ID: 1014674708

View in Genome Browser
Species Human (GRCh38)
Location 6:124349287-124349309
Sequence CCGCCTTTGTAGGGGGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 103}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014674708_1014674716 -10 Left 1014674708 6:124349287-124349309 CCTGCTCCCCCCTACAAAGGCGG 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1014674716 6:124349300-124349322 ACAAAGGCGGGAACTTCCCGAGG No data
1014674708_1014674724 21 Left 1014674708 6:124349287-124349309 CCTGCTCCCCCCTACAAAGGCGG 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1014674724 6:124349331-124349353 CATTCTCCCAGTGCACAGGCCGG 0: 11
1: 19
2: 40
3: 124
4: 344
1014674708_1014674720 17 Left 1014674708 6:124349287-124349309 CCTGCTCCCCCCTACAAAGGCGG 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1014674720 6:124349327-124349349 ACCCCATTCTCCCAGTGCACAGG 0: 13
1: 32
2: 70
3: 99
4: 363
1014674708_1014674725 25 Left 1014674708 6:124349287-124349309 CCTGCTCCCCCCTACAAAGGCGG 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1014674725 6:124349335-124349357 CTCCCAGTGCACAGGCCGGTTGG 0: 4
1: 25
2: 73
3: 121
4: 212
1014674708_1014674726 26 Left 1014674708 6:124349287-124349309 CCTGCTCCCCCCTACAAAGGCGG 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1014674726 6:124349336-124349358 TCCCAGTGCACAGGCCGGTTGGG 0: 1
1: 1
2: 4
3: 19
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014674708 Original CRISPR CCGCCTTTGTAGGGGGGAGC AGG (reversed) Intronic
901457426 1:9371286-9371308 CTTCCTTTGAAGGGGGCAGCAGG + Intergenic
904495534 1:30884374-30884396 CTGCCTTTGTAGATGGGAGTAGG - Intronic
904660928 1:32084259-32084281 ATGCCTTTGTAGGGGGAAGCAGG - Intronic
913453210 1:119006935-119006957 CTGCCTTTGTCGGGGCGGGCGGG + Intergenic
914193504 1:145431293-145431315 CCGCCGTTGCAGGCGGGAGTTGG + Intergenic
914474833 1:148014183-148014205 CCGCCGTTGCAGGCGGGAGTTGG + Intergenic
915311792 1:155008854-155008876 GCCCCTTTGAAGGAGGGAGCTGG + Intronic
915919934 1:159968565-159968587 CCTTCTTTGTAGGGGAGAGAGGG + Intergenic
1064083070 10:12323965-12323987 CCCCCTTTGTGGGGGGGGGGGGG - Intergenic
1067837553 10:49651001-49651023 CAGCCTCTGGAGGGTGGAGCTGG - Intronic
1074686261 10:115964917-115964939 CCTCCTCTGAAGGGGAGAGCTGG + Intergenic
1076118530 10:127918094-127918116 CCTACTTTGTAAGTGGGAGCAGG - Intronic
1076692315 10:132230136-132230158 CCGCCTTGGGAGGGCGGGGCGGG + Intronic
1076727818 10:132421592-132421614 CCGCCTCTGTAGGGTGGGGGCGG - Intergenic
1078326241 11:10383547-10383569 CCGGCTCTGAAGGAGGGAGCCGG - Intronic
1083778287 11:64905405-64905427 CCGCCTTTCTAGAGGGCAGTTGG - Intronic
1087608343 11:100404904-100404926 CCCCCTTTGTAGGCAGGAACTGG + Intergenic
1090968484 11:131619081-131619103 CTGCCTTTGGAGGGCGTAGCTGG + Intronic
1092926672 12:13278370-13278392 CCGCCTCTGTGCAGGGGAGCAGG + Intergenic
1094312592 12:29100902-29100924 CCTCCTTTGTTGGGGGGAAGAGG + Intergenic
1094443206 12:30502084-30502106 CCTCCTTTTTAGGGGGAAGGAGG - Intergenic
1096145610 12:49276741-49276763 CGGCCTCTGTGGGGGGAAGCAGG - Intergenic
1114712258 14:24790472-24790494 CCACTTTTGTAGGAGGGACCTGG + Intergenic
