATTGCTAAAGAAATTTTGGCAGG - Intronic
956236480 3:67077907-67077929 GTTTCAATATGAATTTTGGAAGG - Intergenic
956564949 3:70625843-70625865 GTTTCAACATGAATTTTGGAGGG - Intergenic
957143185 3:76387256-76387278 GTTTCAGCATGAATTTTGGAGGG + Intronic
957540589 3:81564009-81564031 ATTTCTACAGGAATTTTAGAGGG - Intronic
957806894 3:85159369-85159391 GATTTTAAGGGAATTGTGGAAGG + Intronic
957997633 3:87710526-87710548 GTTTCAACATGAGTTTTGGAGGG - Intergenic
958513194 3:95075742-95075764 GTTTCAATATGAACTTTGGAGGG + Intergenic
958628342 3:96655591-96655613 GTTTCTAAAGATAATTTGGTGGG - Intergenic
958653357 3:96967818-96967840 GTTCTTGAAGGAACTTTGGAAGG + Intronic
959151761 3:102616516-102616538 GTTTCAAAACAAATTTTGGGAGG + Intergenic
959154751 3:102653338-102653360 GTTTCAAAATGAATTTTGGAGGG - Intergenic
959214383 3:103431929-103431951 GTTACAACATGAATTTTGGAGGG + Intergenic
959287550 3:104435607-104435629 ATTTCAACATGAATTTTGGAGGG + Intergenic
959450596 3:106494488-106494510 GTTTCAACATGAATTTTGGAGGG + Intergenic
959460953 3:106624720-106624742 GTTTCAAAATGAGTTTTGGGGGG + Intergenic
959604832 3:108231089-108231111 ATTTCAAAATGACTTTTGGAGGG - Intergenic
959873351 3:111353339-111353361 ATTTCAACATGAATTTTGGAGGG - Intronic
959892851 3:111575915-111575937 GTTTCAATATGAGTTTTGGAAGG + Intronic
959977718 3:112480750-112480772 ATTTCAACATGAATTTTGGAGGG + Intronic
960017610 3:112910203-112910225 GTTTCAACAAGAATTTTGGAGGG + Intergenic
960037344 3:113115124-113115146 ATTTCTAAAAGTTTTTTGGATGG - Intergenic
960281964 3:115790366-115790388 TTTTCGAAAGGACTTTGGGAAGG + Intergenic
960292568 3:115903911-115903933 TTTTTCAAAAGAATTTTGGAGGG - Intronic
960392111 3:117090186-117090208 GTTTCAAAATGAATTTTGGAGGG + Intronic
960408425 3:117291272-117291294 GTTACTAAAAGAATTGTGGTAGG - Intergenic
960690405 3:120341519-120341541 GTTTCAACATGAATTTTGGGAGG - Intronic
960697724 3:120412263-120412285 GTATCAACATGAATTTTGGAGGG - Intronic
962003661 3:131326808-131326830 GTTTCCATATGAATTTTGAAGGG - Intronic
962099052 3:132322746-132322768 GTTTCAACATGAGTTTTGGAGGG - Intronic
962301281 3:134245345-134245367 CATTTTAGAGGAATTTTGGAAGG - Intronic
962705317 3:138037817-138037839 GTTTCAACATGAGTTTTGGAGGG + Intergenic
962940829 3:140123353-140123375 GTTTCAACATGAATTTTGGAGGG + Intronic
962970139 3:140393136-140393158 ATTTCAACATGAATTTTGGAGGG + Intronic
963146935 3:142003538-142003560 GCTTCAACATGAATTTTGGAGGG + Intronic
963986776 3:151605335-151605357 GTTTCTTAAGGAGTTTTAGAAGG + Intergenic
964130240 3:153278876-153278898 GTTTCAACAAGAACTTTGGAAGG + Intergenic
964176818 3:153833757-153833779 GTTTCAACATGAGTTTTGGAAGG - Intergenic
964223682 3:154372585-154372607 GTTTCAACATGAATTTTGAAGGG + Intronic
964253422 3:154747078-154747100 GTTTCAACATGAGTTTTGGAGGG + Intergenic
964298319 3:155258872-155258894 TTTTCTAAAATTATTTTGGATGG + Intergenic
964593829 3:158398579-158398601 GTTTCAAAATGAATTTTGAAGGG + Intronic
964623153 3:158734935-158734957 GTTTCAACATGAATTTTGGAGGG + Intronic
964663246 3:159144117-159144139 GTTTCAACATGAATTGTGGAGGG + Intronic
965107991 3:164383168-164383190 TTTTCTAAATGAGTCTTGGACGG - Intergenic
965313150 3:167156918-167156940 ATTTCAAAATGAGTTTTGGAGGG - Intergenic
965649169 3:170915763-170915785 GTTTCAACATGAGTTTTGGAGGG - Intergenic
965961183 3:174430345-174430367 GTCACTAAAGGGATTTTGGAAGG + Intergenic
966024621 3:175260737-175260759 GTTTAAAAATGAATTTGGGAGGG + Intronic
966170654 3:177076261-177076283 GTTTCAACATAAATTTTGGAGGG + Intronic
966358255 3:179105170-179105192 GTTTTTAAACGAATTATGAATGG + Intergenic
967169984 3:186815558-186815580 GTTTCAACATGAGTTTTGGAGGG - Intergenic
967260712 3:187639072-187639094 GTTTCAACATTAATTTTGGAGGG + Intergenic
967403504 3:189089821-189089843 GTTTCAACATGAGTTTTGGAGGG + Intronic
967689920 3:192462235-192462257 GTTTCAACATGAGTTTTGGAGGG - Intronic
968439456 4:615292-615314 ATTTCAACAGGACTTTTGGAGGG - Intergenic
968855665 4:3119711-3119733 GTTGCTAACAGAATTTAGGAGGG + Intronic
969205349 4:5639986-5640008 TTTGCTAAATGAATTCTGGATGG + Intronic
969719226 4:8883933-8883955 GTTTCAACATGAATTTGGGAGGG - Intergenic
970026410 4:11628857-11628879 GTCCCAAAAGGGATTTTGGATGG - Intergenic
970147062 4:13047076-13047098 ATTTCAACATGAATTTTGGAGGG - Intergenic
970434304 4:16018601-16018623 GTGTCTAAAGGGACTTGGGATGG + Intronic
