ID: 1014674717

View in Genome Browser
Species Human (GRCh38)
Location 6:124349316-124349338
Sequence GGAGAATGGGGTGGAGCCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 837
Summary {0: 2, 1: 27, 2: 47, 3: 147, 4: 614}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014674717_1014674725 -4 Left 1014674717 6:124349316-124349338 CCCGAGGCTCCACCCCATTCTCC 0: 2
1: 27
2: 47
3: 147
4: 614
Right 1014674725 6:124349335-124349357 CTCCCAGTGCACAGGCCGGTTGG 0: 4
1: 25
2: 73
3: 121
4: 212
1014674717_1014674732 25 Left 1014674717 6:124349316-124349338 CCCGAGGCTCCACCCCATTCTCC 0: 2
1: 27
2: 47
3: 147
4: 614
Right 1014674732 6:124349364-124349386 TCCAGGGACCCCTTTTTACTTGG 0: 4
1: 14
2: 26
3: 70
4: 199
1014674717_1014674726 -3 Left 1014674717 6:124349316-124349338 CCCGAGGCTCCACCCCATTCTCC 0: 2
1: 27
2: 47
3: 147
4: 614
Right 1014674726 6:124349336-124349358 TCCCAGTGCACAGGCCGGTTGGG 0: 1
1: 1
2: 4
3: 19
4: 99
1014674717_1014674730 9 Left 1014674717 6:124349316-124349338 CCCGAGGCTCCACCCCATTCTCC 0: 2
1: 27
2: 47
3: 147
4: 614
Right 1014674730 6:124349348-124349370 GGCCGGTTGGGTATTCTCCAGGG No data
1014674717_1014674724 -8 Left 1014674717 6:124349316-124349338 CCCGAGGCTCCACCCCATTCTCC 0: 2
1: 27
2: 47
3: 147
4: 614
Right 1014674724 6:124349331-124349353 CATTCTCCCAGTGCACAGGCCGG 0: 11
1: 19
2: 40
3: 124
4: 344
1014674717_1014674729 8 Left 1014674717 6:124349316-124349338 CCCGAGGCTCCACCCCATTCTCC 0: 2
1: 27
2: 47
3: 147
4: 614
Right 1014674729 6:124349347-124349369 AGGCCGGTTGGGTATTCTCCAGG 0: 1
1: 0
2: 3
3: 23
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014674717 Original CRISPR GGAGAATGGGGTGGAGCCTC GGG (reversed) Intronic
900238218 1:1602431-1602453 AGAGAAAAGAGTGGAGCCTCGGG + Intergenic
900891353 1:5451813-5451835 GCACACTGGGGTGGAACCTCCGG + Intergenic
901231999 1:7646575-7646597 GGTGAGTTGGGTGGAGGCTCTGG + Intronic
902517170 1:16995824-16995846 GTGGGATGGGGTGGATCCTCTGG + Intronic
902876990 1:19346556-19346578 GGAGAACAGGGTGGAGTCTGGGG + Intronic
903273999 1:22209248-22209270 TGAGAATGGAGTGCCGCCTCTGG + Intergenic
903389492 1:22953915-22953937 GGAGAACGTGCTGGAGCCGCTGG - Exonic
903557229 1:24202772-24202794 GGAGATGGGGGCTGAGCCTCAGG + Intergenic
903878235 1:26490858-26490880 GGAGACTGGGGTGGAGGTTGGGG + Intergenic
903955416 1:27022064-27022086 GGAAGATGGGGTGGAGACTCAGG + Intergenic
904003100 1:27349675-27349697 GGAGAATGGGGAGGAGGCCCCGG + Exonic
905849836 1:41265459-41265481 GCAGGATGAGATGGAGCCTCTGG - Intergenic
905954011 1:41977120-41977142 GGAGAATGAGTTGGGGCCTATGG + Intronic
906500311 1:46337167-46337189 GGAGAATGGCGTGAACCCCCGGG + Intergenic
907145814 1:52230317-52230339 GGAGGACGGGGTGGGGCCTTGGG - Intronic
907237322 1:53061634-53061656 GGAGGGTGGGGTGGAGCGTGGGG + Intergenic
907460375 1:54602047-54602069 GTGGAGTTGGGTGGAGCCTCGGG + Intronic
907647460 1:56258551-56258573 GGAGACTGCGTTAGAGCCTCTGG + Intergenic
908035249 1:60044590-60044612 GGAGAATGGGGAGGAGCTCTTGG + Intronic
908531624 1:65039802-65039824 GGGGAATGGGGGGAATCCTCAGG - Intergenic
909050512 1:70762134-70762156 GGAGAATGGCGTGAACCCTAGGG + Intergenic
909584591 1:77275371-77275393 GGGGGATGGGGTGGAGCCACAGG + Intergenic
909601301 1:77464332-77464354 GCGCACTGGGGTGGAGCCTCGGG - Intronic
910626435 1:89313025-89313047 GGAGGATGGGGTAGAGCCTTGGG - Intergenic
911265095 1:95733905-95733927 GGAGAACTGGGTGGAGCCCTGGG - Intergenic
912452709 1:109777104-109777126 GGAGAGTGGGGAGGAGCACCAGG + Intergenic
913103063 1:115587351-115587373 GGAGGACAGGGTGGAGCCTCTGG + Intergenic
913103624 1:115592737-115592759 GGAGGATGGGGTGCAACCTCAGG + Intergenic
913134768 1:115877704-115877726 GGGGAAGTGGGTGGAGCCACAGG + Intergenic
913963309 1:143355157-143355179 GGAGAATGGGGTGAGGCCTGAGG - Intergenic
914057665 1:144180743-144180765 GGAGAATGGGGTGAGGCCTGAGG - Intergenic
914121481 1:144785623-144785645 GGAGAATGGGGTGAGGCCTGAGG + Intergenic
914744999 1:150495086-150495108 GGAGAATGGCGTGAACCCTGGGG + Intronic
915120528 1:153627499-153627521 GTAGAGTGAGCTGGAGCCTCAGG + Intronic
915561824 1:156692313-156692335 GGGGACTGGGGAGGAGGCTCAGG + Intergenic
915580238 1:156809011-156809033 GGAGAAGAGGGGGCAGCCTCTGG + Intronic
916002091 1:160626838-160626860 AGAGTATGGAGTGGAGCCTGGGG - Intronic
916075376 1:161197416-161197438 GGAGGAAAGGATGGAGCCTCAGG + Intronic
916638743 1:166703125-166703147 GGAGAATGGGATGGAGCCTCAGG + Intergenic
916943101 1:169696772-169696794 GGAGAATGGAATGGAACCTCAGG - Intronic
917098290 1:171421844-171421866 GGAGGACTGGGTGGAGCCTTGGG - Intergenic
917557199 1:176102108-176102130 AGAGGATGGGGTGGGGCCTCAGG + Intronic
918161239 1:181902063-181902085 GGAGGATGGGGTGAGGCCTTGGG + Intergenic
918175550 1:182041146-182041168 GGGGAAAGGGGTGGAGCCAGGGG - Intergenic
918181145 1:182086760-182086782 GGAGAAGGTGGTGGCGCCTCAGG + Intergenic
918682353 1:187371107-187371129 GGAGAATGGCGTGAACCCTGGGG + Intergenic
918704251 1:187641174-187641196 GTGCACTGGGGTGGAGCCTCAGG + Intergenic
919558751 1:199093394-199093416 GGAGAATGGCGTGAACCCCCGGG - Intergenic
920118385 1:203637338-203637360 GGAGAATGGCGTGAACCCCCGGG + Intronic
920735479 1:208529553-208529575 GGAGATTGGCTTGCAGCCTCTGG - Intergenic
