ID: 1014674715

View in Genome Browser
Species Human (GRCh38)
Location 6:124349297-124349319
Sequence CGGGAAGTTCCCGCCTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 37}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014674715_1014674729 27 Left 1014674715 6:124349297-124349319 CCTACAAAGGCGGGAACTTCCCG 0: 1
1: 0
2: 1
3: 4
4: 37
Right 1014674729 6:124349347-124349369 AGGCCGGTTGGGTATTCTCCAGG 0: 1
1: 0
2: 3
3: 23
4: 151
1014674715_1014674720 7 Left 1014674715 6:124349297-124349319 CCTACAAAGGCGGGAACTTCCCG 0: 1
1: 0
2: 1
3: 4
4: 37
Right 1014674720 6:124349327-124349349 ACCCCATTCTCCCAGTGCACAGG 0: 13
1: 32
2: 70
3: 99
4: 363
1014674715_1014674730 28 Left 1014674715 6:124349297-124349319 CCTACAAAGGCGGGAACTTCCCG 0: 1
1: 0
2: 1
3: 4
4: 37
Right 1014674730 6:124349348-124349370 GGCCGGTTGGGTATTCTCCAGGG No data
1014674715_1014674726 16 Left 1014674715 6:124349297-124349319 CCTACAAAGGCGGGAACTTCCCG 0: 1
1: 0
2: 1
3: 4
4: 37
Right 1014674726 6:124349336-124349358 TCCCAGTGCACAGGCCGGTTGGG 0: 1
1: 1
2: 4
3: 19
4: 99
1014674715_1014674725 15 Left 1014674715 6:124349297-124349319 CCTACAAAGGCGGGAACTTCCCG 0: 1
1: 0
2: 1
3: 4
4: 37
Right 1014674725 6:124349335-124349357 CTCCCAGTGCACAGGCCGGTTGG 0: 4
1: 25
2: 73
3: 121
4: 212
1014674715_1014674724 11 Left 1014674715 6:124349297-124349319 CCTACAAAGGCGGGAACTTCCCG 0: 1
1: 0
2: 1
3: 4
4: 37
Right 1014674724 6:124349331-124349353 CATTCTCCCAGTGCACAGGCCGG 0: 11
1: 19
2: 40
3: 124
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014674715 Original CRISPR CGGGAAGTTCCCGCCTTTGT AGG (reversed) Intronic
902241918 1:15095187-15095209 CGTGAGGTTCCCGCATTGGTTGG - Intronic
902892847 1:19457045-19457067 CTGGAACTTCCTGCCTTTCTGGG - Intronic
915586690 1:156847614-156847636 CGGGAAGTGCCTGCCTTTGTTGG + Intronic
920251688 1:204626225-204626247 CGGGCATTTCCAGCCTTTGGTGG - Intronic
921985792 1:221310414-221310436 TGGGAATTTGCCACCTTTGTTGG - Intergenic
922865003 1:228852303-228852325 GGGGAAGTTCACGTCTTTGAGGG + Intergenic
1063391255 10:5651153-5651175 CTGGAAGTTTCCTCCTTTCTGGG - Intronic
1070207814 10:74281380-74281402 GGGGAAGTTCCCCACTTTTTTGG + Intronic
1073322035 10:102621333-102621355 GGGGAAGTACCCTCCCTTGTAGG + Intronic
1075846529 10:125549389-125549411 CGGGAAGTTGCCTCCTTCCTAGG - Intergenic
1083661815 11:64254910-64254932 CGGGAAGTTCTGGGCTTTGGGGG + Exonic
1084694220 11:70744248-70744270 CAGGAAGCTCCTGCCCTTGTGGG + Intronic
1113617517 13:111691411-111691433 CAGGAATGTCCCGCCTTTGCCGG - Intergenic
1113623047 13:111776671-111776693 CAGGAATGTCCCGCCTTTGCCGG - Intergenic
1122608746 14:102966452-102966474 GGGGACGTTCCCGCCTTCCTCGG + Intronic
1125364661 15:38901187-38901209 GTGGAAATTCCCGACTTTGTAGG + Intergenic
1134233489 16:12447788-12447810 GGGGCTGTTCCCGCTTTTGTGGG - Intronic
1140909372 16:79437908-79437930 CGGGAGGTTTCCGCCTCTGCAGG + Intergenic
1145785232 17:27589119-27589141 CCGGAAGCTCCCATCTTTGTTGG + Intronic
1146747408 17:35344632-35344654 TGGAATGTTCCAGCCTTTGTTGG - Intergenic
1151561475 17:74872206-74872228 TGGGAAGTTCCAGCTTCTGTTGG - Intronic
1153791921 18:8586600-8586622 CGGGAAGTGCCCACCTTCGTGGG + Intergenic
1157568357 18:48695878-48695900 AGGGAACTTCCTGCCATTGTTGG + Intronic
1160744123 19:702688-702710 AGGCAAGTTCCTGCCCTTGTGGG + Intergenic
947745200 2:232503640-232503662 CGGGAATTAGCCGCCTTTATCGG - Intergenic
950243127 3:11389560-11389582 CGGGAAAATACCGCCTGTGTGGG + Intronic
953200964 3:40778208-40778230 CTGGAAGTTTCTGCCTTTGTTGG - Intergenic
954702269 3:52456465-52456487 CGGGTAGTTCCCGACTTTGACGG + Intronic
959097574 3:101972277-101972299 CAGGAAGTTCCCACATCTGTGGG - Intergenic
960053514 3:113259925-113259947 CAGAAAGTTCCCACCTCTGTTGG + Intronic
966922089 3:184619083-184619105 CTGAAAGTTCCCGCCTCTGCTGG + Intronic
968975653 4:3820910-3820932 CGGGAAGTTCCCTCCTGGGTGGG - Intergenic
996578423 5:125001852-125001874 CTGGAGGTTCCAGCATTTGTTGG - Intergenic
1003330058 6:5122280-5122302 CTAGAAGTTCCTGACTTTGTGGG + Intronic
1006115952 6:31776350-31776372 CGGGACTGTCCCTCCTTTGTGGG - Intronic
1014674715 6:124349297-124349319 CGGGAAGTTCCCGCCTTTGTAGG - Intronic
1025251972 7:57357483-57357505 GGTGAAGTTCCCGCTTTCGTAGG + Intergenic
1034930719 7:155160961-155160983 TGGAAATCTCCCGCCTTTGTTGG + Intergenic
1040470439 8:47731784-47731806 TGGGCAGTTCCCCCCTTTCTGGG - Intronic
1058379324 9:104361408-104361430 CAGGAAGTTCCCGCCGTTTGCGG + Intergenic
1062548465 9:137074690-137074712 CAGCAACTCCCCGCCTTTGTGGG + Intergenic
1195709309 X:107761283-107761305 CAGGAAGTTCTAGCCCTTGTGGG - Intronic
1199810576 X:151344779-151344801 CTGGAAGGTCCAGCCTTTGATGG + Intergenic