970693560 4:18647575-18647597 GTTTCAACATGAATTTTGGCGGG - Intergenic
970700034 4:18725548-18725570 GTTTCAACATAAATTTTGGAGGG - Intergenic
971179342 4:24314258-24314280 ATTTCAACATGAATTTTGGAGGG - Intergenic
971361974 4:25946503-25946525 GTTCCAACATGAATTTTGGATGG + Intergenic
971827986 4:31652237-31652259 GTTCCAACATGAATTTTGGAGGG + Intergenic
971897193 4:32612665-32612687 GTTTCAACATGAGTTTTGGAGGG + Intergenic
971934007 4:33123486-33123508 GTGTCAACATGAATTTTGGAGGG + Intergenic
971996097 4:33966653-33966675 ATTTTTAAAAGAATTTTGGCTGG - Intergenic
973766502 4:54167950-54167972 GTTCCAACATGAATTTTGGAGGG + Intronic
973862827 4:55082733-55082755 TTTTCTAAAGGATGTTTTGAAGG - Intronic
973873281 4:55188150-55188172 GTTTCAATATGAATTTTGGAGGG - Intergenic
974010989 4:56607113-56607135 GTTTCAACATGAATTTTGGAAGG - Intergenic
974011288 4:56609601-56609623 GTTTCAACACGAATTTTGGAAGG - Intergenic
974432342 4:61815635-61815657 GTTTCAATATGAATTTTGGCAGG - Intronic
974478466 4:62414512-62414534 GTTTCAACATGAATTTTGGAGGG - Intergenic
974480538 4:62437581-62437603 GTTTTTAAGGGGATTATGGAGGG + Intergenic
974595385 4:64008106-64008128 GTTTGTAAAGGGATCCTGGAAGG - Intergenic
975245058 4:72110834-72110856 ATTGCTAAAGGATTTTTGGAGGG - Intronic
975557376 4:75677823-75677845 GTTTCAACATGAATTTTGGAGGG - Intronic
975707209 4:77122935-77122957 GTTTCTAAAGATAATTTGGCAGG - Intergenic
976262683 4:83160496-83160518 GTTTCAACAGGAGTTTTGGAGGG + Intergenic
976705865 4:88018228-88018250 TTTCCTAAAGGACATTTGGAAGG + Intronic
976843883 4:89464588-89464610 GTTTCAACATGAATTTTGAAGGG - Intergenic
977125683 4:93164545-93164567 ATTTCTAGACTAATTTTGGAAGG - Intronic
977372615 4:96158815-96158837 ATTTCAACAGGAATTTTGGAGGG + Intergenic
977417999 4:96759765-96759787 ATATCTAAAAGAATTTTTGATGG + Intergenic
977537361 4:98270243-98270265 GTTTCAACATGAGTTTTGGAGGG + Intronic
977603733 4:98961312-98961334 GTTTCAACACGGATTTTGGAGGG - Intergenic
977650458 4:99462667-99462689 GTTTGTAAAGCATTTTTGTAGGG + Intergenic
977675995 4:99747728-99747750 GTTTCAACATGAATTTTGGAGGG - Intergenic
977706805 4:100080581-100080603 ATTTCAAAATGAGTTTTGGAGGG + Intergenic
977982402 4:103340073-103340095 GTTTCAACATGAATTTTGGAAGG - Intergenic
978240369 4:106507857-106507879 ATTTCAACATGAATTTTGGAAGG + Intergenic
978421778 4:108541304-108541326 GTTTCAACATGAAATTTGGAGGG - Intergenic
979046981 4:115879578-115879600 GATTCTCAAGGAAATATGGATGG + Intergenic
979084265 4:116386744-116386766 GTTTCAAAATGAGTTTTGGAGGG - Intergenic
979264155 4:118682269-118682291 GTTTCAAAATGAATTTTTGGAGG + Intergenic
979273127 4:118785699-118785721 GATTTTAAAGGAATGTTGCATGG - Intronic
979309734 4:119188475-119188497 AATTCAAAAGGAATTTTGAATGG + Intergenic
979349851 4:119630766-119630788 GTTTCAACATGAATTTTGGAGGG - Intergenic
979527608 4:121734017-121734039 GTTTCAACATGAGTTTTGGAGGG - Intergenic
980320705 4:131269775-131269797 GATTCTAAAAGAATATTGGCTGG + Intergenic
980335746 4:131470754-131470776 GCATCTACATGAATTTTGGAAGG - Intergenic
980595239 4:134946865-134946887 GTTTCAACATGAGTTTTGGAGGG + Intergenic
980717251 4:136642410-136642432 GTTTTAACATGAATTTTGGAGGG + Intergenic
981179720 4:141726145-141726167 GTTTCAATCTGAATTTTGGAGGG + Intronic
981361047 4:143845962-143845984 GTTTCAACATGAGTTTTGGAGGG + Intergenic
981371786 4:143966964-143966986 GTTTCAACATGAGTTTTGGAGGG + Intergenic
981380873 4:144070162-144070184 GTTTCAACATGAGTTTTGGAGGG + Intergenic
981407504 4:144387955-144387977 GTTTGAACATGAATTTTGGAGGG + Intergenic
981619311 4:146676115-146676137 GTTTCAACATGAATTTTGGAGGG + Intergenic
981687831 4:147474771-147474793 GTTTCAACATGAATTTTGTAGGG + Intergenic
981711284 4:147710995-147711017 GTTTCAACATGAGTTTTGGAGGG + Intergenic
981977526 4:150748730-150748752 GTTTCTACAAGAATTTTGGAGGG - Intronic
982331283 4:154184627-154184649 GTTTCAATATAAATTTTGGAGGG - Intergenic
982583331 4:157206808-157206830 GTGTGAAAATGAATTTTGGAAGG - Intronic
982639859 4:157944756-157944778 GTTTCAACATGAGTTTTGGATGG + Intergenic
982892072 4:160867475-160867497 GTTTCAACATGAACTTTGGAGGG + Intergenic
983014980 4:162602552-162602574 ATTTGAAAAGGAATTTTGCATGG - Intergenic
983349424 4:166568998-166569020 GTTTCAACATGAATTTTGAAGGG + Intergenic
983765274 4:171473096-171473118 GTATCTAAAGGAATTTCCCAAGG - Intergenic