920940040 1:210473540-210473562 GGTGAATGGTGTGGGGCCACTGG + Intronic
922367598 1:224880647-224880669 GGAAGATGGGGTGGAGCCTCAGG + Intergenic
923099250 1:230799092-230799114 AGAGACTGGGGAGGAGCCACAGG - Intronic
923412653 1:233725438-233725460 GAGGGATGGGGTGGAGTCTCGGG - Intergenic
923413356 1:233731434-233731456 GGTGGATGGGGTGGAGCCTTGGG - Intergenic
923414215 1:233739032-233739054 GGAGGATGGGGTGGAGCCTAGGG + Intergenic
923484836 1:234419079-234419101 GGAGAATGGCGTGAACCCTGGGG + Intronic
923570960 1:235114526-235114548 GGAGAATGGCGTGAACCCTGGGG - Intronic
923908492 1:238413011-238413033 GCCCACTGGGGTGGAGCCTCAGG + Intergenic
923914424 1:238486076-238486098 GCACACTGGGGTGGAACCTCAGG - Intergenic
924571584 1:245241770-245241792 GGAGCACTGGGTGCAGCCTCTGG + Intronic
1063306697 10:4909296-4909318 GGAGAATAAGGTGGAGCCACAGG + Intergenic
1063306975 10:4911325-4911347 GGAGAGTGGAGTGGAGCCATGGG + Intergenic
1063468223 10:6262361-6262383 GGAGAATGGCGTGAACCCTGGGG + Intergenic
1063569966 10:7206318-7206340 GGAGCTTGGGGTGGGACCTCAGG + Intronic
1064174948 10:13066742-13066764 GGGGAACGGGGTGGAGCCACAGG + Intronic
1064175630 10:13072550-13072572 GGAGAATGGGGTGGAGCCACAGG + Intronic
1064466560 10:15588391-15588413 GGAAACTGGGGTTCAGCCTCTGG - Intronic
1064772469 10:18737769-18737791 GCAGAAAGGGTTGGAGCCTTGGG + Intergenic
1065353944 10:24820915-24820937 GGAGCAGGGGCTGGTGCCTCAGG - Intergenic
1065534509 10:26703988-26704010 GGAGAATGGCGTGAACCCTGGGG + Intronic
1066102762 10:32132551-32132573 GGGGGATGGGGCGGAGCCACAGG - Intergenic
1066242576 10:33552473-33552495 GGAGGGTGGGGTGGAGCCACAGG - Intergenic
1066721542 10:38345055-38345077 GGAGAATGGCGTGAACCCTGGGG + Intergenic
1066749328 10:38636407-38636429 GGATTACGGGGTGGAGCCTCGGG - Intergenic
1066967323 10:42281385-42281407 GGATTACGGGGTGGAGCCTCGGG + Intergenic
1067121393 10:43475018-43475040 GGAGAATGAGGTGGAGGCAGGGG - Intronic
1067299348 10:44994887-44994909 GGGGACTAGGGTGGAGCCTGAGG + Exonic
1068428396 10:56898341-56898363 GGAGAATGGGTTGGAGCCACTGG - Intergenic
1068438340 10:57019289-57019311 GAACTCTGGGGTGGAGCCTCAGG - Intergenic
1068878399 10:62022410-62022432 GGAGGATGGGGTGGAGCCTTGGG + Intronic
1069462012 10:68604501-68604523 GAAGCATGGGCTGGAGCCTTTGG + Intronic
1070406297 10:76100452-76100474 GGAGAAAGGGCTGAAGCCACGGG - Intronic
1070767663 10:79066055-79066077 GGGGTAGGGGGTGGAGCTTCTGG + Intergenic
1070812210 10:79304070-79304092 GGAGGATGGGGTGGAGCAGACGG + Exonic
1071137763 10:82471304-82471326 GGAGAATGGGGTGGAGCCGTGGG - Intronic
1071307404 10:84311291-84311313 TGAGAATGAGGTTGAGCATCAGG + Intergenic
1071326060 10:84519428-84519450 GGAGAACTGGGTGGAGCCACGGG - Intergenic
1073105948 10:101032167-101032189 GGAGGAGGGGCTGGAGCCGCGGG - Intronic
1073466250 10:103696111-103696133 GGTTAATGGGGTGGAGGCTGAGG + Intronic
1074062144 10:109976390-109976412 AGAGATTGGGGTGGGGCCTAGGG - Intergenic
1074779380 10:116790192-116790214 GGAGAATGGCGTGAACCCCCAGG - Intergenic
1074852602 10:117450794-117450816 GGAAACTGGGGTGCAGGCTCTGG - Intergenic
1076452511 10:130566547-130566569 GGAGAATGGCGTGAACCCCCGGG + Intergenic
1077052262 11:572371-572393 GGAGAATGGCGTGAACCCCCAGG - Intergenic
1077066584 11:643761-643783 GGAGAAAGGGCTGAAGCCTGTGG - Intergenic
1077200147 11:1302679-1302701 GGAGACTGGCGTGGAGCATGAGG - Intronic
1077303995 11:1859751-1859773 GGAGAATGGGCCAGAGCCACGGG - Intronic
1077309391 11:1881754-1881776 GGAGGATGGGGTGGCTGCTCAGG - Intronic
1077364391 11:2155677-2155699 GGACGATGGGGTGCCGCCTCCGG + Intronic
1077868203 11:6240208-6240230 GGAGAAAGCGGTTCAGCCTCAGG - Exonic
1077895381 11:6449508-6449530 GGAGGATAGGGTGAAGCCCCAGG + Intronic
1078356456 11:10635527-10635549 TGCCAATGGGCTGGAGCCTCTGG + Intronic
1078535820 11:12172814-12172836 GGAGGATGGGGCGGGGCCTCGGG - Intronic
1078737008 11:14029637-14029659 GGAGAATGGGGTGGAGCCTCAGG - Intronic
1078774942 11:14385223-14385245 GGGGAAAGGGGTGGAGCCTCAGG + Intergenic
1079820076 11:25115441-25115463 GGAGAATGGCGTGAACCCTGGGG + Intergenic
1080120686 11:28673894-28673916 GGAGAGTGGGGTGGAGCCCAAGG - Intergenic
1080217111 11:29856653-29856675 GAACACTGGGGTGGAGCCTTGGG - Intergenic
1081100622 11:38997255-38997277 GGAGGATGGAGTGGGGCCTGAGG - Intergenic
1081214779 11:40382782-40382804 GGAGAATGGCGTGAACCCTGGGG - Intronic
1081435838 11:43026665-43026687 GGAGGACTGGGTGGAGCCTTGGG - Intergenic
1081703860 11:45168908-45168930 GGAGAAGGGGGTGTGGCCTGTGG - Intronic
1081865152 11:46355667-46355689 GGAGAGTGGGGTGGGGCCCTGGG + Intronic
1084028366 11:66466829-66466851 GGAAAATGGGGCGGGGCCTCCGG + Intronic
1084737092 11:71112563-71112585 AGAGCATGGGGTGGAGAGTCCGG - Intronic
1084804007 11:71566284-71566306 GGAGAAGGGGCAGGTGCCTCAGG - Exonic
1084879834 11:72163086-72163108 GTGCACTGGGGTGGAGCCTCTGG - Intergenic
1085083496 11:73651907-73651929 AGAGGATGGGGTGGAATCTCGGG + Intronic
1085566579 11:77520015-77520037 GGGGAATGGGGTGGAGCCACGGG - Intronic
1086133655 11:83425277-83425299 GCAAACTGGGGTGGAGCCTCAGG - Intergenic
1086296504 11:85373556-85373578 GCCCATTGGGGTGGAGCCTCAGG + Intronic
1086479799 11:87222405-87222427 GGAGAATGGCGTGAACCCTGGGG + Intronic
