ID: 1014673706

View in Genome Browser
Species Human (GRCh38)
Location 6:124339044-124339066
Sequence GGACCCAGTGGCTCACGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014673698_1014673706 24 Left 1014673698 6:124338997-124339019 CCACAGATCATTACAAACTTGGT 0: 1
1: 0
2: 2
3: 11
4: 124
Right 1014673706 6:124339044-124339066 GGACCCAGTGGCTCACGGGCTGG 0: 1
1: 0
2: 1
3: 16
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014673706 Original CRISPR GGACCCAGTGGCTCACGGGC TGG Intronic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900310514 1:2031207-2031229 GGACACAGGGGCTCAGGGGCTGG + Intergenic
900796559 1:4711985-4712007 GGGCCCAGGGCCTCACAGGCGGG - Exonic
900889773 1:5441508-5441530 GGAGCCAGGGGCTCAGGAGCCGG + Intergenic
901115729 1:6842230-6842252 GGACCCAGTGGCTCTCAAGTGGG + Intronic
902514130 1:16980692-16980714 GGACCCAGCGGCTCCGGGGCTGG - Exonic
903675432 1:25061764-25061786 GGACTCAGTGGCCCACGGTGAGG + Intergenic
903765257 1:25729904-25729926 GGTCCCCGTGGCTCACAGCCAGG + Intronic
903825992 1:26146103-26146125 GGCCTCAGTGGCTCACGTGGTGG + Intergenic
917214689 1:172665782-172665804 AGACCTTGTGGCTCAGGGGCAGG - Exonic
918508606 1:185285154-185285176 GAACCCAGGGGCCCACGGGGAGG - Intronic
918787533 1:188782357-188782379 GGACTCAGTTCCTCACAGGCTGG + Intergenic
919746869 1:201014293-201014315 GCACCCAGCGGGTCAGGGGCAGG - Intronic
921167065 1:212514971-212514993 GGACCCAGTGGCTCCCCAGGCGG + Intergenic
921196195 1:212760183-212760205 GGTACCAGTGGCCCACAGGCTGG - Intronic
923001139 1:230007308-230007330 GGACCCCGTGGTTCAAGGCCGGG + Intergenic
1062861133 10:810626-810648 GGACTCACTGGCGGACGGGCAGG + Exonic
1067070053 10:43124671-43124693 GAGCACAGTGGCCCACGGGCTGG + Intronic
1070164764 10:73889161-73889183 AGGCCCAGTGGCCCACAGGCAGG - Intergenic
1070386420 10:75928816-75928838 GCACCCAGTGGCTCTGTGGCAGG + Intronic
1073266502 10:102231141-102231163 GGTCCCAGCGGCTGAAGGGCGGG + Intronic
1073463136 10:103677973-103677995 GGGCACAGTGGCTCCCGTGCAGG + Intronic
1076589849 10:131575394-131575416 GGACCCACTGGCTGGCGGGGAGG - Intergenic
1077701330 11:4444816-4444838 GGACCCTGTGGCACAGGGGTTGG - Intergenic
1077897355 11:6463551-6463573 GGACCCTGTGGCTGACCGACTGG - Intronic
1078856827 11:15212426-15212448 GGGCCCAGTGGCTCACGGCAGGG - Intronic
1078865482 11:15293475-15293497 GAACCCACTGGCACAGGGGCTGG - Intergenic
1088630200 11:111766757-111766779 AGATCCAGTGGCTCAGGGCCAGG - Intergenic
1091304555 11:134529356-134529378 TGATGCAGTGGCTCTCGGGCTGG + Intergenic
1091453447 12:587711-587733 GGACCCTGCGCCTCACAGGCAGG + Intronic
1097754107 12:63390036-63390058 TGAGCAAGCGGCTCACGGGCTGG - Intergenic
1100169610 12:91959408-91959430 GGACGCGATGGCTCAGGGGCCGG - Intergenic
1101812709 12:108121448-108121470 AGAGCCATGGGCTCACGGGCTGG - Intergenic
1108208521 13:48115161-48115183 GGACCCAGGGGCACACTGGGTGG + Intergenic
1108694014 13:52886821-52886843 GGACCCAGTGGCTGTCAGGCTGG + Intergenic
1111907182 13:94268954-94268976 GAAGCCAGGGGCTCATGGGCTGG + Intronic