983770511 4:171543217-171543239 GTTTCTAAATTAATTTTGAATGG + Intergenic
983896597 4:173087587-173087609 TTTTCTAAAAGAAGTTTGCATGG - Intergenic
983922926 4:173366450-173366472 GTTTCACAATGAATTTGGGAGGG + Intergenic
983955024 4:173687469-173687491 GTTTCTATATGAATTTTGGAAGG - Intergenic
984091547 4:175381180-175381202 GTTTTTAAAGATAATTTGGAGGG - Intergenic
984178166 4:176446071-176446093 ATTTCAACATGAATTTTGGAGGG - Intergenic
984321556 4:178203569-178203591 ATTTCAACAAGAATTTTGGAGGG + Intergenic
984387998 4:179088792-179088814 ATTGCTAAAACAATTTTGGAAGG - Intergenic
984851955 4:184162182-184162204 GTTTGGAGAGAAATTTTGGAGGG - Intronic
984982499 4:185296231-185296253 GTTTCAACATGAATTTTGGAGGG + Intronic
985375622 4:189334320-189334342 ATTTCAACATGAATTTTGGAGGG + Intergenic
985438390 4:189957951-189957973 GTTTATAAAGAAATTTTAGGAGG - Intronic
986032946 5:3910486-3910508 GTTTCAATGTGAATTTTGGAGGG + Intergenic
986671186 5:10144427-10144449 GTTTCAACACGAGTTTTGGAGGG - Intergenic
986882680 5:12194480-12194502 ATTTCAACATGAATTTTGGAAGG + Intergenic
986923805 5:12720988-12721010 GTTTCAACATGAGTTTTGGAGGG - Intergenic
986984769 5:13488174-13488196 GTTTCCAAATGAGTTTTGGAGGG - Intergenic
987033360 5:13996256-13996278 ATTTCAACAAGAATTTTGGAGGG + Intergenic
987033655 5:13998398-13998420 GTTTCAACATGAATTTGGGAGGG + Intergenic
987170027 5:15245420-15245442 ATTTTTAATGGAATTTTGGAAGG + Intergenic
987628075 5:20429164-20429186 GATTCTACTGGAATTTTGAATGG - Intronic
987817532 5:22922322-22922344 GTTTCAACATGAATTTTGGAGGG + Intergenic
987995524 5:25272903-25272925 GTTTCAACATGAATTTTGTAGGG - Intergenic
988249570 5:28738706-28738728 TTTTGGAAGGGAATTTTGGAAGG + Intergenic
988725931 5:33926495-33926517 GTTTCTTAAGAAATTAGGGAAGG + Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989708750 5:44371051-44371073 ATTTCAAAATGAATTTTGGAGGG - Intronic
989765069 5:45073328-45073350 GTTTTTGAAGAAATTTTAGAAGG + Intergenic
989789545 5:45380365-45380387 GCTTCAACATGAATTTTGGAGGG + Intronic
990085269 5:51968851-51968873 GTTTCTAAGGGAACCATGGAGGG + Intergenic
990195760 5:53313593-53313615 GTTTCCAAAGGACTTCTGGGAGG - Intergenic
990226206 5:53657492-53657514 GATTCAAAAGGTAATTTGGATGG - Intronic
990339930 5:54812545-54812567 GTTTCAATATGAGTTTTGGAGGG - Intergenic
991092701 5:62708391-62708413 GTTTTTAAGGGAATTGTGAAGGG + Intergenic
991168681 5:63594417-63594439 GTTTCAACATGAATTTTGAAGGG - Intergenic
991372892 5:65938152-65938174 ATTTCTAAAAACATTTTGGAGGG + Intronic
991714873 5:69442303-69442325 ATTTCTAAAGGATTTTTCTAAGG + Intronic
992041246 5:72835653-72835675 GTTTCAAGATGAATTTTGGTAGG + Intronic
992041484 5:72837520-72837542 GTTTCAACATGAATTTTGGAGGG + Intronic
992352418 5:75943856-75943878 GTTGCCAAAGGAAATATGGAAGG - Intergenic
992458058 5:76934487-76934509 GCTTCAACATGAATTTTGGAGGG - Intergenic
992475357 5:77096659-77096681 GTTTCAACATGAGTTTTGGAGGG + Intergenic
992496269 5:77297283-77297305 ATTTCAACATGAATTTTGGAGGG + Intronic
992575003 5:78098966-78098988 GTTTCAACACGAATTTTGGAGGG - Intronic
993021926 5:82602267-82602289 GTTTCAACATAAATTTTGGAGGG + Intergenic
993039531 5:82797116-82797138 GTTTCAGCATGAATTTTGGAAGG - Intergenic
993123477 5:83803473-83803495 ATTTCAACATGAATTTTGGAAGG + Intergenic
993180572 5:84547330-84547352 GTTTCAACATGAGTTTTGGAGGG - Intergenic
993272871 5:85817484-85817506 GTTTTTAAAGATATTTTGGCAGG - Intergenic
993303742 5:86249082-86249104 GTTTCAACATGAGTTTTGGAGGG - Intergenic
993357659 5:86935085-86935107 GTTTCAACATGAATTTTGGAGGG - Intergenic
993411417 5:87578073-87578095 GTTTCTAATGGATTTTTAAAAGG - Intergenic
993500019 5:88655393-88655415 GATTCTAAATAAATTTTGGAAGG - Intergenic
993797899 5:92291936-92291958 GTTTCAACATAAATTTTGGAGGG + Intergenic
994015948 5:94965708-94965730 GTTTCAACATGAATTTTGGAAGG - Intronic
994080632 5:95705338-95705360 GTTTCAACGTGAATTTTGGAGGG + Intergenic
994379307 5:99052754-99052776 ATTTCAACAGGAGTTTTGGAGGG - Intergenic
994448086 5:99903437-99903459 GTTTCAACATGAATTTTGGAGGG - Intergenic
995410483 5:111851972-111851994 GTTTCAACATGAATTTTGGAAGG - Intronic
995555744 5:113326602-113326624 GTTTCAATGCGAATTTTGGAGGG + Intronic
995556605 5:113336240-113336262 ATTTCCATATGAATTTTGGAGGG + Intronic
996090192 5:119343114-119343136 GTTCCTAAAGCAATTGTGGTGGG + Intronic
996313934 5:122140141-122140163 ATTTCAACATGAATTTTGGAAGG - Intronic
