ID: 1014674713

View in Genome Browser
Species Human (GRCh38)
Location 6:124349295-124349317
Sequence GGAAGTTCCCGCCTTTGTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 54}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014674713_1014674726 18 Left 1014674713 6:124349295-124349317 CCCCTACAAAGGCGGGAACTTCC 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1014674726 6:124349336-124349358 TCCCAGTGCACAGGCCGGTTGGG 0: 1
1: 1
2: 4
3: 19
4: 99
1014674713_1014674730 30 Left 1014674713 6:124349295-124349317 CCCCTACAAAGGCGGGAACTTCC 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1014674730 6:124349348-124349370 GGCCGGTTGGGTATTCTCCAGGG No data
1014674713_1014674729 29 Left 1014674713 6:124349295-124349317 CCCCTACAAAGGCGGGAACTTCC 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1014674729 6:124349347-124349369 AGGCCGGTTGGGTATTCTCCAGG 0: 1
1: 0
2: 3
3: 23
4: 151
1014674713_1014674720 9 Left 1014674713 6:124349295-124349317 CCCCTACAAAGGCGGGAACTTCC 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1014674720 6:124349327-124349349 ACCCCATTCTCCCAGTGCACAGG 0: 13
1: 32
2: 70
3: 99
4: 363
1014674713_1014674725 17 Left 1014674713 6:124349295-124349317 CCCCTACAAAGGCGGGAACTTCC 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1014674725 6:124349335-124349357 CTCCCAGTGCACAGGCCGGTTGG 0: 4
1: 25
2: 73
3: 121
4: 212
1014674713_1014674724 13 Left 1014674713 6:124349295-124349317 CCCCTACAAAGGCGGGAACTTCC 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1014674724 6:124349331-124349353 CATTCTCCCAGTGCACAGGCCGG 0: 11
1: 19
2: 40
3: 124
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014674713 Original CRISPR GGAAGTTCCCGCCTTTGTAG GGG (reversed) Intronic
912344965 1:108955664-108955686 GGAAGATCCACCCTCTGTAGGGG + Intronic
914318116 1:146533175-146533197 GAAATTTCCCCCTTTTGTAGGGG + Intergenic
914496241 1:148200182-148200204 GAAATTTCCCCCTTTTGTAGGGG - Intergenic
922865005 1:228852305-228852327 GGAAGTTCACGTCTTTGAGGGGG + Intergenic
1077083028 11:733896-733918 GGAATGTCCCGCCTTGGTCGTGG - Intergenic
1077327232 11:1969120-1969142 GGGGGCTCCCTCCTTTGTAGCGG - Intronic
1085266082 11:75238851-75238873 AGGAGTTCCAGCCTTGGTAGTGG + Intergenic
1088657988 11:112019330-112019352 GGATGATCCCGCCTCTGTAGGGG + Intronic
1091317119 11:134622378-134622400 GGAAGTATCGTCCTTTGTAGGGG + Intergenic
1202810214 11_KI270721v1_random:24300-24322 GGGGGCTCCCTCCTTTGTAGCGG - Intergenic
1092173249 12:6386097-6386119 GGAAGTGCCCGGCCTTGCAGGGG - Exonic
1092474261 12:8805845-8805867 GGCAAGTCCCGCTTTTGTAGAGG + Intergenic
1093268198 12:17026334-17026356 GGCAAGTCCCGCTTTTGTAGTGG - Intergenic
1108558998 13:51624836-51624858 GGACGTTCCTGCCTTTGCACTGG - Intronic
1115157518 14:30357865-30357887 GGATGTTCACCACTTTGTAGCGG + Intergenic
1115746944 14:36447522-36447544 GATATTTCCCCCCTTTGTAGAGG + Intergenic
1118900757 14:69983522-69983544 GGAAGTTGCCACCTCTGCAGGGG + Intronic