1087462821 11:98466821-98466843 GGAGAACTGGGTGGAGCCATGGG + Intergenic
1087470030 11:98561514-98561536 GGATAATGGGGTGGAACCACCGG + Intergenic
1088010473 11:104995001-104995023 GCACACTGGGGTGGAGCCTTGGG + Intronic
1088093993 11:106077327-106077349 GGAGACTGGGGTGGAGACTTCGG - Exonic
1090059005 11:123447559-123447581 GCAGCATGGGTTGGAGGCTCTGG + Intergenic
1090156012 11:124439537-124439559 AGACAGTGGGGTGGAGCTTCAGG - Intergenic
1090884696 11:130865471-130865493 GGAGCACGGCTTGGAGCCTCGGG + Intergenic
1091146832 11:133287618-133287640 GGAGAATGGGCTGCAGCGCCTGG + Intronic
1091356772 11:134943687-134943709 GCAGAATGGGGCGGGGCTTCTGG - Intergenic
1091419799 12:326772-326794 GGAGAATGGCGTGGACCCGCAGG + Intronic
1091952371 12:4605050-4605072 GGAGAATGAGGTGGAGCAGCTGG + Exonic
1092013854 12:5140132-5140154 GGGGAATGGGGTGGAGCCACCGG - Intergenic
1092061932 12:5558106-5558128 GGAGGAGGGGGTAGAGACTCGGG - Intronic
1092259647 12:6946145-6946167 GGGGGAAGGGGAGGAGCCTCAGG - Intergenic
1092532859 12:9359991-9360013 GGAGGTTGGGGAGGGGCCTCAGG - Intergenic
1092563043 12:9636840-9636862 GGAGGATGGGGTGGAGCCGTGGG - Intergenic
1092588269 12:9922890-9922912 GGAGTAGGGGGTGCAGCCTTTGG - Intronic
1092783263 12:12006751-12006773 GGAGAATGGCGTGAACCCCCTGG - Intergenic
1094003192 12:25718538-25718560 GGAGGATGGGGTGGAGCCTCAGG + Intergenic
1094472571 12:30817246-30817268 GGAGGATGGGGCAGGGCCTCAGG + Intergenic
1095178726 12:39122860-39122882 TGGGAATGGGGTGAGGCCTCTGG - Intergenic
1095345280 12:41142525-41142547 GAAAAATGGGGTGGAGCCACCGG - Intergenic
1095593503 12:43933289-43933311 GGAGAATGGCGTGAACCCTGGGG - Intronic
1095604423 12:44050063-44050085 GGGAAATGAGGTGGGGCCTCTGG + Intronic
1095765297 12:45887764-45887786 GAAGGACGGGGTGGAGCCTCGGG - Intronic
1096195095 12:49644577-49644599 GGAAGAAGTGGTGGAGCCTCAGG - Exonic
1096356298 12:50943617-50943639 GGAGAATGGTGTGAACCCTGGGG + Intergenic
1097126546 12:56780756-56780778 GGAGAATGGGGTGAACCCGGGGG + Intronic
1097987064 12:65794768-65794790 GGAGAATGGCGTGAACCCTGGGG + Intergenic
1098643861 12:72873151-72873173 GGAGGACAGGGTGGAGCTTCAGG + Intergenic
1098947841 12:76608255-76608277 GGAGAGTGGGGTGGAGCCACCGG - Intergenic
1100040422 12:90311045-90311067 GGAGAATGGGGTGAACCCGGGGG - Intergenic
1100272233 12:93037506-93037528 GGAGGACGGGGTGGAGCCTCGGG - Intergenic
1100361587 12:93884519-93884541 GGAGGACGGGGTGGGGCCTCGGG + Intronic
1100497092 12:95135552-95135574 GGAGAATGAGGGTGAGGCTCAGG - Intronic
1101181232 12:102220263-102220285 GCAAAATGAGGTCGAGCCTCAGG + Intergenic
1103003128 12:117401311-117401333 GGAGAAAGGGGTTGGACCTCTGG - Intronic
1103905535 12:124325567-124325589 GGGGAATGGCGTGGAACCTGCGG + Exonic
1103964718 12:124631480-124631502 GGAGAATGGCGTGAAGCCGGGGG + Intergenic
1104691626 12:130830361-130830383 GGAGAGGAGGGTTGAGCCTCTGG - Intronic
1104726312 12:131077610-131077632 GGAGGGAGGGGTGGGGCCTCCGG + Intronic
1104801813 12:131559651-131559673 TGATAATGGGGCGGGGCCTCTGG - Intergenic
1105209514 13:18249688-18249710 GGGGAATGGTGTGGAGGTTCCGG - Intergenic
1105494057 13:20914933-20914955 GGAGAATGGTGTGAACCCTGGGG - Intergenic
1105596470 13:21843947-21843969 GGAGAATGGCGTGAATCCCCGGG - Intergenic
1106065873 13:26348575-26348597 GGATAATGGGGTGGAGGTGCAGG - Intronic
1106075967 13:26461445-26461467 GGAGAATGGCGTGAACCCACAGG + Intergenic
1106628369 13:31443660-31443682 GGAGACAGGGGCAGAGCCTCTGG - Intergenic
1107053168 13:36074396-36074418 GGAGAATGGCGTGAACCCTGGGG + Intronic
1107517540 13:41145727-41145749 GGAAGATGGGGTGGAGCCATAGG + Intergenic
1107557489 13:41529899-41529921 GGGGAGTGGGGTGGGGCCTTAGG + Intergenic
1107963035 13:45575769-45575791 GGAGAGTGGCTTAGAGCCTCCGG + Intronic
1108136914 13:47374445-47374467 GGAGAATGGCGTGAACCCCCAGG - Intergenic
1108940421 13:55946792-55946814 GGAGAGTGGGGTGGAGCCACTGG + Intergenic
1109382162 13:61577038-61577060 GGAGAATGGCGTGAATCCTGGGG + Intergenic
1109638934 13:65161430-65161452 GAAGAATGGAGTGGAGCCATGGG - Intergenic
1109822064 13:67669839-67669861 GGAGAATGGCGTGGACCCCCGGG - Intergenic
1109863633 13:68232936-68232958 GGAGGATGGGGTGGAGCCTCAGG - Intergenic
1109955211 13:69557037-69557059 GGAAAGTGGGGTGGAGCCACTGG - Intergenic
1110976772 13:81847471-81847493 GGAGAATGGCGTGAACCCCCGGG - Intergenic
1112015352 13:95326875-95326897 GGAGAATGGGGTGGAGTGGCGGG + Intergenic
1112065045 13:95783967-95783989 GTGCACTGGGGTGGAGCCTCGGG - Intronic
1112091040 13:96084440-96084462 GGAGAATGGCGTGAACCCCCGGG - Intergenic
1112549896 13:100409562-100409584 GTGCACTGGGGTGGAGCCTCAGG - Intronic
1112596815 13:100815036-100815058 AGAGAGTGGGGTGCAGCCTCTGG - Intergenic
1112774652 13:102830899-102830921 GGAGGATGGGGTTGGGCCTCAGG - Intronic
1112957060 13:105073226-105073248 GGAGCATGGGGTGGAGCCACGGG - Intergenic
1113652637 13:112046742-112046764 AGGAAAAGGGGTGGAGCCTCAGG - Intergenic
1113757930 13:112826834-112826856 GGAGACTGGCGAGGGGCCTCTGG + Exonic
1113857745 13:113457889-113457911 GCAGAATGGGATGGCGCCTCTGG + Exonic
1113895094 13:113759247-113759269 GGAGAGCCGGGTGGGGCCTCGGG + Exonic
1113939229 13:114009960-114009982 GGAACTTGGGGTCGAGCCTCAGG - Intronic
1114007030 14:18325036-18325058 GCACACTGAGGTGGAGCCTCTGG + Intergenic