996336114 5:122386096-122386118 GTTTCTCAAGGAAATTTTGTTGG + Intronic
996589445 5:125129439-125129461 ATTTCAACATGAATTTTGGAAGG + Intergenic
996783091 5:127209740-127209762 GTTTCAACATGAATTTTGGAGGG + Intergenic
996872023 5:128202332-128202354 CTTTCAACATGAATTTTGGAAGG + Intergenic
997018528 5:129966972-129966994 GTGTCTAAAGCAATTTAAGAAGG + Intronic
997067348 5:130577591-130577613 GTTTCAACACGCATTTTGGAGGG - Intergenic
997189092 5:131913896-131913918 ATTTCAACACGAATTTTGGAGGG - Intronic
997315155 5:132927125-132927147 GTTGGAAAAGGAAATTTGGAAGG + Exonic
997605945 5:135176108-135176130 GTTTCTAAAGGAACAGGGGAGGG + Intronic
997762201 5:136460421-136460443 ATTTTTGAAGGCATTTTGGAAGG - Intergenic
997904949 5:137807268-137807290 GTTTCAACATGAATTTTGGAGGG + Intergenic
997939247 5:138142002-138142024 GTTTCAACATGAATTTTGGAGGG - Intronic
999009229 5:148016768-148016790 ATTTTTAATGGAATTTAGGAAGG - Intergenic
999662056 5:153874657-153874679 GTTTCAACATGAATTTTGGAGGG + Intergenic
999865199 5:155693753-155693775 GTTTCAATATGAATTTTGAAGGG - Intergenic
1000054149 5:157589214-157589236 GTTTCAACATGAATTTTTGAGGG + Intergenic
1000219161 5:159195456-159195478 GTTTGTAAAGGGATTGTAGATGG - Intronic
1000268823 5:159663494-159663516 GTTTCAACATGAGTTTTGGAGGG + Intergenic
1000308401 5:160017521-160017543 ATTTCAACATGAATTTTGGAGGG + Intronic
1000403540 5:160860526-160860548 ATTTCTGAAAGAATTTTAGAAGG + Intergenic
1001762962 5:174222940-174222962 GTTTCAACATGAGTTTTGGAGGG + Intronic
1002077662 5:176718459-176718481 GTTTCCACATGCATTTTGGAGGG + Intergenic
1002123808 5:177026318-177026340 GTTTCTGAAGGAGTTTGTGAAGG + Intronic
1002162640 5:177324823-177324845 GTTTCAACATGAGTTTTGGAGGG + Intergenic
1002687249 5:181023393-181023415 GTTTCAACATGAATTTTGGCAGG - Intergenic
1003144425 6:3498015-3498037 GTTTCTACATGTATCTTGGAGGG - Intergenic
1003435351 6:6083020-6083042 GTTTCAACACAAATTTTGGAAGG + Intergenic
1003680765 6:8252831-8252853 TTTTCAACATGAATTTTGGAGGG - Intergenic
1004365912 6:15012579-15012601 GTTTCAACATAAATTTTGGAGGG - Intergenic
1004780348 6:18901548-18901570 GTTTCCACATGAATTTTGGAAGG + Intergenic
1005023053 6:21435837-21435859 GTCTCAAAAAGAATATTGGAAGG + Intergenic
1005169729 6:22969024-22969046 GTTTCAACATGAATTTTGGAGGG + Intergenic
1005376762 6:25190633-25190655 GTTTCAACATGAGTTTTGGAGGG - Intergenic
1005912057 6:30319136-30319158 GTTTCAACATGAGTTTTGGAGGG - Intergenic
1006622174 6:35373223-35373245 GTTTCAACATGAATTTTGGAGGG + Intronic
1006867006 6:37216692-37216714 GTTTCAACATGAATTTTGAAGGG - Intronic
1007101239 6:39248578-39248600 GTTTCAATATGAGTTTTGGAGGG - Intergenic
1007827459 6:44611402-44611424 ATTTCTAAATGAGATTTGGAGGG - Intergenic
1008058232 6:46967456-46967478 GTTTCAACATGAATTTTGGAGGG - Intergenic
1008840468 6:55896761-55896783 GTTTCAATAAAAATTTTGGAGGG + Intergenic
1008876427 6:56334685-56334707 ATTTCAATATGAATTTTGGAGGG - Intronic
1009026167 6:58002875-58002897 GCTTCTAAAAGAATTAAGGAAGG + Intergenic
1009201715 6:60754349-60754371 GCTTCTAAAAGAATTAAGGAAGG + Intergenic
1009786093 6:68341404-68341426 GTTTCTAAAGGATATTCAGAGGG + Intergenic
1010103200 6:72135085-72135107 TTATTTAAAGGAATTTTGGGTGG - Intronic
1010134740 6:72537913-72537935 GTTTAAACATGAATTTTGGAAGG + Intergenic
1010316848 6:74461321-74461343 GTTTTTAAAGAAATTTTTGTGGG + Intergenic
1010367572 6:75069689-75069711 GTTTCAATGTGAATTTTGGAGGG - Intergenic
1011346302 6:86372679-86372701 GTTTCAAGATGAATTTTGGAGGG + Intergenic
1011449920 6:87481480-87481502 GTTTCTAAAGGAAGTTTCTCAGG - Intronic
1011579179 6:88839635-88839657 ATTGCTAAAGAAATTCTGGATGG + Intronic
1011704763 6:89989802-89989824 GTCTCTGTAGGAATCTTGGAGGG + Intronic
1011984832 6:93430635-93430657 ATTTCAACATGAATTTTGGAGGG - Intergenic
1011985048 6:93432987-93433009 GTTTCAATATGAATTTTGGAGGG - Intergenic
1012079170 6:94734089-94734111 GTTTCAACATTAATTTTGGAGGG + Intergenic
1012229258 6:96741130-96741152 TTTTCTAAAGGTATTATAGAAGG + Intergenic
1012646877 6:101695418-101695440 GTTTCAACATGAATTTTGGAAGG + Intronic
1012786798 6:103639991-103640013 GTTACAAAAGAAGTTTTGGAAGG + Intergenic
1012874293 6:104707849-104707871 GTTTCAACATGAATTTGGGAGGG + Intergenic
1012954821 6:105558164-105558186 GTTTCAACATGAGTTTTGGAGGG + Intergenic
1013020080 6:106206088-106206110 GTTTCAGCATGAATTTTGGAGGG - Intronic