1119849837 14:77859276-77859298 GGAGGTACCCACCTTTGCAGGGG + Exonic
1120853207 14:89189300-89189322 GGAAGTCCCTGCCTTTGGAGTGG - Intronic
1130879843 15:88045540-88045562 GGAAGTTCACAGCTTTGGAGAGG - Intronic
1132544056 16:524947-524969 AGAAGTTCCCGCCTTTCTCTGGG - Intergenic
1140909374 16:79437910-79437932 GGAGGTTTCCGCCTCTGCAGGGG + Intergenic
1158165528 18:54535402-54535424 GGACGTGCCTGCATTTGTAGTGG - Intergenic
1165333367 19:35153847-35153869 GGCAGTTTCCACCTTTCTAGTGG + Intronic
926570021 2:14519541-14519563 GGAATTGCCCTTCTTTGTAGAGG + Intergenic
928181363 2:29071115-29071137 GGAAGTTCGCCGCTTTGTGGTGG + Exonic
929311901 2:40435264-40435286 GGAAGTGCTTGCCTTGGTAGTGG - Intronic
934754414 2:96815890-96815912 GGAAGTTCCCGGCTTGGGAGCGG - Intergenic
939864091 2:147453251-147453273 GGATGTTCCCTCCCATGTAGAGG - Intergenic
941465723 2:165824156-165824178 GGAAGATCCTGCTTTTGAAGTGG - Intergenic
943420137 2:187659260-187659282 AGAAGTTCACGCCATTGTAGCGG + Intergenic
946167393 2:217873356-217873378 GGCAGGTCCCACCTTTCTAGAGG + Intronic
946873788 2:224108319-224108341 GGAAGTTCACGTGTTTGCAGAGG - Intergenic
947825329 2:233102324-233102346 GGAAGCTGCTGCCTTTGAAGGGG + Intronic
1175276675 20:57775309-57775331 GGAAGGTCTCGCCTTTGGTGAGG - Intergenic
949670945 3:6398613-6398635 GGCAAGTCCCGCTTTTGTAGGGG + Intergenic
954702271 3:52456467-52456489 GGTAGTTCCCGACTTTGACGGGG + Intronic
957270060 3:78018535-78018557 GGATGTTCCAGCCTTTGCATTGG - Intergenic
963508747 3:146221705-146221727 GCAAGGTCCTGCCTTGGTAGAGG - Intronic
964304449 3:155325624-155325646 GGAAGTTCAAGCGTTTGCAGTGG + Intergenic
984704277 4:182836450-182836472 GGGAGTTCCCTGCTTAGTAGAGG - Intergenic
991909676 5:71549242-71549264 GTAAGTTCCCTCCTTTTTTGCGG - Intronic
1005805978 6:29474969-29474991 GGCAGTCCCTGCCTTTGTGGAGG + Intergenic
1007520000 6:42444629-42444651 GGAAGATCTGGCCTTTGTAAGGG - Intronic
1014674713 6:124349295-124349317 GGAAGTTCCCGCCTTTGTAGGGG - Intronic
1015984571 6:138872365-138872387 GACAGTTCCTGCCTTTGTGGAGG + Intronic
1021456536 7:20835340-20835362 AGAAGTTCGCGCGTTTGCAGCGG - Intergenic
1022876236 7:34533573-34533595 GGAAGTGGCTGCCTTTGCAGAGG - Intergenic
1033163402 7:139017061-139017083 GGAATTTCCAGCTTCTGTAGTGG - Intergenic
1039053408 8:33514777-33514799 CGAAGCTCCCGCCTGTGCAGTGG - Intergenic
1039617671 8:38969460-38969482 GGAAGCTCCAGCCTTTCAAGTGG + Exonic
1046213802 8:111115775-111115797 GGAAGAAACCGCTTTTGTAGTGG + Intergenic
1049751733 8:144287890-144287912 GGAAGTTACGGCCTTGGCAGAGG - Intronic
1051809154 9:21031019-21031041 AGCAGTTCCTGCCTTTATAGGGG - Intronic
1052904032 9:33817910-33817932 TGAAGTAGCCGCCTTCGTAGAGG - Exonic
1062439973 9:136565350-136565372 AGAAGGTCCCGGCTCTGTAGAGG + Intergenic
1186898580 X:14029939-14029961 GGAAGTCCCCCCCTGTGTCGCGG + Intergenic
1189610424 X:42727560-42727582 GGAAGTTCTTGCCTCAGTAGTGG + Intergenic
1201320559 Y:12693886-12693908 GTAAGTTCCCTCCTCTGAAGAGG + Intergenic