ID: 1014674706

View in Genome Browser
Species Human (GRCh38)
Location 6:124349283-124349305
Sequence CTTTGTAGGGGGGAGCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 288}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014674706_1014674720 21 Left 1014674706 6:124349283-124349305 CCAGCCTGCTCCCCCCTACAAAG 0: 1
1: 0
2: 1
3: 20
4: 288
Right 1014674720 6:124349327-124349349 ACCCCATTCTCCCAGTGCACAGG 0: 13
1: 32
2: 70
3: 99
4: 363
1014674706_1014674726 30 Left 1014674706 6:124349283-124349305 CCAGCCTGCTCCCCCCTACAAAG 0: 1
1: 0
2: 1
3: 20
4: 288
Right 1014674726 6:124349336-124349358 TCCCAGTGCACAGGCCGGTTGGG 0: 1
1: 1
2: 4
3: 19
4: 99
1014674706_1014674725 29 Left 1014674706 6:124349283-124349305 CCAGCCTGCTCCCCCCTACAAAG 0: 1
1: 0
2: 1
3: 20
4: 288
Right 1014674725 6:124349335-124349357 CTCCCAGTGCACAGGCCGGTTGG 0: 4
1: 25
2: 73
3: 121
4: 212
1014674706_1014674716 -6 Left 1014674706 6:124349283-124349305 CCAGCCTGCTCCCCCCTACAAAG 0: 1
1: 0
2: 1
3: 20
4: 288
Right 1014674716 6:124349300-124349322 ACAAAGGCGGGAACTTCCCGAGG No data
1014674706_1014674724 25 Left 1014674706 6:124349283-124349305 CCAGCCTGCTCCCCCCTACAAAG 0: 1
1: 0
2: 1
3: 20
4: 288
Right 1014674724 6:124349331-124349353 CATTCTCCCAGTGCACAGGCCGG 0: 11
1: 19
2: 40
3: 124
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014674706 Original CRISPR CTTTGTAGGGGGGAGCAGGC TGG (reversed) Intronic
900891245 1:5451229-5451251 GTTTGCAGTGGGGAGCAGCCTGG + Intergenic
900909671 1:5586193-5586215 ATTTGTGGGGAGGAGCTGGCAGG + Intergenic
901253106 1:7796667-7796689 CTTTGGAGGGGGAAGAAGGGAGG + Intronic
901414328 1:9106319-9106341 GACTGTAGGGGGGAGCAGGAGGG - Intronic
902310547 1:15578589-15578611 CTTAGAAGAGGGGAGGAGGCCGG - Intronic
902472299 1:16657290-16657312 CTCTGTAGGGGGTGGCAGGCTGG + Intergenic
902486504 1:16750156-16750178 CTCTGTAGGGGGTGGCAGGCTGG - Intronic
903228651 1:21908487-21908509 CTTTGCTGGGTGGAGCAGGCTGG - Intronic
903650665 1:24919646-24919668 TTTTGTGGTGGGGAGCAGGATGG + Intronic
905009958 1:34740485-34740507 CTTTCTAGGGGGTATCAGGAAGG - Intronic
905637359 1:39563661-39563683 ATTTGTAGGGGGCAACAGCCCGG + Exonic
905775122 1:40663457-40663479 CTGGGGAGGGGGGAGCAGGCTGG - Intronic
906215442 1:44035640-44035662 CACTGTAGGGAGGAACAGGCTGG + Intergenic
907483072 1:54758025-54758047 CTTCTTAGGGGGGATGAGGCAGG + Exonic
909564498 1:77039541-77039563 CTTTGTATGTGGCAGCAGGTAGG + Intronic
909736805 1:78971459-78971481 CTTTGCAGGGGGGAAAAGCCTGG + Intronic
910430786 1:87157651-87157673 TTGTGTCTGGGGGAGCAGGCAGG + Intronic
911275432 1:95853268-95853290 CTTAGGAGCTGGGAGCAGGCAGG + Intergenic
912382437 1:109254745-109254767 CTTTGAAGGGTGGGGCAGGGAGG - Intronic
912649504 1:111425333-111425355 CCTGGGAGGGTGGAGCAGGCTGG - Intronic
912664490 1:111566879-111566901 TTTTGGAGGGGGGAGGAGGAAGG + Intronic
914246813 1:145892360-145892382 CTGTGGAGTGGGGAACAGGCAGG + Exonic