1013191657 6:107808985-107809007 ATTTCAACATGAATTTTGGAGGG - Intronic
1013268028 6:108519323-108519345 GTTTCAGCATGAATTTTGGATGG + Intronic
1013470010 6:110455692-110455714 GTTTCAACATGAATTTTGGAGGG - Intronic
1013488973 6:110626416-110626438 GTTTCAACATGAATTTTGGAGGG - Intronic
1013761350 6:113522563-113522585 GTTCCTAAAGGAATTCTCCAGGG - Intergenic
1014181882 6:118393217-118393239 GTTTCAACATGAATTTTGGAGGG + Intergenic
1014188545 6:118464184-118464206 GTTTCTGTTGGTATTTTGGAAGG - Exonic
1014672764 6:124327216-124327238 GTTTCTAAAGGAATTTTGGAGGG + Intronic
1014720658 6:124913793-124913815 GTTTCAATATGGATTTTGGAGGG - Intergenic
1014813016 6:125906537-125906559 GTTTCTGTGGGAAGTTTGGAAGG + Intronic
1014948918 6:127530814-127530836 GCTTCAACATGAATTTTGGAGGG + Intronic
1015369814 6:132437906-132437928 ATTTCAACATGAATTTTGGAGGG + Intergenic
1015840949 6:137476800-137476822 GTTTAAACACGAATTTTGGAGGG - Intergenic
1016039164 6:139413961-139413983 GTTTCAACATGAATTTTGGAAGG + Intergenic
1016060509 6:139625235-139625257 GTTTCTGAGTGACTTTTGGAGGG - Intergenic
1016440278 6:144076280-144076302 GTTTCAACATGAGTTTTGGAGGG - Intergenic
1016591675 6:145752562-145752584 CTTTTTAAAGACATTTTGGAGGG + Intergenic
1016599288 6:145838520-145838542 GTTACAACATGAATTTTGGATGG + Intergenic
1016731831 6:147435862-147435884 ATTTCAAAATGAGTTTTGGAGGG - Intergenic
1017797910 6:157864351-157864373 GTTTCAACATGAGTTTTGGAGGG + Intronic
1018230278 6:161668956-161668978 GTTTTAACATGAATTTTGGAGGG - Intronic
1018411190 6:163550396-163550418 GTTTCAACATGAGTTTTGGAGGG + Intronic
1019404049 7:873697-873719 TCTTCTAAAGGACTTTTGGAGGG + Exonic
1020580978 7:10001207-10001229 TTTTCTAAAGATATTTTTGAAGG - Intergenic
1020751885 7:12151415-12151437 GTTTTAAAAGTAATTTTTGATGG + Intergenic
1021160265 7:17264059-17264081 GTTTCGAAATGAATTTTGAAGGG - Intergenic
1021224743 7:18013923-18013945 GTTTTTAAGGGAATCATGGAGGG + Intergenic
1021477686 7:21080898-21080920 ATTTCAACATGAATTTTGGAGGG + Intergenic
1022235562 7:28457248-28457270 ATTTCAACATGAATTTTGGAGGG + Intronic
1022512423 7:30948782-30948804 ATTTCTACATGAAATTTGGAAGG - Intronic
1022581327 7:31557925-31557947 GTTTCAACATGAGTTTTGGAGGG - Intronic
1022596627 7:31719135-31719157 GTTGTTAAAGAAATATTGGAAGG - Intergenic
1022783460 7:33610650-33610672 GTTTCGACACGACTTTTGGAGGG + Intergenic
1022893678 7:34727280-34727302 GTTTATAAATGAATTTTAAAAGG - Intronic
1022971494 7:35521399-35521421 GTTTCAACATGAGTTTTGGAAGG + Intergenic
1023113424 7:36837485-36837507 GTTTCAACATGAATTTTGGAGGG + Intergenic
1024116740 7:46201332-46201354 GTTTCTACATGCATTTTTGAGGG + Intergenic
1024210558 7:47199653-47199675 GTTTCAACATAAATTTTGGAGGG + Intergenic
1024467292 7:49725073-49725095 GTTTCAACATGAATTTTGGAGGG - Intergenic
1024810357 7:53203796-53203818 TTTTCTAAAAGAAATTTTGAGGG + Intergenic
1024819402 7:53309903-53309925 GTTTGTAAAGCAAATTTGGTGGG + Intergenic
1024847967 7:53672004-53672026 GTTTCAACATGAGTTTTGGAGGG + Intergenic
1025274889 7:57571385-57571407 GTTTCAACATGAACTTTGGAGGG + Intergenic
1026241132 7:68576101-68576123 GTTTCAACATGATTTTTGGAGGG + Intergenic
1026253980 7:68694910-68694932 GTTTCTAAAGAAGCTATGGAAGG - Intergenic
1026423085 7:70260625-70260647 GTTTCAACACGAGTTTTGGAGGG + Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027136189 7:75625671-75625693 GTTTCAACATGAATTTTGGAGGG - Intronic
1027141123 7:75658399-75658421 TTTTTTGAAGGAATTCTGGAGGG + Intronic
1027520240 7:79197915-79197937 ATTTCAACATGAATTTTGGAGGG + Intronic
1027982176 7:85239199-85239221 GTTTCAACATGAATTTGGGAGGG - Intergenic
1028335921 7:89654824-89654846 GCTTCTGAAGTAATTTTTGAAGG + Intergenic
1028632345 7:92948785-92948807 GGTTCTGAAGGCATTTTAGAGGG + Intergenic
1028916575 7:96266044-96266066 GTTTCAACATGAATTTTGGAGGG + Intronic
1029879961 7:103797779-103797801 GTATATAAAGGAATTGTGAAGGG + Intronic
1030324504 7:108205072-108205094 GTTTCAACATGAATTTTGGAGGG - Intronic
1030544503 7:110875072-110875094 ATTTCAACATGAATTTTGGAGGG + Intronic
1030671717 7:112345340-112345362 GTTTCAACAGGAATTTTGGAGGG + Intergenic
1030854722 7:114540725-114540747 GTAGATAAAGGAATTTTTGATGG + Intronic
1030879562 7:114860970-114860992 GTTTTAACATGAATTTTGGAAGG - Intergenic
1031179770 7:118399253-118399275 GTTTCAACAGGAATTTTGGAGGG + Intergenic