1114198222 14:20498046-20498068 GGAGAATGGGGTGAACCCAGGGG + Intergenic
1114520641 14:23332683-23332705 GGAGAATGGCGTGAACCCTGGGG - Intergenic
1114683221 14:24504917-24504939 GGAGAAGGGGGTGTTGCTTCTGG + Intronic
1114855177 14:26430437-26430459 GGAGAATGGCGTGAACCCTGGGG - Intergenic
1115769561 14:36655874-36655896 GGAGAATGATGCGGAGCCTTGGG + Intergenic
1116102804 14:40464097-40464119 GCAGAATGGGGTGGAGCCACCGG + Intergenic
1116599600 14:46902990-46903012 CAAGAATGGGTTGGAGCCACGGG + Intronic
1117057353 14:51926616-51926638 GCACGCTGGGGTGGAGCCTCAGG + Intronic
1117289286 14:54316820-54316842 GGAGAACAAGGTGGAGCCACGGG + Intergenic
1117722127 14:58638226-58638248 GGCGAAGGAGCTGGAGCCTCCGG + Exonic
1118378018 14:65193567-65193589 GGAGAACGGGGTGGAGCTGTGGG - Intergenic
1118474559 14:66104691-66104713 GGGGAATGGGGTGGAGCCACGGG + Intergenic
1118486963 14:66223542-66223564 GGAGGATGGGGTGGGACCTCAGG - Intergenic
1118549955 14:66939617-66939639 GGAGGATGGGGTGGAGTTACGGG - Intronic
1118550582 14:66945332-66945354 GGAGGATGGGGTGGAGCTATGGG - Intronic
1118726835 14:68634692-68634714 TGAGACGGAGGTGGAGCCTCTGG + Intronic
1118856504 14:69627553-69627575 GGAGAATGGCATGGAGCTTGTGG - Intronic
1118929125 14:70223795-70223817 GGAGGAAGCGGTGGGGCCTCGGG - Intergenic
1119040933 14:71273972-71273994 GGAGAATGGGGTGGGGGCCCTGG - Intergenic
1119211595 14:72836161-72836183 TCAGAAGGGGTTGGAGCCTCTGG + Intronic
1119474348 14:74918572-74918594 TGCGAATGGGCCGGAGCCTCAGG + Exonic
1119489060 14:75014356-75014378 GGAGAATGGGGAGGGGGCTTGGG - Exonic
1119679352 14:76580404-76580426 AGAGAATGGGTTGGAGCAGCAGG + Intergenic
1119860091 14:77929969-77929991 GGAGATTGGGGTGAAGACTTAGG + Intronic
1120195717 14:81480278-81480300 GGAGAATGGCGTGAACCCTGGGG - Intronic
1120811583 14:88808944-88808966 GGAGGACAGGGTGGAGCCTCAGG - Intergenic
1120919144 14:89738894-89738916 GGAGAATGGCGTGAACCCTGGGG - Intergenic
1120969579 14:90196200-90196222 GGAGGACGGGGTGGAGCCTGGGG + Intergenic
1121200434 14:92112368-92112390 GGAGAATGGCGTGAACCCCCGGG + Intergenic
1121486218 14:94317413-94317435 GGAGAATGGGGTGGAGCTGTGGG + Intronic
1123390949 15:19871681-19871703 GCAAACTGAGGTGGAGCCTCGGG + Intergenic
1123418241 15:20108038-20108060 GGAGAATGGGGAGGGTCCTGGGG + Intergenic
1123468945 15:20535954-20535976 GGAGAATGGCGTGAAGCCGGGGG + Intronic
1123527459 15:21114560-21114582 GGAGAATGGGGAGGGTCCTGGGG + Intergenic
1123729221 15:23130938-23130960 GGAGAATGGCGTGAAGCCGGGGG + Intronic
1123747389 15:23328424-23328446 GGAGAATGGCGTGAAGCCGGGGG + Intergenic
1123772434 15:23541641-23541663 GGAGAATGGAGTGGAGCGTGGGG + Intergenic
1123777658 15:23596843-23596865 GGAGGGCGGGGTGGAGCCTCGGG - Intronic
1124279749 15:28352276-28352298 GGAGAATGGCGTGAAGCCGGGGG + Intergenic
1124302949 15:28559332-28559354 GGAGAATGGCGTGAAGCCGGGGG - Intergenic
1125137236 15:36357882-36357904 GGTGAATAGGGTGGAGACTAGGG - Intergenic
1125525183 15:40369902-40369924 GGAGAGTGGGCTGGGGCTTCTGG - Exonic
1125633063 15:41163651-41163673 GGAGAATGGCGTGAACCCTGGGG + Intergenic
1125966010 15:43876186-43876208 GGGAAAGGGGGTGCAGCCTCTGG - Intronic
1126336097 15:47587853-47587875 GGAGAAAGGGGAGGAGATTCAGG - Intronic
1126666155 15:51077758-51077780 GGAACAGGGGGCGGAGCCTCAGG + Intronic
1126972645 15:54134608-54134630 GGAGAATGGCGTGAACCCTGGGG - Intronic
1127126015 15:55812762-55812784 GGAGAATGGCGTGAACCCCCGGG - Intergenic
1127348330 15:58124506-58124528 GTACACTGAGGTGGAGCCTCGGG - Intronic
1127450300 15:59109893-59109915 GGAGAATGGCGTGAACCCTGGGG + Intronic
1127470460 15:59285446-59285468 GGAGAATGGCGTGAAGCCGGGGG - Intronic
1127510838 15:59639551-59639573 GGAGAATGGCGTGAACCCCCGGG - Intronic
1127829695 15:62739459-62739481 GGAGAGTTGGCTGCAGCCTCTGG + Exonic
1128542455 15:68545531-68545553 GGAGATTGGGGCCTAGCCTCAGG - Intergenic
1128841389 15:70853965-70853987 GGAGGAGGGGGCGGAGACTCGGG - Exonic
1128920183 15:71603394-71603416 GGAGAACGGGGTGGAGCCACGGG - Intronic
1129029565 15:72608607-72608629 GGAGGATGGGGTGGAATCTGAGG - Intergenic
1130219884 15:82010549-82010571 GGAAAAGGGGGAGCAGCCTCTGG - Intergenic
1131007648 15:88991460-88991482 GGAGAATGGGCTGGAGCCATGGG - Intergenic
1131145051 15:90005392-90005414 CCTGAATGGGGTGGAGCCCCTGG + Intronic
1131715959 15:95111126-95111148 GAAGAAAGGGGAGGAACCTCAGG + Intergenic
1131885074 15:96903734-96903756 GGAGAATGGGGTGGAGCCGTGGG + Intergenic
1132214206 15:100050708-100050730 GGATAATGGAGTGGAACCCCGGG - Intronic
1132524142 16:406014-406036 GGAGAAGGGGGTGGAGAATGTGG + Intronic
1132702749 16:1229072-1229094 GGGGAAGAGGGTGCAGCCTCAGG + Intronic
1132705577 16:1241796-1241818 GGGGAAGAGGGTGCAGCCTCAGG - Intronic
1132826107 16:1906491-1906513 GGAGAAAGAGGAGGAGGCTCAGG - Intergenic
1132829639 16:1921027-1921049 AGAGGATGGGGTGGAGCTTAAGG + Intergenic
1132943929 16:2521873-2521895 GGAGAATGGCGTGAACCCTGGGG - Intronic
1133066125 16:3208569-3208591 GGAGAATGGTGTGAAGCCGGAGG - Intergenic
1133066812 16:3213810-3213832 GCACAATGTGGTGGAGCCCCAGG - Intergenic
1135169079 16:20167102-20167124 GGAGATTGGGTTGGAGCTTTGGG + Intergenic
1135561377 16:23479404-23479426 GGAGAGTGAGCTGGACCCTCAGG - Intronic