917076751 1:171214062-171214084 ATTTGTAGTGGGGAGGAGCCTGG - Intergenic
917452341 1:175157679-175157701 TTTTCTTGGGGGGAGCAGGGAGG - Intronic
919837100 1:201582568-201582590 CTCTGTGTGGGGGAGCTGGCTGG - Intergenic
920049212 1:203153167-203153189 CTTTGAGTGGGGGAGCTGGCAGG + Intronic
923913845 1:238481381-238481403 ATTTGTAGCTGGGAGCAGCCTGG - Intergenic
924502532 1:244651122-244651144 CATTTTGGGGAGGAGCAGGCTGG - Intergenic
1064944203 10:20770240-20770262 CCTTGAAGGTGGGAGCAGGGTGG + Intergenic
1065976449 10:30846689-30846711 CTTGGAAGCTGGGAGCAGGCAGG + Intronic
1067807465 10:49403092-49403114 CTATTTAGGGGGCAGCAGCCGGG - Intergenic
1068760881 10:60708013-60708035 CTTTGCAGTGGGGAGGAGCCTGG - Intronic
1069245127 10:66194860-66194882 CTTTGTGGTGGGGAAAAGGCAGG - Intronic
1069877924 10:71574523-71574545 CGTCCTTGGGGGGAGCAGGCTGG - Intronic
1070770050 10:79077032-79077054 CTGTGTATGGGGAAGCAGGGAGG + Intronic
1071315574 10:84392751-84392773 CTTTTTTGGGGTGTGCAGGCTGG + Intronic
1071435753 10:85646988-85647010 CTTTGTAGAGTGGTGCTGGCTGG - Intronic
1071907384 10:90188645-90188667 CTTTGCAGTGGGGAGGAGCCTGG - Intergenic
1072620376 10:97075402-97075424 CTCTGTAGGGAGGAGGAGGGAGG + Intronic
1073195439 10:101687182-101687204 TTTTGTAGGGGGGATGAGGATGG - Intronic
1074477500 10:113785831-113785853 ATTTGGAAGGGAGAGCAGGCCGG - Intergenic
1074937906 10:118204362-118204384 GTTGGTTGGGGGCAGCAGGCTGG - Intergenic
1078448637 11:11424111-11424133 CTTTGTTGGGGGCAGCAGGCAGG - Intronic
1080039215 11:27741293-27741315 CTTTGTAGGGGTTAGCTAGCAGG - Intergenic
1080656305 11:34261123-34261145 TTTTTTTGGGGGGGGCAGGCGGG - Intronic
1083732172 11:64658417-64658439 CTCTGCAGGGGAAAGCAGGCTGG - Intronic
1084933588 11:72575383-72575405 CTTTCTTGGTGGGAGCAGGAAGG - Intergenic
1084944428 11:72631117-72631139 CTTTGCAAGGGGGTCCAGGCTGG + Intronic
1085326995 11:75613822-75613844 CTTAGTAGGGGGTTGAAGGCTGG - Intronic
1085814977 11:79727852-79727874 CAGTGTGGGAGGGAGCAGGCAGG + Intergenic
1086312529 11:85550442-85550464 CCTTGCAGGAGGGAGCACGCAGG - Intronic
1086974494 11:93116748-93116770 GTTTGTAGTGGGGAGGAGACTGG + Intergenic
1088933738 11:114378077-114378099 CCTGGTAGGAGGGAGCTGGCTGG + Intergenic
1089008735 11:115114669-115114691 CTCTGTGGGGTGGAGCAGGGTGG - Intergenic
1089395995 11:118136572-118136594 CTTTGGAGGTGGGAGTGGGCTGG - Exonic
1091288969 11:134426397-134426419 CTTTGCAGGGAGGACCAGGCAGG + Intergenic
1091843504 12:3637156-3637178 CACTGAAGGGAGGAGCAGGCAGG + Intronic
1093157607 12:15706253-15706275 CTTTGCAGAGGGGAGGAGCCTGG + Intronic
1094472579 12:30817280-30817302 GTTTGTAGGGGGGAGGAGCCTGG + Intergenic
1094741206 12:33291135-33291157 TTTTGTTGGGGGAAGAAGGCAGG + Intergenic
1096303757 12:50456074-50456096 TTTTGGAGGGGGGAGCGGGGAGG - Intronic
1098436874 12:70476959-70476981 CTTTGTAGCGAGGAGGAGCCTGG + Intergenic
1098805985 12:75020541-75020563 CTTTGCAGTGGGGAGGAGCCTGG - Intergenic