1031339803 7:120585260-120585282 GATTCTCAAGGAAATGTGGACGG + Intronic
1031686885 7:124741386-124741408 TTTTCTGAAAGAATTTTTGAAGG - Intergenic
1031906299 7:127463849-127463871 GTTTCAACATGAGTTTTGGAGGG - Intergenic
1032601961 7:133306997-133307019 TATTCTAAAGGAATATTGGAAGG - Intronic
1032993276 7:137417646-137417668 GTTTCAACATGAATTTTGGAGGG - Intronic
1033059004 7:138087338-138087360 GTTTCAACATGAGTTTTGGAGGG + Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034352303 7:150424804-150424826 GTTTCAACATGAATTTTGGGAGG - Intergenic
1034568931 7:151939412-151939434 GTTTCTAATGGCATTTAGAATGG - Intergenic
1034658001 7:152744581-152744603 GTTTCAACATGAATTTTGGAGGG + Intergenic
1035153753 7:156895527-156895549 GTTTCTGAATGCATTTTGAAAGG + Intergenic
1035825204 8:2637493-2637515 GTTTCAACATGAATTTTAGAGGG + Intergenic
1037087866 8:14875382-14875404 GTCTCAACATGAATTTTGGAGGG + Intronic
1037168737 8:15863830-15863852 CTTTCAAAAGGAAGTTTGAATGG + Intergenic
1037193554 8:16157585-16157607 GTTTCTAACAAAATGTTGGAAGG + Intronic
1037371571 8:18184637-18184659 GTTTCAACATGAATTTGGGAAGG - Intronic
1037499948 8:19476042-19476064 GTTACTGTAGGAATTTTGTAGGG - Intronic
1037843053 8:22259281-22259303 ATTTCAACATGAATTTTGGAAGG - Intergenic
1038077761 8:24096822-24096844 GTTTTTCAATGAGTTTTGGAGGG - Intergenic
1038541873 8:28396579-28396601 GTTTCTAAAAGCATTTTAAATGG + Intronic
1038751228 8:30297857-30297879 GTTCCAACATGAATTTTGGAAGG - Intergenic
1038999693 8:32966265-32966287 GCTTCAACATGAATTTTGGAGGG - Intergenic
1039035844 8:33358589-33358611 ATTTCAACATGAATTTTGGAGGG - Intergenic
1039380193 8:37077725-37077747 GGTTCTAAGGGATTTTTGTATGG - Intergenic
1039764334 8:40612414-40612436 GTCCATAAAGGAAATTTGGATGG - Intronic
1039943897 8:42114003-42114025 GTTTCAACATGAATATTGGAGGG + Intergenic
1040064145 8:43130906-43130928 GTTTCAACATGAATTTTGGAGGG + Intergenic
1040282369 8:46067156-46067178 TTTGCTAAAGGAATTTTGGAGGG + Intergenic
1040859067 8:51980214-51980236 GTTTTTAAAGAAAATTTGGCGGG - Intergenic
1041022518 8:53652786-53652808 ATTTCTTATGGAATTTTGGCTGG - Intergenic
1041570868 8:59335715-59335737 GTTTCTGAAGAAACTTTTGAAGG + Intergenic
1041648127 8:60274507-60274529 GTTTCAACATGGATTTTGGAGGG - Intronic
1041735827 8:61109616-61109638 GTTTCTACCTGAGTTTTGGAGGG - Intronic
1041758816 8:61341806-61341828 GCTTTTAAGGGAATTTTGCAAGG + Intronic
1042043449 8:64621209-64621231 GATTCTCAACGAATATTGGATGG - Intronic
1042053309 8:64734597-64734619 GTTTCAACATGAATTTTGAAGGG + Intronic
1042513691 8:69637648-69637670 GTTTCTAAAAAAATTTTGCTGGG + Intronic
1042628849 8:70793236-70793258 GTTTCAACATGAGTTTTGGAGGG - Intergenic
1042688299 8:71465741-71465763 ATTTCAACACGAATTTTGGAGGG - Intronic
1042691844 8:71508497-71508519 GTTTCAACAGGAATTTTGTGGGG - Intronic
1042763783 8:72298718-72298740 GTTTCAACATGAATTTTGAATGG + Intergenic
1042936676 8:74066355-74066377 GTTTCAACATGAATTTTGGAGGG + Intergenic
1043577045 8:81669785-81669807 GTTTCCATATGAGTTTTGGAGGG - Intronic
1043673053 8:82913078-82913100 GTCTCAACATGAATTTTGGAGGG - Intergenic
1043802687 8:84630480-84630502 GTTTCAAAAGGAATTTTGGGTGG + Intronic
1044180484 8:89187725-89187747 GTTTCAACATGAATTTTGGAAGG - Intergenic
1044181742 8:89204482-89204504 TTGTCTTATGGAATTTTGGATGG + Intergenic
1044449363 8:92315739-92315761 GTTACTATTGTAATTTTGGAGGG + Intergenic
1044608650 8:94070338-94070360 GTTTCAACATGAGTTTTGGAGGG + Intergenic
1044639582 8:94364845-94364867 GTTTCAACATGAATTTGGGAAGG - Intergenic
1044644868 8:94429336-94429358 GGTTCTAAAATAATTGTGGAAGG - Intronic
1044885663 8:96774286-96774308 GTTTCAACATGAATTTTGGAGGG + Intronic
1044928583 8:97230547-97230569 GTTTCAACATGAGTTTTGGAGGG - Intergenic
1045348935 8:101320345-101320367 GTTTCAACATGAGTTTTGGAGGG + Intergenic
1045553663 8:103194960-103194982 GTTTCAACATGAATTTTGGAGGG + Intronic
1046064989 8:109185711-109185733 GTTTCAACATGAATTTTGAAGGG - Intergenic
1046231770 8:111367358-111367380 GTTTCAGCATGAATTTTGGAAGG + Intergenic
1046473523 8:114710731-114710753 GTTTCAACATGAATTTTGGAGGG + Intergenic
1046561888 8:115848257-115848279 TTTTCCTAAGGAATTTGGGAAGG + Intergenic
1046623140 8:116549236-116549258 GTTTCAATGGAAATTTTGGAGGG - Intergenic
1046926262 8:119792618-119792640 GTTTCAACATGAATTTTGGAGGG - Intronic
1047000192 8:120565795-120565817 GTTTCAACATGAATTTTGGGGGG - Intronic