1118724021 14:68614231-68614253 TAGCCTTTGTAGGGAGGAGTTGG + Intronic
1122651249 14:103228363-103228385 CAGCCTTTGCAGGGATGAGCGGG + Intergenic
1123997723 15:25730377-25730399 CTGCCTCTCTAGGAGGGAGCAGG - Intronic
1126367295 15:47908304-47908326 CTGCCTTTGCAGAGGGAAGCTGG + Intergenic
1129350303 15:74952115-74952137 CAGCCTTGGTGGTGGGGAGCGGG + Intergenic
1132467490 16:84169-84191 CCACCTCAGTAGGGAGGAGCAGG - Intronic
1134035346 16:11025840-11025862 CTGCCTTTGAAGAGGAGAGCTGG - Intronic
1134271378 16:12736083-12736105 CTGACTTTGTAAGGGTGAGCAGG + Intronic
1135047949 16:19169309-19169331 CAGCCTTTTTTGGGGGGAGGGGG + Intronic
1139745772 16:69073331-69073353 CCGCCTTTGGAGGTGGGTGGAGG - Intronic
1142865190 17:2786505-2786527 CCGCCTTAGCAGGGGAGGGCGGG + Intronic
1144953898 17:19009558-19009580 CTGCCATTGCAGGAGGGAGCAGG - Intronic
1145909225 17:28533049-28533071 CAGCCTTTCTTGGGGGCAGCTGG - Intronic
1147423997 17:40337006-40337028 GACCCTTTGTAGGTGGGAGCTGG + Intronic
1147819666 17:43234252-43234274 CCGCCTCTGCCTGGGGGAGCCGG + Intergenic
1147821782 17:43246139-43246161 CCGCCTCTGCCTGGGGGAGCCGG + Intergenic
1147822874 17:43252294-43252316 CCGCCTCTGCCTGGGGGAGCCGG + Intergenic
1147825392 17:43267098-43267120 CCGCCTCTGCCTGGGGGAGCCGG + Intergenic
1147826515 17:43273565-43273587 CCGCCTCTGCCTGGGGGAGCCGG + Intergenic
1147827404 17:43278443-43278465 CCGCCTCTGCCTGGGGGAGCCGG + Intergenic
1147828512 17:43284604-43284626 CCGCCTCTGCCTGGGGGAGCCGG + Intergenic
1147829621 17:43290756-43290778 CCGCCTCTGCCTGGGGGAGCCGG + Intergenic
1147831398 17:43300506-43300528 CCGCCTCTGCCTGGGGGAGCCGG + Intergenic
1147870323 17:43582550-43582572 CAGCCTCTGTAGGAGGGACCAGG + Intergenic
1147877542 17:43632317-43632339 CCCTCTTTGTTGGGGGGATCCGG - Intergenic
1151782399 17:76256065-76256087 CCGCCTTTGTATGGGTGAGAAGG - Intergenic
1151795957 17:76345931-76345953 CTGGCTTTGGAGGGAGGAGCAGG - Intronic
1151827616 17:76531867-76531889 CAGACTTGGTAGGGGTGAGCCGG - Intronic
1152897405 17:82920799-82920821 CCTCCTGTGTTGGGGGGAGAGGG - Intronic
1158638071 18:59178701-59178723 CAGTCTTTGCAGGGGGGACCAGG + Intergenic
1160408957 18:78661679-78661701 CCACTTTTGTTGGGTGGAGCAGG + Intergenic
1161461396 19:4400032-4400054 CCGCCTTTGCAGCGGAGAGAAGG + Intronic
1162352223 19:10157826-10157848 CCACCTGTGCAGCGGGGAGCGGG - Intronic
1163397774 19:17074265-17074287 CCGCCTTTGGTGATGGGAGCAGG - Intronic
1165078233 19:33292520-33292542 CATCCTTTGTGGGGGGGAGGGGG + Intergenic
1166358290 19:42240340-42240362 CCTCCTATGTGGAGGGGAGCAGG - Intronic
1167113115 19:47473536-47473558 CCCCTGTTGTGGGGGGGAGCAGG - Intergenic
929058540 2:37900373-37900395 CCCCCTTTGTGGGCGGGAACTGG + Intergenic
931253812 2:60553976-60553998 CCGCGTGTGTGGGGGGGAGCAGG - Intergenic
932767752 2:74482108-74482130 CCGCCTCTTGACGGGGGAGCGGG - Exonic
939069437 2:137521312-137521334 CAGCCTTTGTAGTGGGGAGGGGG + Intronic
944410245 2:199434014-199434036 CCACCTTAGTAGGAAGGAGCTGG - Intronic
945988274 2:216371836-216371858 CCGCCCTTGGTGGGGGTAGCGGG - Exonic
948052248 2:234987557-234987579 CCGCCCATGTTGGGGGGAGGCGG - Intronic