1099224312 12:79950781-79950803 TTTTGTAGGGGGGTGGGGGCAGG + Intergenic
1099529024 12:83752769-83752791 ATTTGTAGAGGGGAGGAGCCTGG + Intergenic
1102016107 12:109648912-109648934 CCTTGGTGAGGGGAGCAGGCAGG + Intergenic
1102214405 12:111150298-111150320 CTTTTTTGGGGGGAGGAGGAAGG - Intronic
1102222295 12:111202674-111202696 CATTGGAGGGGGCAGGAGGCGGG + Intronic
1103413720 12:120730458-120730480 CTGTGTAGGGAGGAGGAGGCTGG + Intronic
1105509646 13:21040642-21040664 CTCTGTAGAGGGGAGCATGTGGG + Intronic
1106541702 13:30696493-30696515 CTTTCTAGGGTGAAGCAGCCAGG - Intergenic
1106943862 13:34803727-34803749 CTTTGCAGGGGGAAGGAGCCTGG - Intergenic
1106995175 13:35472334-35472356 CTTTCTGGGAGGGAGCAGGAAGG + Intronic
1108119169 13:47164626-47164648 CTTTGAAGGGTAGAGGAGGCTGG - Intergenic
1109313911 13:60727392-60727414 CCTTGTGGGAGGGAGCATGCAGG + Intergenic
1112192448 13:97191278-97191300 CTTTGCAGTGGGGAGGAGCCTGG + Intergenic
1112605772 13:100904445-100904467 TTTTGCAGGGGGGAGGAGACTGG - Intergenic
1113338706 13:109401477-109401499 CTTTGCAGAGGGGAGGAGCCTGG + Intergenic
1114270516 14:21097963-21097985 CTTTGTAGGGGCCCGAAGGCAGG - Intronic
1114387169 14:22267446-22267468 CTTTGCAGTGGGGAGGAGCCAGG - Intergenic
1114424889 14:22613240-22613262 TTTTATAGGGAGGAGAAGGCAGG + Intergenic
1115166542 14:30454401-30454423 CTTTTTTGTGGGGAGCAGGAGGG - Intergenic
1116594190 14:46819332-46819354 CTTTGGAGTGGGGAGGAGCCTGG + Intergenic
1116861088 14:49996153-49996175 CTTTGTTGGAGGGAGAAGGAAGG + Intronic
1117639681 14:57785356-57785378 CATTGTCAGGGGAAGCAGGCAGG - Intronic
1118378011 14:65193533-65193555 CTTTGCAGGGGAGAGGAGCCTGG - Intergenic
1119173894 14:72555144-72555166 CTTTCTAAGGTGGGGCAGGCAGG - Intronic
1120888296 14:89469291-89469313 CCTTGGAGAGGGGAGGAGGCAGG - Intronic
1121266869 14:92609534-92609556 TTTTGTTGGGAGGAGTAGGCTGG + Intronic
1121533902 14:94677954-94677976 CCTTGTAGGAGGGAGCCTGCAGG - Intergenic
1122812962 14:104297982-104298004 CCTGGGATGGGGGAGCAGGCAGG + Intergenic
1123818498 15:24002946-24002968 CCTTGAAGGAGGGAGCAGCCAGG - Intergenic
1124022683 15:25938802-25938824 TTTTGGAGGGGGGAGGGGGCAGG + Intergenic
1124662805 15:31563798-31563820 CTATGCAGAGGGGAACAGGCAGG + Intronic
1126212167 15:46111877-46111899 CCTTGCAGGAGGGAGCATGCAGG - Intergenic
1126722842 15:51600385-51600407 ATTTGTAGGTTGGAGCAAGCAGG - Intronic
1127372672 15:58355575-58355597 CTTTTGGGCGGGGAGCAGGCAGG - Intronic
1128964128 15:72040401-72040423 ATTTGCAGGGGGGAGGAGCCTGG + Intronic
1130749756 15:86698478-86698500 CTGTGTATGGGGGTGCAGGTGGG - Intronic
1131885082 15:96903768-96903790 CTTTGCAGTGGGGAGGAGCCTGG + Intergenic
1132818864 16:1851125-1851147 CTCTGGATGGGGTAGCAGGCTGG - Intronic
1133542757 16:6772378-6772400 CTTTGGAGGTGGGCACAGGCTGG + Intronic
1135258681 16:20962666-20962688 CTTTTTTGGGGGGAGGGGGCAGG + Intronic