1047014615 8:120710501-120710523 ATTTCAACATGAATTTTGGAGGG - Intronic
1047536132 8:125721330-125721352 ATTTCAACATGAATTTTGGAAGG + Intergenic
1047700427 8:127444151-127444173 GTTTCAAAATGAATTTTGGAGGG - Intergenic
1047825627 8:128571282-128571304 GTTCCAATATGAATTTTGGAGGG - Intergenic
1048234687 8:132678004-132678026 ATTTCAACATGAATTTTGGAGGG + Intergenic
1048390808 8:133962785-133962807 GTTTCAACACAAATTTTGGAGGG - Intergenic
1048549961 8:135425049-135425071 GCTTCAACATGAATTTTGGAGGG + Intergenic
1048700488 8:137083221-137083243 GTTTTTAAGGGAATCTTGGTGGG + Intergenic
1049458543 8:142708849-142708871 GTTTCAATATGAATTTTGGAGGG + Intergenic
1049479196 8:142812102-142812124 GTTTTTAAAGGTACTTTGGCTGG - Intergenic
1049631011 8:143657542-143657564 ATTTCTACATGAGTTTTGGAGGG + Intergenic
1049639685 8:143709397-143709419 GTTTTTAAAGGGATTGTGGCGGG - Intronic
1049998016 9:1049507-1049529 TTTTGTAAAGGATTTTTTGAGGG + Intergenic
1050067287 9:1773238-1773260 ATTTCAACATGAATTTTGGAGGG + Intergenic
1050274394 9:3981684-3981706 GTTTTTAAAGGAATTTGAAAAGG - Intronic
1050320338 9:4446152-4446174 ATTTCGACATGAATTTTGGAGGG - Intergenic
1051032985 9:12705549-12705571 GTTTCTTAAATAATTTTTGATGG - Intronic
1051065499 9:13097422-13097444 GTTGCTAAAAAAATTTTGAAAGG - Intergenic
1051985611 9:23083258-23083280 GTTTTGAAAGGAATTTGGGATGG + Intergenic
1052027397 9:23588816-23588838 ATTTCAACATGAATTTTGGAAGG - Intergenic
1052171222 9:25399612-25399634 ATTTCAACATGAATTTTGGAAGG + Intergenic
1052219907 9:26007657-26007679 GCTTCAACATGAATTTTGGAGGG - Intergenic
1052295801 9:26895046-26895068 GTTTTTAAGGGAATTTTGGTGGG - Intergenic
1052299341 9:26936169-26936191 GTTTTTAGTGGAATTTGGGAAGG - Intronic
1052786681 9:32834857-32834879 GTTTCAACATGAGTTTTGGAGGG - Intergenic
1053441253 9:38118137-38118159 GTCTTAAAAGGAATCTTGGAAGG - Intergenic
1053728166 9:41025499-41025521 GTTTCAACAGAAATTTTGAAGGG - Intergenic
1053747411 9:41213275-41213297 GTTTATAAAGAAATTTTAGGAGG - Intergenic
1054338971 9:63837249-63837271 GTTTATAAAGAAATTTTAGGAGG + Intergenic
1054479875 9:65652093-65652115 GTTTATAAAGAAATTTTAGGAGG + Intergenic
1054700344 9:68406587-68406609 GTTTCAACAGAAATTTTGAAGGG + Intronic
1055096727 9:72421753-72421775 GTTCCAAAATGAATTTTGGAGGG + Intergenic
1055151395 9:73004742-73004764 GTTTCAACATGAGTTTTGGAGGG - Intronic
1055328353 9:75155876-75155898 GTTTCAACACGAATTTTGTAGGG - Intergenic
1055669653 9:78590063-78590085 GTTTCAAAGGGAATTTTGAATGG + Intergenic
1055919082 9:81438573-81438595 ATTTCCACAGGAGTTTTGGAGGG - Intergenic
1056103472 9:83323424-83323446 GTTTCAACATGAGTTTTGGAGGG - Intronic
1056178702 9:84061023-84061045 GTTTCAACATGACTTTTGGAGGG + Intergenic
1056415253 9:86369141-86369163 GTTTTTAAGGAGATTTTGGAGGG + Intergenic
1056438404 9:86595852-86595874 GTTTCAACATGAATTTGGGAGGG + Intergenic
1057426995 9:94959993-94960015 TTTTCTAAAAGAATTTTTTATGG + Intronic
1057692413 9:97296694-97296716 GCTTCATAAGGAATTTTGAATGG - Intergenic
1057707826 9:97410013-97410035 GTTTCAACATGAATTTTGTAGGG + Intergenic
1057754942 9:97826215-97826237 GTTTCAACATGAATTTTGAAGGG - Intergenic
1057969881 9:99544702-99544724 GTTTCAACATGAATTTTGGAAGG + Intergenic
1058027128 9:100153933-100153955 ATTTCAACATGAATTTTGGAGGG + Intronic
1058045900 9:100356176-100356198 ATTTCAAAATGAGTTTTGGAGGG + Intergenic
1058048494 9:100382971-100382993 GTTTCGACATGAGTTTTGGAGGG - Intergenic
1058101368 9:100920943-100920965 ATTTCAAAGGGAATTTGGGAGGG + Intergenic
1058268714 9:102941753-102941775 ATTTCAAAATGAATTTTGGCAGG - Intergenic
1058572623 9:106363953-106363975 GTTTCAACATGAATTTTGGAAGG + Intergenic
1058573011 9:106367470-106367492 GTTTCCACATGAATTTTGGAGGG + Intergenic
1058610533 9:106771029-106771051 GTTTCAACATGAATTTTGGAGGG - Intergenic
1058792716 9:108467201-108467223 ATTTCTAAATGACTTTAGGATGG + Intergenic
1058890706 9:109358375-109358397 GTTTCAACATGAATTTTGGAAGG - Intergenic
1059215315 9:112556121-112556143 GTTTCAACGTGAATTTTGGAGGG + Intronic
1059644881 9:116255098-116255120 GGTTCTAAAGTATTTTAGGAAGG - Intronic
1059856988 9:118410246-118410268 ATTTCAACATGAATTTTGGAGGG + Intergenic
1059872598 9:118594616-118594638 GTTTCTACATGACTTTTGGAAGG + Intergenic
1059875264 9:118627754-118627776 GTTTGTGAAGGAATCTGGGAGGG - Intergenic
