ID: 1014674712

View in Genome Browser
Species Human (GRCh38)
Location 6:124349294-124349316
Sequence GAAGTTCCCGCCTTTGTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 70}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014674712_1014674729 30 Left 1014674712 6:124349294-124349316 CCCCCTACAAAGGCGGGAACTTC 0: 1
1: 0
2: 0
3: 1
4: 70
Right 1014674729 6:124349347-124349369 AGGCCGGTTGGGTATTCTCCAGG 0: 1
1: 0
2: 3
3: 23
4: 151
1014674712_1014674724 14 Left 1014674712 6:124349294-124349316 CCCCCTACAAAGGCGGGAACTTC 0: 1
1: 0
2: 0
3: 1
4: 70
Right 1014674724 6:124349331-124349353 CATTCTCCCAGTGCACAGGCCGG 0: 11
1: 19
2: 40
3: 124
4: 344
1014674712_1014674726 19 Left 1014674712 6:124349294-124349316 CCCCCTACAAAGGCGGGAACTTC 0: 1
1: 0
2: 0
3: 1
4: 70
Right 1014674726 6:124349336-124349358 TCCCAGTGCACAGGCCGGTTGGG 0: 1
1: 1
2: 4
3: 19
4: 99
1014674712_1014674725 18 Left 1014674712 6:124349294-124349316 CCCCCTACAAAGGCGGGAACTTC 0: 1
1: 0
2: 0
3: 1
4: 70
Right 1014674725 6:124349335-124349357 CTCCCAGTGCACAGGCCGGTTGG 0: 4
1: 25
2: 73
3: 121
4: 212
1014674712_1014674720 10 Left 1014674712 6:124349294-124349316 CCCCCTACAAAGGCGGGAACTTC 0: 1
1: 0
2: 0
3: 1
4: 70
Right 1014674720 6:124349327-124349349 ACCCCATTCTCCCAGTGCACAGG 0: 13
1: 32
2: 70
3: 99
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014674712 Original CRISPR GAAGTTCCCGCCTTTGTAGG GGG (reversed) Intronic
902241915 1:15095184-15095206 GAGGTTCCCGCATTGGTTGGGGG - Intronic
911964769 1:104352456-104352478 GAAGTTCCATCCTTTGAAAGTGG + Intergenic
912487382 1:110039843-110039865 GCAGTTTCCGCCTTGGCAGGAGG + Intronic
914318117 1:146533176-146533198 AAATTTCCCCCTTTTGTAGGGGG + Intergenic
914496240 1:148200181-148200203 AAATTTCCCCCTTTTGTAGGGGG - Intergenic
917302778 1:173594704-173594726 GAAGTTCCTGCCTTATTTGGAGG + Intronic
1062815128 10:493740-493762 TAAGACCCCGACTTTGTAGGTGG - Intronic
1062968376 10:1627334-1627356 GAATTTCTCTCCTTTGTGGGAGG - Intronic
1069080517 10:64083650-64083672 GAAGTAGCTGCATTTGTAGGGGG - Intergenic
1073534089 10:104259285-104259307 GAATTTCCTTCCTTTTTAGGTGG - Intronic
1074529485 10:114287493-114287515 GGAGTTCTCCCCTTGGTAGGTGG + Intronic
1087217644 11:95511252-95511274 GAAGTTCCCACTTTTCAAGGTGG + Intergenic
1091317120 11:134622379-134622401 GAAGTATCGTCCTTTGTAGGGGG + Intergenic
1092090961 12:5803431-5803453 GATTTTCCAGCCTTTGCAGGTGG - Intronic
1095500161 12:42829018-42829040 GAAGTTCCAGCATATGTTGGTGG + Intergenic
1101959766 12:109239982-109240004 CAAGGTCTCGCCTTTGCAGGGGG + Exonic
1113151724 13:107271349-107271371 GAAGTTCTGGCCTTTGAAGATGG + Intronic
1119849838 14:77859277-77859299 GAGGTACCCACCTTTGCAGGGGG + Exonic
1124714841 15:32050690-32050712 GAACTGCCTTCCTTTGTAGGAGG + Intronic
1127383840 15:58451690-58451712 GAGGTTCGCTCCTTTGGAGGAGG + Intronic
1128977472 15:72164147-72164169 GAAGTTCCCATTTTTGTAGATGG - Intronic
1136536717 16:30903892-30903914 GAAGAGCCCGCCTTTCTAAGCGG - Intergenic
1141177739 16:81731813-81731835 GACATTCCAGCCTTTGTAGAAGG + Intergenic
1141745166 16:85920625-85920647 CAAGTTTCCACCTGTGTAGGAGG + Intronic
1144776385 17:17787109-17787131 GGAGTGCCTGCCCTTGTAGGAGG - Intronic
1144966515 17:19079969-19079991 TCAGTTTCCTCCTTTGTAGGTGG + Intergenic