1137666350 16:50251858-50251880 CTCTGCGTGGGGGAGCAGGCCGG - Intronic
1137815954 16:51397650-51397672 ATTTGTAGGGGGCAGGAGCCTGG - Intergenic
1138202292 16:55099137-55099159 TTTTCTAGGGGGGAGGGGGCGGG - Intergenic
1138350222 16:56342390-56342412 CTGTGGAGGGGGCAGCAGGGAGG - Intronic
1139268337 16:65660099-65660121 CTGTGTAGAGGGGAGAACGCAGG + Intergenic
1140684310 16:77418553-77418575 CTTTCTAGGGGGAAGCTGTCTGG - Intronic
1141330719 16:83108522-83108544 CTTTGCAGTGGGGAGGAGCCTGG - Intronic
1143312341 17:6002474-6002496 TGTAGTAGCGGGGAGCAGGCAGG + Intronic
1143514298 17:7411657-7411679 CCTTGTGGGGGGCGGCAGGCAGG + Intronic
1144796156 17:17892602-17892624 CTTGGGGTGGGGGAGCAGGCAGG - Intronic
1144956530 17:19021524-19021546 CTTTTGAGGGAGGGGCAGGCAGG + Exonic
1146680358 17:34802945-34802967 CTCTGTAGGCTGGAGCAGACAGG - Intergenic
1147795487 17:43039455-43039477 CTCTGTAGGGGTGAGCGGGAAGG + Intergenic
1148247923 17:46047615-46047637 CTTTGTAGGGGGCGGGAGGCGGG + Intronic
1149548905 17:57525266-57525288 CTTTTTTGGGGGGGGCAGGTGGG + Intronic
1150625488 17:66838472-66838494 CCTTGTGGGGAGGAGAAGGCTGG + Intronic
1151482842 17:74380300-74380322 CTTCGGAGGGAGGGGCAGGCAGG + Intergenic
1152377990 17:79928521-79928543 TTTTTTAAGAGGGAGCAGGCTGG - Intergenic
1152644161 17:81461164-81461186 CTTCGTCGGGGGGACCGGGCCGG + Exonic
1154370937 18:13762603-13762625 GTGTGGATGGGGGAGCAGGCTGG - Exonic
1155062596 18:22241948-22241970 CTTTGAGGTGAGGAGCAGGCAGG - Intergenic
1155479692 18:26272082-26272104 CTTTGCAAGGGGGAGGAGCCTGG - Intronic
1155765732 18:29629939-29629961 CTTTGTAGAAGGGAGGAGGCAGG - Intergenic
1155797634 18:30059969-30059991 CTTTGCAGCGGGGAGGAGCCTGG - Intergenic
1156560767 18:38122991-38123013 CATTGTTGGGGGTAGGAGGCAGG + Intergenic
1159889425 18:73940082-73940104 CTCTGTAGGGAGGCCCAGGCAGG - Intergenic
1160772840 19:840814-840836 CTTTGTGGGGGCGGGGAGGCTGG - Intergenic
1161983705 19:7643228-7643250 CTGTGTAGTGTGGAGCAGGTGGG + Exonic
1163299577 19:16435425-16435447 CTTTGGAGGGTGGAACAGACTGG - Intronic
1164631292 19:29763116-29763138 CTCTTGAGGGGGCAGCAGGCTGG - Intergenic
1167040796 19:47021465-47021487 CTCTGGAGGTGGGAGCAGACCGG - Intronic
1167440927 19:49508386-49508408 CTTTGGAGAGGGAGGCAGGCGGG + Intronic
1168109905 19:54186526-54186548 ATGTGTGGAGGGGAGCAGGCTGG - Intronic
1202704696 1_KI270713v1_random:14084-14106 CTCTGTAGGGGGTGGCAGGCTGG + Intergenic
925027997 2:624771-624793 CTCTGCAGGGAGGAGCTGGCAGG + Intergenic
926153704 2:10438895-10438917 CCTTGTACATGGGAGCAGGCAGG - Intergenic
928205733 2:29282021-29282043 CTTTGGAGGGCAGAGCAGGATGG + Intronic
928813386 2:35256962-35256984 CTTTGTGGGGAGGCCCAGGCAGG + Intergenic
928982922 2:37155155-37155177 CATTTTAGGAGGGAGCAGGTTGG - Intronic
929965038 2:46528397-46528419 CTTTGAAGGTGGGAACAGGGTGG + Intronic
930088773 2:47516968-47516990 CTTTGTAGGGTGGAGAGGGAGGG - Exonic
930235787 2:48887811-48887833 TGTTGTAGGGGGGAAAAGGCTGG + Intergenic