1060006371 9:120003655-120003677 GTTTCAACATGAATTTTGGAGGG - Intergenic
1060341525 9:122781477-122781499 ATTTATAAAGTAATTCTGGAAGG + Intergenic
1060647431 9:125292913-125292935 CTTTCAAAAGGAATTCTGGAGGG + Intronic
1060805462 9:126573022-126573044 GTTTCAACATAAATTTTGGAGGG + Intergenic
1061824548 9:133249567-133249589 GTTTCTCAAGGCAGTTTGGGGGG - Intergenic
1062307184 9:135914619-135914641 GTTTCAACATGAATTTTGGAGGG + Intergenic
1202783543 9_KI270718v1_random:24046-24068 GTTTATAAAGAAATTTTAGGAGG - Intergenic
1203448332 Un_GL000219v1:82735-82757 GTTTATAAAGAAATTTTAGGAGG + Intergenic
1186264191 X:7813950-7813972 GTTTTTAAGGGAATTTTGGTGGG + Intergenic
1186287407 X:8060498-8060520 GTTACAGAATGAATTTTGGAAGG - Intergenic
1186294041 X:8129496-8129518 GTTTCAACATGAATTTTGGAAGG - Intergenic
1186724089 X:12338200-12338222 GTTTCAATAGGAGTTTTGGAGGG + Intronic
1186987949 X:15036880-15036902 GATTCAAAATGAGTTTTGGAGGG + Intergenic
1187085432 X:16037935-16037957 GTTTCTAAATGAATTTTCTAAGG - Intergenic
1187730595 X:22249862-22249884 GTTTATAAAGGAAATCTAGAAGG - Exonic
1187927058 X:24260265-24260287 CTTTCCACATGAATTTTGGAGGG + Intergenic
1188674412 X:32921270-32921292 GGTTATAAAACAATTTTGGAAGG + Intronic
1189208162 X:39259632-39259654 GTTTCTAAAGTATTTTTTAATGG - Intergenic
1189254008 X:39623372-39623394 GTTTCAACATGAATTTTGGAGGG + Intergenic
1189305349 X:39982811-39982833 GTTTCAACATGACTTTTGGAGGG + Intergenic
1189649717 X:43176518-43176540 GTTTCAACATAAATTTTGGAGGG + Intergenic
1189718984 X:43895553-43895575 GTTTCAACATAAATTTTGGAAGG - Intergenic
1189906281 X:45763356-45763378 GTTCCTAAAGGGATTTTGGAAGG + Intergenic
1189916179 X:45857886-45857908 GTTTCAACATGAATTTTGAAAGG + Intergenic
1190145316 X:47885812-47885834 ATTTCAACATGAATTTTGGAGGG + Intronic
1190224644 X:48535740-48535762 GTTTCAACATGAGTTTTGGAGGG - Intergenic
1190383796 X:49864927-49864949 GTTTCAACACAAATTTTGGAGGG - Intergenic
1190836180 X:54102665-54102687 GTTTCAATATGAGTTTTGGAGGG + Intronic
1190836825 X:54108980-54109002 GTTTCAATATGAGTTTTGGAGGG - Intronic
1192324308 X:70119204-70119226 GTTTCTAAGGGGATCATGGAGGG + Intergenic
1192605122 X:72508525-72508547 GTTTCAACACGAGTTTTGGAGGG - Intronic
1193490439 X:82142825-82142847 GAGTCTAAGGGAATTTTGGACGG - Intergenic
1193978165 X:88149327-88149349 GTTTCAACATAAATTTTGGAAGG + Intergenic
1193978429 X:88151813-88151835 GTTTCCATATAAATTTTGGAGGG + Intergenic
1194275939 X:91882197-91882219 GTTTCTACATGTATTATGGAAGG + Intronic
1194415164 X:93602874-93602896 GCATATAAGGGAATTTTGGAGGG + Intergenic
1194642763 X:96422418-96422440 GTTTCAACATGAATTTTGGAGGG + Intergenic
1195207573 X:102618202-102618224 ATTTCAACATGAATTTTGGAGGG - Intergenic
1195222532 X:102760139-102760161 GTTTCTAATGGAAGTAAGGAAGG + Intergenic
1196054351 X:111339248-111339270 GTTTCAACATGAGTTTTGGAGGG - Intronic
1196538201 X:116872624-116872646 GTTTCAACATGAAATTTGGAGGG + Intergenic
1196761062 X:119201384-119201406 ATTTCAACATGAATTTTGGAAGG - Intergenic
1197080187 X:122403491-122403513 GTTTCAACATGAATTTTGAAGGG - Intergenic
1197329634 X:125137857-125137879 TTTTAAAAAGGAATTTTGTAAGG + Intergenic
1197640942 X:128967482-128967504 ATTTCAACATGAATTTTGGAGGG + Intergenic
1197992110 X:132329442-132329464 GTTTCAACAGGAATTTTGAAGGG + Intergenic
1198120711 X:133589924-133589946 GTTTCAACATGAATTTTGGATGG - Intronic
1198194289 X:134344494-134344516 GTTTCAACATGAATTTTGGAGGG - Intergenic
1198232011 X:134699161-134699183 GTTCCTGCACGAATTTTGGAGGG - Intronic
1198525708 X:137498358-137498380 ATTTCAAAATGAGTTTTGGAAGG + Intergenic
1198535390 X:137580607-137580629 TTTTTTAAAGGACTTTTGGCTGG - Intergenic
1198693677 X:139312599-139312621 GTTTCAACATGAATTTTGGGAGG - Intergenic
1198926741 X:141805236-141805258 GATACTTAAGGAATGTTGGAAGG - Intergenic
1199042672 X:143131904-143131926 ATTTCAATATGAATTTTGGAGGG + Intergenic
1199049480 X:143220367-143220389 GTTTCAACATGAATTTTGGAGGG - Intergenic
1199339382 X:146659134-146659156 GTTTCTACATGAATTCTGGATGG + Intergenic
1199405346 X:147451947-147451969 GGTACAAAAGGAAATTTGGAGGG + Intergenic
1199751623 X:150824767-150824789 ATTTCAACATGAATTTTGGAGGG + Intronic
1199779778 X:151047730-151047752 GTTTCAACATAAATTTTGGAGGG - Intergenic
1200593185 Y:5103634-5103656 GTTTCTACATGTATTATGGAAGG + Intronic
1201962644 Y:19699323-19699345 GTCTCAAAATGAATTTTGGAAGG - Intergenic