1169912180 20:10655934-10655956 GCCCCTTTGCAGGCGGGAGCTGG - Intronic
1171970506 20:31562092-31562114 CAGCCTTGGTAGTGGGAAGCAGG + Intronic
1172972502 20:38883588-38883610 CTGCCTGTGTAGGGGGTGGCGGG + Intronic
1174039371 20:47688136-47688158 CCGGCTTTCTAGGGGAGAGATGG + Intronic
1174044986 20:47727049-47727071 CAGCCTTTATGGGGGGGGGCGGG + Intronic
1174459657 20:50673415-50673437 CCACCTTTGCAGGGGGTAGCTGG - Intronic
1175244563 20:57573864-57573886 CCGCATTTCTAGTGGGGAGGGGG + Intergenic
1176426399 21:6551174-6551196 CCGCCTGTGTAGGGCGGATGGGG - Intergenic
1179701890 21:43159491-43159513 CCGCCTGTGTAGGGCGGATGGGG - Exonic
949613561 3:5728959-5728981 CCGCCTTTGTAATGGGGGGGGGG + Intergenic
949911015 3:8907979-8908001 CCCCCTTTGTGGGTGGGAACTGG - Intronic
951039018 3:17967582-17967604 CCCCCTTTTTAGCGAGGAGCAGG - Intronic
953967330 3:47319527-47319549 CCGCCTTTGCAGTGGGCAGTGGG + Intronic
959813951 3:110653069-110653091 CCCCCTTAGTAGGCGGGAACTGG - Intergenic
960588057 3:119339128-119339150 CAGCTTTGGTAGGGGAGAGCTGG + Intronic
963141865 3:141952842-141952864 CTGTCTGTGTAGGGGTGAGCCGG - Intronic
968603707 4:1521796-1521818 CCGCCCTTGGAGGGATGAGCTGG - Intergenic
968872734 4:3249916-3249938 CCGCCTCCCTATGGGGGAGCAGG - Intronic
969437122 4:7194561-7194583 CAGCCCTTGGAGGGGAGAGCTGG + Intronic
969566111 4:7979201-7979223 GGGCCTTTGCCGGGGGGAGCTGG - Intronic
1001975849 5:175997739-175997761 CCGCCATTGTAGTGGGGATATGG - Intronic
1002241576 5:177846033-177846055 CCGCCATTGTAGTGGGGATATGG + Intergenic
1007189650 6:40002766-40002788 ACGCCCTTATAGGGGAGAGCTGG + Intergenic
1014674708 6:124349287-124349309 CCGCCTTTGTAGGGGGGAGCAGG - Intronic
1016685706 6:146880036-146880058 CAGCCTTTGTAGAAGGGTGCTGG - Intergenic
1017782413 6:157726096-157726118 CCCCCTTTGTGGGTGGGAACTGG - Intronic
1019123659 6:169825062-169825084 CCACCTGTGCATGGGGGAGCTGG - Intergenic
1021962388 7:25885768-25885790 GCGCCATGGTAGGGGGGAGGTGG + Intergenic
1026876052 7:73879697-73879719 CCCCCTCTGAAGGGTGGAGCTGG + Intergenic
1027360756 7:77406885-77406907 CCGCCTTAGCAGCGGGGAGAGGG - Intronic
1030739103 7:113086746-113086768 CCGCATTTGTAGTGGGGGGCTGG + Intronic
1039586600 8:38712457-38712479 CCTCCTGGGTAGGGTGGAGCCGG + Intergenic
1039848302 8:41341894-41341916 CCACCTCTGTAGGGGGCATCTGG + Intergenic
1047509833 8:125507585-125507607 CCGCCTTGGTTGGGGTGGGCTGG - Intergenic
1048296284 8:133216924-133216946 CCACCTTTAGAGGAGGGAGCAGG + Intronic
1049373132 8:142277174-142277196 CCCCCTGTGTTGGGAGGAGCAGG - Intronic
1052216498 9:25972502-25972524 CAGCCCTTGTAGGAGGAAGCAGG - Intergenic
1055864610 9:80797855-80797877 CCCCCCTTGGTGGGGGGAGCTGG + Intergenic
1057240235 9:93401167-93401189 CCGCCTTTGCAGAGGGTGGCAGG + Intergenic
1057291261 9:93808893-93808915 CCGACTATGTAAGTGGGAGCAGG - Intergenic
1058684082 9:107465689-107465711 CCGCCTTTGCTGGAGGGAGCCGG - Intergenic
1062030100 9:134358362-134358384 CAGCCTGGGTAGGGTGGAGCTGG + Intronic
1190556099 X:51637307-51637329 CCGCCATTGTGTGGAGGAGCAGG + Intergenic
1196899033 X:120365406-120365428 CTGCCTTTGTTGGGGGGAGGAGG - Intronic
1200150486 X:153949017-153949039 CAGCCTTGGGAGGGCGGAGCTGG + Exonic