931807851 2:65825359-65825381 CTTCTAAAGGGGGAGCAGGCAGG + Intergenic
932333159 2:70912326-70912348 ATTTGTAGGTGGGGGCAGGAAGG + Intronic
933727825 2:85436554-85436576 CTTGGTGGGGAAGAGCAGGCAGG - Exonic
933901753 2:86855139-86855161 GGTTGTAAGGGGGAACAGGCAGG + Intronic
934168497 2:89319461-89319483 TTTTGTAGAGGGGACCAGGGAGG - Intergenic
934198790 2:89863121-89863143 TTTTGTAGAGGGGACCAGGGAGG + Intergenic
935778795 2:106494124-106494146 GGTTGTAAGGGGGAACAGGCAGG - Intergenic
936165216 2:110114964-110114986 CTCTGCAGATGGGAGCAGGCAGG + Intronic
937111847 2:119372700-119372722 CTTTGTGGGGAGGAGGAGGATGG + Intergenic
938973883 2:136457427-136457449 CTTTGAAGGAGGGAGTAGGGAGG + Intergenic
940699635 2:157024497-157024519 CGTTGTAGGAGGGATCAGGTAGG + Intergenic
942116509 2:172734765-172734787 GTTTGGTGGGGGGAGGAGGCAGG + Intergenic
943442053 2:187937189-187937211 CTTTGTTAGGGGGTGCAGGGAGG - Intergenic
944821707 2:203439469-203439491 CTCTTTTGGGGGGAGCAGGAGGG + Exonic
945025423 2:205615630-205615652 CTTTGTGCTGGGGAGCTGGCGGG - Exonic
947136254 2:226979440-226979462 ATTTGCAGGGGGGAGGAGCCTGG - Intronic
947214356 2:227736459-227736481 CTTGGGAGGAGGGAGCTGGCTGG + Intergenic
1168811734 20:709282-709304 TTTTGTAGGGGTGAGGAGACAGG - Intergenic
1172274267 20:33671251-33671273 CTCTGTAGGCAGCAGCAGGCTGG + Intronic
1172637112 20:36417332-36417354 CTTTGGTGGGCTGAGCAGGCTGG + Intronic
1175724479 20:61308396-61308418 TTTTGTGGGGAGGAGAAGGCAGG + Intronic
1175870756 20:62208398-62208420 CCTGGTAGGGGGCGGCAGGCTGG - Intergenic
1177357917 21:20032134-20032156 CTTGGGAGCTGGGAGCAGGCAGG - Intergenic
1178007610 21:28240649-28240671 CTGTGGAGGAGGGAGGAGGCAGG - Intergenic
1178580070 21:33831136-33831158 CTTTGGATGGGGGAGGATGCGGG - Intronic
1179605967 21:42515093-42515115 CTTTGTTGGGGGTTGGAGGCAGG + Intronic
1181964395 22:26646413-26646435 CTGTGTGGGGGTGGGCAGGCTGG + Intergenic
1183131480 22:35840652-35840674 GTGTGTAGGGGGGAGGAGGTAGG + Intronic
1183606144 22:38867669-38867691 CTTGGTGCGGGGGAGCAGGGAGG - Intronic
1184462276 22:44645971-44645993 CATTGGGGGAGGGAGCAGGCAGG - Intergenic
949588690 3:5469610-5469632 CTTTGTATGGGGAAACCGGCGGG + Intergenic
950472749 3:13196784-13196806 GTGTGTGGTGGGGAGCAGGCTGG + Intergenic
950548397 3:13652579-13652601 AGTTGAAGGGAGGAGCAGGCTGG + Intergenic
950793982 3:15495831-15495853 AGTTGTAGGGTGGAGGAGGCTGG + Intronic
951342931 3:21510999-21511021 CTTTGTAGTGGGCCGCAGCCTGG + Exonic
951346088 3:21548009-21548031 GTTTGTAGTGGGGAGGAGCCTGG + Intronic
954009481 3:47622705-47622727 TTTTCTAGGGGTGGGCAGGCAGG + Intronic
954385398 3:50241348-50241370 CTTTGTCTGCAGGAGCAGGCAGG + Intronic
956073995 3:65485266-65485288 TTTTGTAGGGTGGGGCAGGTAGG - Intronic
956525047 3:70149513-70149535 CTTGGCAGGGGGTAGCAGGTGGG + Intergenic
958974674 3:100654095-100654117 CTTTGCAGAGGGGAGGAGCCTGG - Intronic