1115346561 14:32348892-32348914 GGACCCTGGGACTCACAGGCTGG - Intronic
1117020997 14:51570109-51570131 GGGCACGGTGGCTCATGGGCCGG - Intronic
1117842091 14:59870556-59870578 GGTCCCAGTGGCTCAGGCACCGG - Exonic
1118574796 14:67231546-67231568 GGACCCAGTGGCTCAGGCTGAGG - Intergenic
1122538926 14:102485849-102485871 GGACCCAGTGGCACACACCCTGG - Intronic
1122701887 14:103595292-103595314 GAACCCAGTGGGCCACGGGGAGG - Intronic
1123021656 14:105400602-105400624 GGACCCAGTGGCTCTTGGGCAGG + Intronic
1129539074 15:76336622-76336644 GGATCCAGGGGCTGATGGGCGGG - Intergenic
1132198714 15:99933050-99933072 GGACCCAGTGGTACAGGGGTGGG - Intergenic
1132549970 16:550321-550343 GGGCTCTGTGGCTCCCGGGCGGG - Intronic
1136482014 16:30548002-30548024 GGAACCAGAGGCCCACAGGCCGG + Intronic
1142176646 16:88648293-88648315 AGAGCCTGTGGCGCACGGGCTGG + Intronic
1142242365 16:88953401-88953423 GGACACAGTGTCTCCAGGGCAGG - Intronic
1143251053 17:5523336-5523358 GAGCCCAGTGGCTCCTGGGCAGG + Intronic
1145036405 17:19543767-19543789 GGATTCAGTGGCTCTCGGGCAGG + Intronic
1151273478 17:73014919-73014941 TGAACCAGTGGCTCAGGGGCGGG - Intronic
1151449366 17:74188497-74188519 GGGTGCAGTGGCTCATGGGCTGG + Intergenic
1151768739 17:76145982-76146004 GGACCCCGAGGCTCTTGGGCTGG - Intronic
1152106015 17:78329584-78329606 GGGCACAGTGACTCACGGGGTGG + Intergenic
1152155900 17:78632527-78632549 GGGCGCGGTGGCTCAGGGGCTGG - Intergenic
1152347648 17:79763231-79763253 GGCCACAGTGGCTCAGGGCCGGG + Intergenic
1152638094 17:81438413-81438435 GATCCAAGTGGCTCACGGGTAGG - Exonic
1152676512 17:81644252-81644274 GGACCCCCTGGCCCACTGGCAGG - Intronic
1152678619 17:81654267-81654289 GGACACAGTGGCTGCAGGGCGGG - Intronic
1153734124 18:8046606-8046628 GGACCCAGAGACACACGGACTGG - Intronic
1154361691 18:13668244-13668266 GGTTCCAGTGGTTCAGGGGCTGG - Intronic
1154967436 18:21373608-21373630 AGGCACAGTGGCTCACGGCCTGG - Intronic
1155218248 18:23662336-23662358 GGACCCAGAGGGTCAGGGTCGGG + Intronic
1156475196 18:37401619-37401641 GGGCTCTGTGGCTCACAGGCTGG - Intronic
1157424316 18:47571870-47571892 GGACTCAGGGACTCAGGGGCAGG - Intergenic
1157610411 18:48951852-48951874 GCACTCAGGGGCTCAGGGGCCGG + Intergenic
1160677536 19:399422-399444 GGACACAGTGGCTGGTGGGCGGG + Intergenic
1160836610 19:1127530-1127552 GGACCGTGTGGGTCCCGGGCTGG + Intronic
1161323724 19:3653076-3653098 GGACACAGTGGCTCACGCCTGGG - Intronic
1162059393 19:8085712-8085734 GGCCCTAGTGGGTCACCGGCTGG + Intronic
1162787787 19:13046352-13046374 AGACACAGTGGCCCAAGGGCTGG - Intronic
1163633397 19:18428000-18428022 GGACTCAGGGGCTCCAGGGCGGG + Intronic
1163743633 19:19032433-19032455 AGGCGCAGTGGCTCACGGCCTGG - Intronic
1165153398 19:33773666-33773688 GGACCCAGCGGCTCTCAGCCAGG + Intergenic
1165774377 19:38396067-38396089 CGACCCAGTGGCACGCGCGCAGG - Exonic
1166360021 19:42249213-42249235 GGGCCCAGCGGCTCAGGGGGAGG - Exonic
1166519526 19:43471159-43471181 GGACCCAGTGAGTGACAGGCAGG + Intergenic
927514383 2:23663327-23663349 GGACCCAAGGGCTCTAGGGCTGG - Intronic
930124753 2:47786627-47786649 AGACACGGTGGCTCACGGCCAGG - Intronic