1144981403 17:19172088-19172110 TCAGTTTCCTCCTTTGTAGGTGG - Intergenic
1144986821 17:19206151-19206173 TCAGTTTCCTCCTTTGTAGGTGG + Intergenic
1145870748 17:28271242-28271264 GAAGTTCCCACCTCTGCAGTAGG + Intergenic
1146513821 17:33473457-33473479 GAAATGCCAGCCTTTGGAGGCGG + Intronic
1146811404 17:35906782-35906804 GAAGTTCCCACCTCTGCAGTAGG + Intergenic
1146812579 17:35915740-35915762 GAAGTTCCCACCTCTGCAGTAGG + Intergenic
1148808823 17:50277917-50277939 GAAGTCCCCGAGTTTGTTGGTGG - Intronic
1150687718 17:67334097-67334119 TATGTTCCAGCCTTTGTAGAAGG - Intergenic
1153354804 18:4123168-4123190 GAAGCACCAGCCTATGTAGGTGG + Intronic
1153791922 18:8586603-8586625 GAAGTGCCCACCTTCGTGGGTGG + Intergenic
1156558770 18:38097775-38097797 CAAATTCCTGCCTTTGTATGAGG + Intergenic
1158438724 18:57454488-57454510 TCAGTTCCCTCCTCTGTAGGAGG + Intronic
1160964688 19:1741906-1741928 GCAGATCCCTCCTCTGTAGGAGG - Intergenic
1162488630 19:10977830-10977852 GATGTTCCAGCCTGTGGAGGAGG + Intronic
926362028 2:12098288-12098310 GAAGTTCCTGTCTTTGTATTAGG - Intergenic
926735478 2:16070369-16070391 GAAGTGCCCACCATTGTGGGAGG + Intergenic
930542560 2:52725056-52725078 GAAATTACTGCCTTTTTAGGGGG + Intergenic
931788689 2:65644209-65644231 GCAGTTCCCTTCTTTGTTGGTGG + Intergenic
939153792 2:138501707-138501729 GAAGTGCCCGGCGCTGTAGGAGG + Intergenic
943378584 2:187114502-187114524 GCAGTTCTCTCCTGTGTAGGGGG + Intergenic
943420138 2:187659261-187659283 GAAGTTCACGCCATTGTAGCGGG + Intergenic
946475772 2:220005181-220005203 GAAGTTTCTGCCTCTGCAGGAGG - Intergenic
1173445529 20:43114502-43114524 GAAGTTACCGACTATGTAGTAGG - Intronic
1180993998 22:19955494-19955516 GCAGTTCCAGCCTTTGCTGGGGG + Intronic
1182778644 22:32850037-32850059 GAAGTTCCTGCCTTGGGATGAGG - Intronic
1182887446 22:33787362-33787384 GAAGATCCTGTCTTGGTAGGAGG - Intronic
1184463177 22:44651767-44651789 GATGTTCCCGCCTGTGCAGTAGG - Intergenic
967212367 3:187180222-187180244 GCAAGTCCCGCCTTTCTAGGGGG - Intronic
968652568 4:1766086-1766108 TAATTTCAGGCCTTTGTAGGTGG + Intergenic
977684782 4:99835604-99835626 GCTGTTCCCTCCTTTCTAGGTGG + Exonic
983200576 4:164856552-164856574 GCAGTTCCCAACTATGTAGGTGG - Intergenic
1007519999 6:42444628-42444650 GAAGATCTGGCCTTTGTAAGGGG - Intronic
1014674712 6:124349294-124349316 GAAGTTCCCGCCTTTGTAGGGGG - Intronic
1020071198 7:5228110-5228132 GAAGATCCCGCGGTTGTTGGTGG + Exonic
1021456535 7:20835339-20835361 GAAGTTCGCGCGTTTGCAGCGGG - Intergenic
1024146607 7:46523340-46523362 CAAGTTTCCCCCTTTGGAGGAGG - Intergenic
1031759324 7:125691705-125691727 GGAGTTCCCAACTTTTTAGGGGG + Intergenic
1033278032 7:139987351-139987373 GAAGCTCCCGTCTTGGTTGGGGG - Intronic
1036199327 8:6754168-6754190 GAAACTCCCTTCTTTGTAGGGGG - Intronic
1042456525 8:69011263-69011285 GAATTTCCCCCCTTTTTTGGAGG + Intergenic
1048302228 8:133260213-133260235 CAAGGTCCCTCCTGTGTAGGTGG + Intronic
1052904031 9:33817909-33817931 GAAGTAGCCGCCTTCGTAGAGGG - Exonic
1058379325 9:104361411-104361433 GAAGTTCCCGCCGTTTGCGGAGG + Intergenic
1062439974 9:136565351-136565373 GAAGGTCCCGGCTCTGTAGAGGG + Intergenic
1196871221 X:120115517-120115539 GAAGTTCACGCTGTTGCAGGTGG - Exonic
1201715294 Y:17037864-17037886 GTAGTTCCCAACTTTGGAGGTGG - Intergenic