959236006 3:103722464-103722486 TTTTGTAGGGAGGTGAAGGCTGG + Intergenic
959335940 3:105065724-105065746 CTTGGTAGGGTGGAGCAAGATGG + Intergenic
960584543 3:119308950-119308972 CTTCTTAGGGGGGATGAGGCGGG - Intronic
961863291 3:129935075-129935097 CTTTGGAGGATGGAGCAGACAGG - Intergenic
962756313 3:138467851-138467873 CATTATAGGGGAGGGCAGGCTGG + Intronic
963575586 3:147058164-147058186 CTGTGTAGGGAGGGGCAGACAGG - Intergenic
963704138 3:148664990-148665012 CTTGGTAGAGGGGATCAAGCTGG - Intergenic
964362010 3:155908286-155908308 CTTTGCAGGAGGGAGGAGCCTGG + Intronic
964523824 3:157595730-157595752 CTTTGGAGGGGAGGGCAGGATGG - Intronic
965524717 3:169703567-169703589 CTTAGGAGGAGGGAGCAGACTGG + Intergenic
969111371 4:4846354-4846376 CTTTGTAGGGAAGACTAGGCAGG - Intergenic
969190683 4:5516272-5516294 CTTTGCAGCGGGGAGGAGCCCGG + Intergenic
970721316 4:18992596-18992618 CTTTGCAGCGGGGAGGAGCCTGG + Intergenic
972300946 4:37785114-37785136 CCTTGTAGGAGGGAGCAGACAGG - Intergenic
976041977 4:80897932-80897954 CCTTGCAGGAGGGAGCATGCAGG + Intronic
976724511 4:88202610-88202632 CTTTGCAGTGGGGAGGAGCCTGG - Intronic
977275494 4:94973017-94973039 CCTTGTGGGAGGGAGCAGGTAGG + Intronic
977685643 4:99844255-99844277 CTTTGCAGTGGGGAGGAGCCTGG - Intronic
979184417 4:117770828-117770850 CCTTGTGGGAGGGAGCATGCAGG - Intergenic
979596682 4:122542181-122542203 CCTTGTGGGAGGGAGCATGCAGG - Intergenic
979832928 4:125322675-125322697 CTTTTTTGGGGGGAGGAGGTGGG + Intronic
982668175 4:158291598-158291620 CTCAGTGGGGAGGAGCAGGCAGG - Intergenic
983067739 4:163230596-163230618 CTTTGTAGGGGGAGGCACGGGGG - Intergenic
983192879 4:164773192-164773214 CTTGGTAGGGAGAAGGAGGCTGG + Intergenic
983809685 4:172045262-172045284 CTTTGTACAGTGGAGCAGGTGGG + Intronic
985239426 4:187914432-187914454 CTTTGAAGAGGGGAACAGGCCGG + Intergenic
985585895 5:733877-733899 CTTTGTGGGGGGGCTCAGGGTGG + Intronic
985600312 5:825289-825311 CTTTGTAGGGGGACTCAGGGTGG + Intronic
985645127 5:1081341-1081363 TTTTGTAGAGGGGGGCAGCCGGG - Intronic
985776664 5:1847895-1847917 CTTTGCTGGTAGGAGCAGGCTGG + Intergenic
985936467 5:3101498-3101520 GTTGGGAGAGGGGAGCAGGCGGG - Intergenic
986177828 5:5366904-5366926 CTTTGCAAGGGGGAGTAGCCTGG - Intergenic
989379507 5:40798887-40798909 CTCTGTTGCGAGGAGCAGGCTGG + Intergenic
991932357 5:71766229-71766251 CTTTGTGAGTGGGAGGAGGCAGG + Intergenic
994761490 5:103859914-103859936 CTTTGTAAGAGGGAGCTGGGAGG + Intergenic
996094100 5:119379923-119379945 CTTTATCTGGGGGAGCAGGCAGG + Intronic
997932590 5:138084429-138084451 CTGTGGTTGGGGGAGCAGGCAGG - Intronic
998522472 5:142813420-142813442 CTTTGAAGGGCAGAGCAGTCTGG - Intronic
1000241818 5:159415756-159415778 CTTTGCAGGAGGGAGGAGTCTGG + Intergenic
1000866214 5:166518292-166518314 CTTCGTGGGAGGGAGCATGCAGG + Intergenic
1001915617 5:175557870-175557892 ATTTGCAGGGGGGAGGAGCCTGG - Intergenic
1002038797 5:176495363-176495385 CTTTGCAGGGGGCAGAAGGGAGG + Intronic