1135788096 16:25368401-25368423 GGAGAATGGGGTGGAGCCACTGG + Intergenic
1136546712 16:30958570-30958592 GGAGAATCCGGGGGAGCCCCGGG + Intronic
1136733388 16:32440726-32440748 GGATTACGGGGTGGAGCCTTGGG + Intergenic
1137330779 16:47493108-47493130 GTGCAACGGGGTGGAGCCTCAGG - Intronic
1137354301 16:47744679-47744701 AGAGGTTGGGGTGGAGCCTCGGG - Intergenic
1138562799 16:57812131-57812153 GGAGAATGGCGTGAACCCTAGGG - Intronic
1138787991 16:59869171-59869193 GGAGAATGGGGCGGAGCCACTGG - Intergenic
1138943067 16:61813555-61813577 GGGGAACAGGGTGGAGCCACGGG + Intronic
1139586569 16:67907787-67907809 GGAGAATGAGGGAGAGCCCCAGG + Intronic
1139951990 16:70677034-70677056 AGAGAGTGGGGGGGGGCCTCTGG - Intronic
1141330727 16:83108556-83108578 GGAGGATGGGGTGGAGCCTAAGG - Intronic
1141523007 16:84593921-84593943 GGGGAATGGGGTGGAGAATGGGG - Intronic
1141665382 16:85462936-85462958 GGAGACGGGGATGGAGCCCCGGG - Intergenic
1141680486 16:85541072-85541094 GGAGAATGGTGGGGAGCAGCAGG + Intergenic
1142076189 16:88119610-88119632 AGAGGATGGGGTGGAGACACAGG + Intergenic
1142285940 16:89171579-89171601 GGCGGGTGGGGCGGAGCCTCTGG - Intergenic
1142371340 16:89684606-89684628 GGAGAATGGTGTGAACCCACGGG - Intronic
1142440553 16:90094890-90094912 TGAGAATGGGCAGGAGCCACCGG + Intergenic
1203019695 16_KI270728v1_random:388876-388898 GGATTACGGGGTGGAGCCTTGGG - Intergenic
1203038030 16_KI270728v1_random:662034-662056 GGATTACGGGGTGGAGCCTTGGG - Intergenic
1142650703 17:1349701-1349723 GGAGAATGGGGTGAACCCAGAGG - Intronic
1142785456 17:2218454-2218476 GGAGAATGGCGTGGACCCAGGGG + Intronic
1142804639 17:2364997-2365019 GGAGAATGGGCTGCTGCCTCGGG + Exonic
1143196677 17:5081182-5081204 GGAGAATGGTGTGAAGCCCGGGG - Intronic
1143308223 17:5966009-5966031 GGAGAATGGTGTGAACCCCCAGG - Intronic
1144796713 17:17896383-17896405 TGAGAGTGGAGTGGAGCCCCAGG - Intronic
1145023439 17:19449916-19449938 TGAGAAGGGGATGGAGTCTCAGG + Intergenic
1146409927 17:32573941-32573963 GGAGAATGGCGTGAACCCTGGGG - Intronic
1147112957 17:38277443-38277465 GGAGAATGGGGTGGGATCACAGG - Intergenic
1147359561 17:39922425-39922447 AGAGATGGGGGTTGAGCCTCTGG - Exonic
1147416324 17:40292838-40292860 GGAGAATGGCGTGAACCCACAGG + Intronic
1148023396 17:44568443-44568465 AGAGGAAGGGGTGGAGGCTCAGG - Intergenic
1148165643 17:45482448-45482470 GGAGAATGGACTGGACCCCCAGG - Exonic
1148416664 17:47511782-47511804 GGAGAATGGGGTGGGATCACAGG + Intergenic
1149102352 17:52922017-52922039 GGGGGATGGGGTGAGGCCTCGGG - Intergenic
1149107580 17:52987960-52987982 GTACACTGGGGTGGAGCCTTGGG + Intergenic
1149316060 17:55439952-55439974 GGAGAATGGCGTGAACCCCCGGG - Intergenic
1150209953 17:63436420-63436442 GGGGACTGTGGTGCAGCCTCCGG - Intronic
1150283559 17:63943356-63943378 GAAGAAAGGGGAGGAGCATCTGG - Intronic
1150396869 17:64829172-64829194 GGAGAATGGACTGGACCCCCAGG - Intergenic
1150767480 17:68013623-68013645 GGAGAAGGAGATGGAGACTCTGG + Intergenic
1150839136 17:68591737-68591759 GAGGATGGGGGTGGAGCCTCGGG + Intronic
1151175440 17:72284282-72284304 GGAGAATGAGGTTGGGCCTAGGG + Intergenic
1151559507 17:74862843-74862865 GGAGAAGCTGGTGGATCCTCAGG - Exonic
1151796729 17:76351422-76351444 GGAGAATGGCGTGAACCCTGGGG + Intronic
1151879901 17:76888681-76888703 GGAGGAAGGGGCTGAGCCTCAGG + Intronic
1152231748 17:79117391-79117413 GGAGCGTGGGGTGGAGGCGCAGG - Intronic
1152248014 17:79196008-79196030 GGAGGCTGGGGTGGAGCATGAGG - Intronic
1152399605 17:80057783-80057805 GGAGAATGGCGTGAACCCTGGGG + Intronic
1152672371 17:81616637-81616659 GGAGAATGGGGTGAACCCAGGGG + Intronic
1152742317 17:82023682-82023704 GGAGAGTGGGGCCGAGCCCCAGG + Exonic
1152960846 18:79479-79501 GGACAGCAGGGTGGAGCCTCAGG - Intergenic
1152960857 18:79513-79535 GGACAGCAGGGTGGAGCCTCAGG - Intergenic
1152960868 18:79547-79569 GGACAGCAGGGTGGAGCCTCAGG - Intergenic
1154497895 18:14975616-14975638 GCAGAATGGGGCGGGGCTTCCGG + Intergenic
1155284101 18:24271461-24271483 GCAGAGTGGGGTGCAGCCGCGGG - Intronic
1156972295 18:43170934-43170956 GGAGAATGGGGTGAAGACTTGGG + Intergenic
1157920580 18:51709314-51709336 GCAGAAGGGGGTGGAGTCTGTGG + Intergenic
1158641504 18:59207647-59207669 GCGCACTGGGGTGGAGCCTCAGG + Intergenic
1158893653 18:61894513-61894535 GGAGGAGGGGGTGGAGCCGCCGG - Intergenic
1158968235 18:62642515-62642537 GGAGGATGAGGTGCAGCCTTGGG - Intergenic
1159357021 18:67349489-67349511 GGAGGACGTGGTAGAGCCTCAGG - Intergenic
1160125816 18:76170313-76170335 GGAGGGAGGGGTGGAGCCTCTGG + Intergenic
1160482586 18:79255710-79255732 GACGAATGGGGTCGAGTCTCTGG + Intronic
1160918348 19:1508207-1508229 GAAGATGGGGGTGGAGCCTAGGG + Intronic
1160918392 19:1508317-1508339 GGGGAAGGCGGTGGAGCCTAGGG + Intronic
1161459501 19:4388476-4388498 GGAGAAGTGGGAGGAGCCGCAGG + Intronic
1161724798 19:5922499-5922521 GGACGGTGGGGTGGAACCTCTGG + Intronic
1161785583 19:6323327-6323349 GGAGAATGGTGTGAACCCTAGGG + Intronic
1161824614 19:6554048-6554070 GGAGAATGGTGTGAACCCTGGGG - Intergenic
1161876697 19:6917401-6917423 GTAGAGTGGGCTGGAGCATCAGG + Intronic
1161975361 19:7605455-7605477 TGAGAATGGGCTGGTGCCTCAGG - Exonic
1162488635 19:10977845-10977867 GGAGGAGGAGGTGGAGCCACAGG + Intronic