933770797 2:85742689-85742711 GCATCCAGTTGCTCCCGGGCTGG - Intergenic
938107348 2:128542190-128542212 AGGCACAGTGGCTCATGGGCTGG - Intergenic
938746036 2:134279138-134279160 GGACACAGTGCCTGACCGGCAGG - Intronic
939985637 2:148827189-148827211 GCACCCAGGGCCTCAAGGGCAGG + Intergenic
942462631 2:176178713-176178735 GGTCACTGTGGCTCAGGGGCGGG - Intergenic
1171444729 20:25195607-25195629 GGACCCAGTTGCGCAGGCGCGGG - Intergenic
1172777867 20:37417714-37417736 GAGCCGAGTGGCTCACGGCCTGG - Intergenic
1173160139 20:40646481-40646503 GGCCCCAGGGGCTCAGGGCCAGG + Intergenic
1175168762 20:57064976-57064998 GGAGTCAGTGGCTCAAGGACGGG - Intergenic
1176223096 20:63979304-63979326 GGACCCAGAGGCACGGGGGCGGG - Intronic
1176368007 21:6045252-6045274 GAAAACAGTGGCTCAGGGGCTGG + Intergenic
1178978384 21:37240418-37240440 GGGCGCAGTGGCTCAGGGCCAGG - Intronic
1179755512 21:43493290-43493312 GAAAACAGTGGCTCAGGGGCTGG - Intergenic
1180089394 21:45526052-45526074 GGACCCCGTGGCTGCCGGGCGGG - Intronic
1180599652 22:17007776-17007798 GGACCCTGTCTCTCACTGGCGGG + Intronic
1181880239 22:25973406-25973428 GAACCCAGTGGCTCTTGGCCTGG + Intronic
1182090496 22:27591353-27591375 GGACCCTGTGGCCCACAGGAGGG - Intergenic
1183519711 22:38289807-38289829 TGACCCACAGGCTCACGGCCTGG - Intergenic
1184079998 22:42212650-42212672 GGACCCAGGGGCTCACTCACTGG - Exonic
1184332976 22:43837627-43837649 GGAAGCAGAGGCTCAAGGGCAGG + Intronic
1185343721 22:50302480-50302502 GGGCCCAGTGGCTCTCGACCAGG - Intronic
950458636 3:13107742-13107764 AGACCCAGCGGCCCAGGGGCGGG - Intergenic
951235197 3:20227011-20227033 GGGCACAGTGGCTCAAGGTCTGG - Intergenic
951999788 3:28772326-28772348 GTACCCAGTGGGTCACTGCCTGG + Intergenic
953009433 3:39010672-39010694 GGGCAGGGTGGCTCACGGGCTGG - Intergenic
954137541 3:48588977-48588999 CGACCCACAGGCTCAGGGGCTGG + Exonic
958977239 3:100682209-100682231 GGACCCAGCCGCTCACCGGAGGG + Intronic
961762688 3:129183458-129183480 GGCCCCAAGGGCGCACGGGCGGG + Intronic
967823441 3:193859465-193859487 GGTCCCAGTGTCTCACTGGCTGG - Intergenic
968382411 4:107815-107837 GGACCCTGAGGCCCAGGGGCGGG + Intergenic
968472024 4:786727-786749 GGTCCCGGCGGCTCCCGGGCGGG + Intronic
969567045 4:7984803-7984825 GGACCCTGTGGGTCTCTGGCTGG - Intronic
970593287 4:17577607-17577629 AGCCCCAGTAGCCCACGGGCAGG - Intronic
974057476 4:56998493-56998515 GGGCACGGTGGCTCACAGGCCGG - Intronic
976564524 4:86538439-86538461 GGGCGCAGTGGCTCAGGGCCGGG - Intronic
980906198 4:138950878-138950900 AGGTGCAGTGGCTCACGGGCTGG - Intergenic
980996592 4:139785210-139785232 GGACCCAGAAGCTGAGGGGCAGG - Intronic
981988526 4:150887475-150887497 GGGAGCAGTGGCTCACGGGCCGG + Intronic
985483751 5:137238-137260 GGTGCCAGGGGCTCAGGGGCAGG + Intergenic
985691204 5:1313680-1313702 GGACCCGGTGACCCATGGGCTGG + Intergenic
985726968 5:1521797-1521819 GCTCCCAGTGGCTCTTGGGCAGG - Intronic
989789259 5:45376689-45376711 GGACCCTGAGGTTCACTGGCAGG + Intronic
993386507 5:87268398-87268420 GGCCCCTGGGGCTCCCGGGCGGG + Exonic