1003196536 6:3919978-3920000 CTTTGCAGCGGGGAGGAGCCTGG - Intergenic
1004017593 6:11746414-11746436 CTTTGTGGTGGGGGGTAGGCTGG + Intronic
1006017187 6:31091223-31091245 CTTTGCAGCGGGGAGCAGCCTGG + Intergenic
1006630689 6:35427768-35427790 CTTGGGAGGGAGGACCAGGCAGG - Exonic
1008541800 6:52552206-52552228 CTTTGCATGGGGGAGGAGCCTGG - Intronic
1008675016 6:53810042-53810064 CTCTGTAGCGGGAAGCAGGTAGG + Intronic
1009534960 6:64870409-64870431 TTTTGGAGGGGGGAGGAGGGGGG - Intronic
1009846998 6:69146482-69146504 CTTGGGAGCTGGGAGCAGGCAGG - Intronic
1010872280 6:81058423-81058445 CTTTGCAGTGGGGAGGAGCCTGG - Intergenic
1011133522 6:84075444-84075466 TTTTGTATGGTGGGGCAGGCAGG + Intronic
1011753804 6:90478975-90478997 CTTTCTAGAGGCAAGCAGGCTGG + Intergenic
1012843225 6:104356380-104356402 CTTTGTGGGAGGGACCATGCAGG - Intergenic
1013988548 6:116225928-116225950 CTTTGGAGGGGGGTGGAGGCTGG + Intronic
1014674706 6:124349283-124349305 CTTTGTAGGGGGGAGCAGGCTGG - Intronic
1015266321 6:131295257-131295279 CTTTGCAGCGGGGAGGAGCCTGG + Intergenic
1016162498 6:140898437-140898459 CTTTGCAGGGAGGAGGAGCCTGG - Intergenic
1016187305 6:141212479-141212501 CTTTGCAGTGGGGAGGAGCCTGG - Intergenic
1016233489 6:141833437-141833459 CTTTGCAGGCGGGAGGAGCCTGG + Intergenic
1018426971 6:163691811-163691833 CTTGGTAACAGGGAGCAGGCTGG + Intergenic
1020408812 7:7867629-7867651 CTCAGTAGAGGGGTGCAGGCAGG + Intronic
1021196772 7:17682466-17682488 CTTTGTTGGGAGGATGAGGCGGG + Intergenic
1022084492 7:27053349-27053371 CTTTGCATGGGGGAGGAGTCTGG - Intergenic
1022322087 7:29297227-29297249 CTTTGCAGGGGCGAGGAGCCTGG - Intronic
1022322499 7:29300069-29300091 CTTTGCAGTGGGGAGGAGCCTGG + Intronic
1023624081 7:42099028-42099050 CTTGGCACGGGGGAGCAGGCAGG - Intronic
1023852613 7:44158743-44158765 CTTTTATGGGGGGAGCTGGCTGG - Intronic
1024670661 7:51591013-51591035 CTTCCTAGAGGGGAGGAGGCAGG + Intergenic
1025747185 7:64253410-64253432 CTTTGCTGGTGTGAGCAGGCTGG - Intronic
1028849742 7:95524852-95524874 GTTTGCAGTGGGGAGCAGCCTGG + Intronic
1029370824 7:100149345-100149367 CCATGTAGGGGGGAGGGGGCCGG + Intronic
1029433277 7:100546264-100546286 CCTTGTTAGGGGGAGGAGGCAGG - Intronic
1030139686 7:106291943-106291965 CTTTGCAGTGGGGAGAAGCCTGG + Intergenic
1033206449 7:139427180-139427202 CCGAGTAGGGGAGAGCAGGCAGG + Intergenic
1035062391 7:156079296-156079318 CTGAGTGTGGGGGAGCAGGCAGG - Intergenic
1036685676 8:10908411-10908433 CCTGGGAGGGGGAAGCAGGCTGG - Intronic
1037259836 8:16996062-16996084 CTTTGCAGCGGGGAGGAGCCTGG + Intronic
1037315535 8:17595874-17595896 CTTTTGAGGGAGGGGCAGGCAGG + Intronic
1037412499 8:18613336-18613358 GTTTGCAGGGGGGAGGAGCCTGG + Intronic
1037719312 8:21429391-21429413 CTTTCTAGGGGAGAGAGGGCAGG + Intergenic
1038200746 8:25410465-25410487 CTTTTTAGGGGGGCGGGGGCAGG + Intronic
1038405580 8:27320083-27320105 GTTTGTAGTGGGGAGGAGTCTGG + Intronic