1163250219 19:16122409-16122431 GGAGCAGGAGGTGGAGCCCCTGG + Intronic
1163752416 19:19085699-19085721 TGAGAATGGGGTGAAGACACAGG - Intronic
1164203085 19:23034435-23034457 GGAGGATGGGGCAGAGCCTCAGG - Intergenic
1164406783 19:27955651-27955673 GGAGAATGGGGTGGGGTCACGGG + Intergenic
1164810851 19:31154711-31154733 GGAGGATGGGATGGAACCTCGGG - Intergenic
1164973633 19:32553416-32553438 GGAGAATGGCGTGAAGCCAGCGG + Intergenic
1165157132 19:33795743-33795765 GGAGACTGGGGAGGGGCGTCCGG + Intergenic
1165205396 19:34180734-34180756 GGGGAATGGGGTGGGGGCTGAGG - Intronic
1165344926 19:35239307-35239329 GGGGAATGGTGTGGTGTCTCAGG + Intergenic
1165485417 19:36092581-36092603 GGAGAATGGGGTCCAGGCTGTGG + Intronic
1165613640 19:37179183-37179205 AGTGAATGGGGTGGAGCATATGG + Intronic
1165705852 19:37975764-37975786 GGAGTCAGGGGTGCAGCCTCTGG + Intronic
1166124853 19:40708559-40708581 GCAGAGTGGGGTGTAGACTCAGG + Intronic
1166326554 19:42054379-42054401 GGAGATCGGTGTGAAGCCTCTGG - Exonic
1166724954 19:45021381-45021403 GGAGAATGGCGTGAACCCGCAGG + Intronic
1166862729 19:45819211-45819233 GGAGAATGGATCGGAGGCTCGGG - Intronic
1166882748 19:45939415-45939437 GGAGGAGGGGAGGGAGCCTCTGG - Exonic
1167112875 19:47472098-47472120 GGAGGCTGGGGAGGAGGCTCGGG - Exonic
1167337598 19:48896336-48896358 GGATGAAGGGGTGGAGCCTTAGG - Intronic
1167483363 19:49746325-49746347 GGTGACATGGGTGGAGCCTCGGG - Intronic
1167685511 19:50953209-50953231 GGAGAATGGGGAGGGGTCTCCGG + Intergenic
1167705703 19:51079744-51079766 GGAGGGTGGGGAGGAGTCTCTGG - Intronic
1168111261 19:54192375-54192397 TGAGTATGGGTTGGGGCCTCTGG + Intronic
1168357099 19:55707642-55707664 GCAGACTGGGGTGGGGACTCTGG + Intronic
1168407494 19:56118543-56118565 GGGGTATGGGATGGAGGCTCTGG - Intronic
1202697148 1_KI270712v1_random:133416-133438 GGAGAATGGGGTGAGGCCTGAGG - Intergenic
925341755 2:3142785-3142807 GGAGAATGTGGTGGTGCGTTCGG - Intergenic
925611314 2:5705603-5705625 GGAGAATGGGGTGGAGGAGCAGG + Intergenic
925611565 2:5706364-5706386 GGAGACTGGGGTGGAGAAGCTGG + Intergenic
925611587 2:5706430-5706452 GGAGACTGGGGTGGAGGAGCAGG + Intergenic
925611625 2:5706540-5706562 GGAGACTGGGGTGGAGGAGCAGG + Intergenic
925939014 2:8797175-8797197 GGAGAACGGGAAGTAGCCTCTGG - Intronic
927124984 2:20005906-20005928 GGTGAATGAGGTGGCGGCTCGGG - Exonic
927399263 2:22692032-22692054 GGAGAATGGTCTAGATCCTCTGG - Intergenic
927707145 2:25303469-25303491 GGAGGAAGGGGTGGACCCCCCGG + Intronic
927909874 2:26889767-26889789 GGTGAGTGGGGTGGATACTCTGG - Intronic
928055097 2:28044568-28044590 GTAGAATGGAGTGGAGGCTGTGG + Intronic
928358052 2:30638765-30638787 GGAGAATGGGGAGGAGGAGCAGG - Intronic
929115718 2:38442245-38442267 GGAGAACAGGGTGGAGCCTTGGG + Intergenic
930630758 2:53752484-53752506 GAAGAATGGGGTGAAGCCACTGG - Intronic
931054856 2:58457967-58457989 GGGGAATGGGGTGGGTTCTCTGG + Intergenic
931470984 2:62537381-62537403 AGAGACTGGGGTGGAGCCACAGG + Intergenic
932046770 2:68357790-68357812 GGAGGATGGAGTGGGGCCTTGGG - Intergenic
932245031 2:70189624-70189646 GGAGAATGGCGTGAACCCTGGGG + Intronic
932303703 2:70686676-70686698 GAAGAATCTGGTGGAGCCTCTGG - Intronic
932827992 2:74958933-74958955 GGAGTGTGGGGCGGGGCCTCGGG + Intronic
933495539 2:83046161-83046183 GGAGAAATGGGTGGAGCCATGGG - Intergenic
934084958 2:88502274-88502296 GGAGAATGGGGCTGAGCCCAGGG - Intergenic
934278314 2:91590432-91590454 GGAGAATGGGGTGAGGCCTGAGG - Intergenic
934931533 2:98429660-98429682 GGAGAACCGGGTGGAGCCGGGGG + Intergenic
935267636 2:101408392-101408414 GGAGAATGGCGTGAACCCTGGGG + Intronic
935668299 2:105533789-105533811 GGAGAATGGCGTGAACCCTGGGG - Intergenic
936578608 2:113676052-113676074 GCACACTGGGGTGGAGCCTCGGG + Intergenic
936733244 2:115408284-115408306 GGAGATTGGGGTGGAGCCTCAGG - Intronic
937402027 2:121592741-121592763 GGAGAATGGCGTGAACCCTGGGG - Intronic
938529543 2:132170445-132170467 GCACACTGAGGTGGAGCCTCGGG - Intronic
938693745 2:133816052-133816074 AGTGAATGGGGTGGGGTCTCTGG - Intergenic
938850902 2:135258350-135258372 GGAGGATGTGGTGGAGCCTTGGG + Intronic
940116987 2:150219960-150219982 GGAGGACGGGGTGGGGCCTCAGG - Intergenic
940264161 2:151818925-151818947 GGGGAATGGGGTGGAGGCGGGGG - Intronic
941854112 2:170212766-170212788 GGGGAAATGGGTGGAGCCACGGG - Intronic
941992623 2:171571888-171571910 GCGCACTGGGGTGGAGCCTCCGG - Intergenic
942838920 2:180336466-180336488 GCACACTGGGGTTGAGCCTCGGG + Intergenic
943149789 2:184097718-184097740 GGAGAATGGGGTGGAGCCACCGG + Intergenic
943246291 2:185455666-185455688 GGAGAATGGGGTGGAGCCACGGG + Intergenic
944073076 2:195695090-195695112 GCGCACTGGGGTGGAGCCTCAGG - Intronic
944730668 2:202514225-202514247 GGAGAATGGCGTGAACCCTGGGG - Intronic
944960112 2:204862983-204863005 GGAGGACGGGGTGGAGCCTCCGG - Intronic
944964398 2:204914091-204914113 GCACAATGGGGCGGAGCCTTGGG + Intronic
945061300 2:205911196-205911218 TGAGAATGTGGTGGAGCTACAGG + Intergenic
945217246 2:207446847-207446869 GCACACTGGGGTGGAGCCTCGGG + Intergenic
945468639 2:210201099-210201121 GGAGGACGGGGTGGAGCCTCGGG + Intronic
945631897 2:212288482-212288504 GCGCACTGGGGTGGAGCCTCAGG + Intronic
946034021 2:216727530-216727552 GGGGTAAGGGGTGGAGACTCAGG + Intergenic