998136510 5:139677004-139677026 GGGACCAGGGGCTGACGGGCGGG - Intronic
998265534 5:140665054-140665076 GCAGCCAGTAGGTCACGGGCCGG - Exonic
998385250 5:141753661-141753683 GGCCCCGGGGGCTCCCGGGCTGG + Intergenic
999058685 5:148609860-148609882 GGGCACAGTGGCTCATGGGCCGG - Intronic
1006120976 6:31805656-31805678 AGGCGCAGTGGCTCACGGGCTGG - Intronic
1006170548 6:32089392-32089414 GCACCAGGTGGCTCAGGGGCTGG + Intronic
1007599219 6:43071483-43071505 GGACCCAGAGGCTGACAGGCTGG - Intronic
1013157376 6:107506334-107506356 GGACTCAGTGACTCACCTGCAGG + Exonic
1014673706 6:124339044-124339066 GGACCCAGTGGCTCACGGGCTGG + Intronic
1018320986 6:162608363-162608385 GGACCCTGTGGCTCAAGGACAGG + Intronic
1019294288 7:265834-265856 GGCCCCGATGGCTCAGGGGCGGG - Intergenic
1020130508 7:5556350-5556372 GGCCCCTGTGGCTCAGAGGCAGG + Intronic
1022515610 7:30973435-30973457 TCACCCAGTGGCACACGGGTGGG + Intronic
1022810943 7:33868410-33868432 AGACCCAGAGGCTCAGAGGCTGG + Intergenic
1024305954 7:47929740-47929762 TGACCCAGTGGGTCAGGGGTGGG - Intronic
1028752108 7:94393841-94393863 GGACCGGGGGGCTCACGGGAGGG + Intergenic
1030735329 7:113041460-113041482 GGAACCAGAGGCTCAAAGGCAGG + Intergenic
1031922366 7:127611621-127611643 GGACCCAGTGGTTCCAGGGCAGG + Exonic
1032410622 7:131691324-131691346 GGGCACAGTGGCTCACGGGGAGG - Intergenic
1033289955 7:140075424-140075446 GGATCCAGTAGCCCAAGGGCAGG + Intergenic
1033422911 7:141218715-141218737 GGACCCTGGGGTTCAAGGGCAGG - Intronic
1034275171 7:149820858-149820880 GGACCCTGTGGGGCAAGGGCTGG - Intergenic
1035369098 7:158367458-158367480 GGACGCAGTGGTTCACAGGATGG + Intronic
1035464187 7:159064257-159064279 GGCCCCAGTGGCTCCGGGGCAGG - Intronic
1039380941 8:37084735-37084757 GGTCCCAGTGGCTCAGTGGTTGG + Intergenic
1041094993 8:54341344-54341366 GGATGCAGTGGCTCAGGGGAGGG + Intergenic
1041225078 8:55689736-55689758 GGACCCAGAAGGTCCCGGGCGGG + Intergenic
1042149983 8:65771586-65771608 GCACGCAGTGGCTCACGCGGTGG + Intronic
1044729317 8:95217686-95217708 GGGCACAGTGGCTCATGAGCTGG - Intergenic
1046811648 8:118539589-118539611 GGACCCTGTGGCTCTGGGGTGGG - Intronic
1048214232 8:132480765-132480787 GGACCCCGAGGGTCGCGGGCCGG + Exonic
1049849464 8:144823071-144823093 GGAAGCAGTGCCACACGGGCTGG - Intergenic
1053299099 9:36936204-36936226 GGACCCAGTGGCCCAGGACCCGG + Intronic
1056532144 9:87497616-87497638 GGACGCACTGGCTCCCCGGCCGG + Intronic
1057470114 9:95349617-95349639 GGGCGCAGTGGCTCCCGGTCAGG + Intergenic
1061520452 9:131114499-131114521 GGACCCAGTGGCTCCCTTGTGGG - Intronic
1061665989 9:132161454-132161476 GGACCCGCTGGCCCCCGGGCCGG + Intergenic
1061932492 9:133840425-133840447 GCAAGCAGTGGCTCAGGGGCAGG - Intronic
1189197024 X:39161571-39161593 GGACCCACTGGCTCTCCTGCTGG + Intergenic
1192497006 X:71622832-71622854 GGGCCCAGTGCCTCACAGGAAGG + Intergenic
1195419624 X:104659411-104659433 GTACCCAGTTGCTAACAGGCAGG + Intronic
1196758315 X:119177410-119177432 GGACCCAGGGTTTCAAGGGCAGG + Intergenic
1199778270 X:151034717-151034739 GGACCTTGTGGGTCACGGGAAGG - Intergenic