1039177013 8:34820148-34820170 CTTTGGAGAGGGGAGGAGGAAGG + Intergenic
1040822138 8:51573389-51573411 CTTTCCAGTGGGGAGCAGGAAGG - Intronic
1040949700 8:52925068-52925090 CTTTGCAGTGGGGAGGAGCCTGG + Intergenic
1041367301 8:57121587-57121609 TTTTGTAGGGTGAAGAAGGCAGG - Intergenic
1041460200 8:58103090-58103112 CTTTGTAAGGGGGTACAGGAAGG + Intronic
1043571681 8:81610875-81610897 CTTTGTGAGGGAGAGCAGGGAGG + Intergenic
1044274608 8:90285343-90285365 CCTTGTGGGAGGGAGCATGCAGG + Intergenic
1044494671 8:92862613-92862635 CATTGTAATTGGGAGCAGGCTGG + Intergenic
1045381885 8:101635470-101635492 CTTTGTAGAGGCCAGCAGTCAGG + Intronic
1046132902 8:109990351-109990373 CTTTGCATGGGGGAGAAGCCTGG - Intergenic
1048974652 8:139664404-139664426 CTGTGTAGGGGAGGGGAGGCGGG - Intronic
1049539598 8:143202060-143202082 CTGGGTAGCGGGGAGCTGGCAGG - Intergenic
1052216495 9:25972498-25972520 CCTTGTAGGAGGAAGCAGGTAGG - Intergenic
1052693568 9:31848632-31848654 CTTTGCAGCGGGGAGGAGCCTGG + Intergenic
1053141078 9:35683080-35683102 CTATGGGGAGGGGAGCAGGCAGG - Intronic
1057259863 9:93577255-93577277 CTTCGCAGGGGGGAGGCGGCGGG - Intronic
1057291259 9:93808889-93808911 CTATGTAAGTGGGAGCAGGTGGG - Intergenic
1058282473 9:103132384-103132406 ATTTGCAGGGGGGAGGAGCCTGG - Intergenic
1060231720 9:121830409-121830431 CTGTGCAGTGGGGAGCAGGGAGG - Intronic
1060801384 9:126547814-126547836 CCTTGGTGAGGGGAGCAGGCTGG - Intergenic
1061078499 9:128355923-128355945 CTGTGTAGAGGTGAGCAGACGGG + Intronic
1062444862 9:136589332-136589354 CCTGGTAGGGGGGTGCAGGTGGG + Intergenic
1185880054 X:3732780-3732802 CTTTGCAGCGGGGAGGAGACTGG - Intergenic
1187492371 X:19764108-19764130 TTTTGAAGTGGGGAGCAGGTGGG - Intronic
1188375305 X:29421351-29421373 CTTTGCAGCGGGGAGGAGCCTGG - Intronic
1189723578 X:43945962-43945984 CTTTTTAAGGGGGATCTGGCTGG + Intergenic
1189851353 X:45179173-45179195 CTTTGTTGGGGGAAGGAGGCTGG - Intronic
1189883369 X:45514301-45514323 CTTGGAAAGAGGGAGCAGGCAGG + Intergenic
1190576799 X:51847653-51847675 CTTTGCAGTGGGGAGGAGCCTGG - Intronic
1194448296 X:94012911-94012933 GTTTGTAGACGGGAGCAGCCTGG - Intergenic
1194653058 X:96538452-96538474 ATTTGCAGGGGGGAGGAGCCTGG + Intergenic
1194809654 X:98375029-98375051 CTTTGCAGGGGGGAGGAGCCTGG - Intergenic
1194810331 X:98380705-98380727 CTTTGCAGTGGGGAGGAGCCTGG - Intergenic
1195937929 X:110143018-110143040 CTTGGTTGGGGAGAGCAGCCTGG + Intronic
1195997449 X:110745436-110745458 CTGTGTAGGAGGGAGGAGGCTGG - Intronic
1197425679 X:126294984-126295006 CTTTGCAGTGGGGAGGAGCCTGG - Intergenic
1197929265 X:131678417-131678439 CTATGGAGAGGGGAGCAGGCAGG - Intergenic
1197946062 X:131841033-131841055 CTATGGAGAGGGGAGCAGGTAGG + Intergenic
1198939189 X:141934448-141934470 ATTTGTAGGGGGTAGGAGCCTGG + Intergenic
1199169283 X:144717464-144717486 CTTTGCAGGGGGCAGAAGCCTGG + Intergenic
1200785808 Y:7259427-7259449 CTTTGCAGCGGGGAGGAGCCTGG + Intergenic