946231691 2:218295456-218295478 GGGGAATGGGGTGGGGGTTCGGG + Intronic
946297133 2:218794169-218794191 GCGCACTGGGGTGGAGCCTCGGG - Intronic
946412345 2:219521636-219521658 AGTGAAGGGGGTGGAGCCTGAGG + Intronic
946535971 2:220628688-220628710 GGAGACTGTGGTGGTGTCTCTGG + Intergenic
946873790 2:224108340-224108362 GGAGGACAGAGTGGAGCCTCAGG - Intergenic
947136263 2:226979474-226979496 GGAGGATGGGGTGGGGTCTCGGG - Intronic
947817646 2:233048786-233048808 GGAGAATCTGGAGGAGCCCCTGG + Intergenic
948022216 2:234744040-234744062 GAAGAATGCTGTGGACCCTCAGG + Intergenic
949037250 2:241821482-241821504 GGATCATGGGGTGGACTCTCAGG + Intergenic
1169603544 20:7289999-7290021 GGACGATGGGGTGGAGTCTTGGG - Intergenic
1170877920 20:20267878-20267900 GCACATTGGGGTGGAGCCTCCGG - Intronic
1170942136 20:20857130-20857152 GAAGCAAGGGGTGGTGCCTCTGG + Intergenic
1170946999 20:20900462-20900484 GGAGAGTGGGGTAGAGCCACTGG - Intergenic
1171238241 20:23545266-23545288 GGAAGATGGGGTGGAGCCTGGGG - Intergenic
1172365198 20:34343727-34343749 GAAGAACAGGGTGGAGCCACAGG + Intergenic
1174165210 20:48579395-48579417 GGAGAATGGCGTGAACCCTGGGG - Intergenic
1174286794 20:49479772-49479794 GGAGACTGGGGAGGAGGCTGCGG + Intronic
1176040800 20:63064817-63064839 GGAGAATGGGAGGGAACCTCGGG - Intergenic
1176171438 20:63698095-63698117 GGAGAAGGGGCAGGAGCCTTCGG - Intronic
1176222332 20:63975551-63975573 TGAGAATGGGGTGGGGTCTTTGG + Intronic
1176233474 20:64043049-64043071 GGAGGATGGGGTGGGGTCCCGGG + Intronic
1176277201 20:64279140-64279162 GTACAGTGGGGTGGAGACTCAGG + Intronic
1176766970 21:13029482-13029504 GCACACTGAGGTGGAGCCTCAGG + Intergenic
1176972340 21:15281153-15281175 GGAGAATGCTGTGGAGCCATGGG - Intergenic
1177200304 21:17946326-17946348 GGAGAATGGCGTGAACCCCCGGG + Intronic
1177332547 21:19682035-19682057 GGAGAATGGCGTGAACCCTGGGG - Intergenic
1177405517 21:20662713-20662735 GGAGAATGGGGTGGAGCCACTGG + Intergenic
1177414392 21:20775853-20775875 GGAGAGTGGGGTGGAACCACAGG - Intergenic
1177567372 21:22843066-22843088 GGAGAATGGGGTGGAGTCCCTGG - Intergenic
1177571333 21:22890730-22890752 GAAGAATTGGGTGGAACCACTGG - Intergenic
1177702220 21:24653905-24653927 AGAGAATGGGCTGGAGAGTCTGG + Intergenic
1177944141 21:27446189-27446211 GGAGAACAAGGTGGAGCCACCGG - Intergenic
1178838490 21:36118755-36118777 GGAGAATGGCGTGAACCCCCGGG + Intergenic
1178934521 21:36850313-36850335 GGAGAATGGGGAGGCAACTCCGG + Intronic
1179956194 21:44740449-44740471 GGAGAATGGGGTGGAGGCATGGG + Intergenic
1180017020 21:45093693-45093715 GGAGACTGTGCTGCAGCCTCAGG + Intronic
1180153141 21:45962724-45962746 GGAGAATGGGGTGGAGCCACAGG - Intergenic
1180185141 21:46135704-46135726 GGAGACTGGGGAGGGGACTCAGG - Intergenic
1180431538 22:15255846-15255868 GCACACTGAGGTGGAGCCTCTGG + Intergenic
1180514098 22:16123758-16123780 GCACACTGAGGTGGAGCCTCGGG + Intergenic
1180539078 22:16424360-16424382 GGATTACGGGGTGGAGCCTCGGG - Intergenic
1181468617 22:23124634-23124656 GGAGCAAGGGGTGGTGCCCCTGG + Exonic
1181627602 22:24132338-24132360 GGAGAAAGGGGTGGGGCTTCAGG - Intronic
1182943992 22:34305252-34305274 GGAGAATGGTGTGAACCCTGGGG - Intergenic
1183303256 22:37068959-37068981 GGCCTATGGGGTGGAGCCCCGGG + Intronic
1184462755 22:44648649-44648671 GGAGGGTGGGGTGCAGCCTGAGG - Intergenic
1184704824 22:46203763-46203785 GGAGAATGGGGTGGAGCCACGGG - Intronic
1184905573 22:47483629-47483651 GGAGGACGGGGTGGGACCTCAGG - Intronic
1185372775 22:50468661-50468683 GGAGAATGGGGTGTAGCGGCAGG - Intronic
949984868 3:9532805-9532827 GGAGAAGGGAGTGGGGCCTCTGG - Intronic
951406203 3:22301274-22301296 GGAGTTTGGGGTGGAGCCAAAGG + Intronic
952253577 3:31676921-31676943 GGAGAAAGGGGTGCAGTCTCTGG + Intronic
952769001 3:36980351-36980373 GGAGAATGGCGTGAACCCACAGG - Intergenic
952994985 3:38871147-38871169 GCAGAGAGGAGTGGAGCCTCAGG - Intronic
953437030 3:42885797-42885819 GGAGACTGGGGTGTAGCCACCGG - Intronic
953647457 3:44768500-44768522 GGAGAATGGAGTGGAGCCACTGG - Intronic
953978820 3:47403141-47403163 GGAGAATGGCGTGAACCCCCGGG - Intronic
953990330 3:47478359-47478381 TGAGAATCCTGTGGAGCCTCTGG + Intergenic
954028763 3:47803318-47803340 GGAGAGTGGGGCGGAGACGCCGG + Intronic
954193799 3:48984037-48984059 GCAGAATGGGGTTGGGCCTGTGG + Exonic
954358782 3:50106229-50106251 GGAGAATGGCGTGAACCCTGGGG - Intronic
954446137 3:50547828-50547850 GGAGGATGGGGTGAGCCCTCTGG - Intergenic
954959513 3:54551613-54551635 TCAGAATGGTGTGAAGCCTCAGG + Intronic
955037484 3:55283171-55283193 GTGCACTGGGGTGGAGCCTCTGG + Intergenic
957003936 3:74921295-74921317 GGAGAATTTGGGGGAGCTTCAGG + Intergenic
957003962 3:74921557-74921579 GGAGAATTTGGGGGAGCTTCAGG + Intergenic
957028225 3:75209256-75209278 GGAGAGTGGGATGGAGCCACCGG + Intergenic
957574640 3:81991395-81991417 GCCCACTGGGGTGGAGCCTCAGG + Intergenic
957986796 3:87582343-87582365 GCACACTGGGGTGGAGCCTCAGG + Intergenic
958047943 3:88307839-88307861 GGAGGACGGGGTGGAGCCTTGGG + Intergenic
958536189 3:95407796-95407818 GAAGAATGGGGTGAAGCCATGGG + Intergenic
958536701 3:95412671-95412693 GGAGAAGGGGGTGGAGTCATGGG + Intergenic
958743803 3:98109401-98109423 GTGCACTGGGGTGGAGCCTCAGG + Intergenic
958974682 3:100654129-100654151 GGAGAACGGGGTGGAGCTGTGGG - Intronic
959011170 3:101078191-101078213 GGAGAATGGCGTGAACCCGCGGG - Intergenic
959429632 3:106236679-106236701 GGAGAATGGGGTGGAGCCACAGG + Intergenic
959486838 3:106936447-106936469 TAAGGATGGGGTAGAGCCTCAGG - Intergenic
959572932 3:107904892-107904914 GGAGGATGGGGTGGAGCCTGGGG - Intergenic
959660604 3:108863938-108863960 GGAGGACAGGGTGCAGCCTCGGG - Intergenic
960597003 3:119415595-119415617 GGAGAATGGGGTTCAGCCTCTGG + Exonic
960702374 3:120451048-120451070 GGAGAATGGGGAGGAGCTGGGGG - Exonic
960768515 3:121165785-121165807 GCACACTGGGGTGGAGCCTCGGG - Intronic
961028590 3:123583264-123583286 AGAGAATGGGGTGGAGGGTAAGG - Intronic
961082470 3:124037991-124038013 GGAGCATGGGCTGGAGGCTAGGG + Intergenic
961650688 3:128415365-128415387 GGGTGGTGGGGTGGAGCCTCAGG + Intergenic
961715185 3:128853094-128853116 GGAGAATGGCGTGAACCCCCGGG - Intergenic
962126713 3:132627148-132627170 GGGGAATGGGGTGGAGCCACCGG + Intronic
962205065 3:133427594-133427616 GGAGAATGGGGTGGCATTTCAGG + Intronic
962386630 3:134937436-134937458 GAAGGAAGGGGTGGGGCCTCTGG - Intronic
962582604 3:136811888-136811910 AGAGAATGGGGTGGAGCCACCGG - Intergenic
962859805 3:139389370-139389392 GGAGAAGGCGGTGGGGCCTAGGG - Intronic
963185539 3:142411911-142411933 GGAGAATGGCGTGAACCCCCGGG - Intronic
963435465 3:145260021-145260043 GGAGAATGGGGTGGAGCCACTGG - Intergenic
963805129 3:149714683-149714705 GCAGAATGGGGTGGGTCCCCAGG + Intronic
963970530 3:151424526-151424548 GGAGAATGGCGTGAACCCCCGGG + Intronic
964073108 3:152659181-152659203 GCACACTGGGGTGGAGCCTCAGG - Intergenic
964157387 3:153602648-153602670 GGAGAATGGAGTGGACGCACAGG - Intergenic
964169986 3:153758543-153758565 GGAGAATGGCGTGAACCCCCGGG - Intergenic
964304447 3:155325603-155325625 GCACACTGGGGCGGAGCCTCGGG + Intergenic
964362002 3:155908252-155908274 GGAGAACAGGGTGGGGCCACAGG + Intronic
964368150 3:155971094-155971116 GGAGTCTGGGATGGTGCCTCTGG - Intergenic
964980389 3:162670373-162670395 GCAGGCTGGGGTGGAGCCTCAGG + Intergenic
965003206 3:162984969-162984991 GGAGAACAGGGTGGAGCCACAGG - Intergenic
966143845 3:176787676-176787698 GGAGGGTGGGGTGGAGCCACGGG - Intergenic
966196537 3:177319480-177319502 GGAGAATGGGGTGAACCCTCGGG + Intergenic
966493305 3:180552385-180552407 GGAGCATGGCTTGGAGTCTCAGG - Intergenic
966883212 3:184361440-184361462 GGAGGAAGGGATGGAGCCACGGG - Exonic
966931220 3:184677070-184677092 GGAGAATGTGCTGGAGACACAGG + Intronic
967546234 3:190732063-190732085 GGAGAACAGGGTGGAGCCACGGG - Intergenic
967966775 3:194966916-194966938 GAAGAATGTTGTCGAGCCTCTGG - Intergenic
968381573 4:101102-101124 GAAGGGTGGGGTGGAGCCACTGG + Intergenic
968398560 4:267211-267233 GGAGAATGGTGTGAACCCTGGGG + Intergenic
968669364 4:1840574-1840596 GGAGAATGGTGTGGACCCCGGGG + Intronic
968886052 4:3333138-3333160 GGAGAATGGCGTGAACCCTGGGG - Intronic
969755046 4:9143805-9143827 GGAGAGTTGGGGGGAGGCTCAGG - Intergenic
969903530 4:10371969-10371991 GGGGACTGGGGTGGAGCCACAGG - Intergenic
969909615 4:10431581-10431603 GGAGAATGGGCAGGTGCTTCAGG - Intergenic
971572411 4:28230206-28230228 GGAGAATGAGGTGGAGACGCAGG + Intergenic
972194926 4:36641902-36641924 GGAGAATGGCGTGAACCCGCGGG + Intergenic
972679383 4:41290698-41290720 GGAGAACAGGGTGGAGCCTCGGG - Intergenic
972701087 4:41494031-41494053 TGTGCATGGGGTGGATCCTCTGG + Intronic
973226455 4:47790308-47790330 GTGCACTGGGGTGGAGCCTCAGG + Intronic
975349867 4:73333365-73333387 GGAGAATGGTGTGAACCCTGAGG - Intergenic
976316380 4:83663617-83663639 GGAGAACAGGGTGGTGCCACAGG - Intergenic
976724519 4:88202644-88202666 GGAGAACGGGGTGGAGCCATGGG - Intronic
976751558 4:88455459-88455481 GGAGAGTGGGGTGCAGCCAGAGG - Intergenic
976862424 4:89681416-89681438 GGAGAGTGGGGTGGAGCCACCGG + Intergenic
977054586 4:92175460-92175482 GGAGAATAGGGTGGAGCCTCAGG - Intergenic
977315647 4:95444420-95444442 GGAGAATGGCGTGAAGCCAGGGG - Intronic
977405836 4:96597553-96597575 GGAGAATGGCGTGAACCCTGGGG + Intergenic
977750217 4:100600931-100600953 GGAGAATGGCGTGAACCCTGAGG + Intronic
977823432 4:101502591-101502613 GGAGACTGGGGTGGGGCCTCAGG + Intronic
977891838 4:102321376-102321398 GGAGAATAGGATGGAGCCATGGG + Intronic
977944518 4:102896559-102896581 GGATTACGGGGTGGAGCCTCGGG - Intronic
978665529 4:111176913-111176935 GGAGAATGGCGTGAACCCTGGGG + Intergenic
978887088 4:113776867-113776889 GGAAGACGGGGTGGAGCCTTGGG + Intergenic
979772351 4:124543465-124543487 GGAGAATGGCGTGAACCCTGGGG + Intergenic
980048078 4:128011237-128011259 GGAGAATGGTGTGAACCCTGGGG - Intronic
980339863 4:131531441-131531463 GGAGGATGGGATGGGGCCTGGGG - Intergenic
980479359 4:133367235-133367257 GGAGGACAGGGTGGAGCCTCGGG + Intergenic
980533471 4:134085061-134085083 GGAGGAGCGGGTGGAGCCTCAGG - Intergenic
980694942 4:136342345-136342367 GGAGAATGGCGTGAACCCCCGGG + Intergenic
980722402 4:136716136-136716158 GCTCACTGGGGTGGAGCCTCTGG + Intergenic
980723009 4:136721276-136721298 GTGCACTGGGGTGGAGCCTCAGG + Intergenic
981189961 4:141851180-141851202 GGAGGACGGAGTGGAGCCTCGGG + Intergenic
981491119 4:145340485-145340507 GGAGGATGGGGTGGAGCCACAGG + Intergenic
981770755 4:148304773-148304795 GGAGAATGCGGTGGAGCCACTGG + Intronic
982041262 4:151399198-151399220 GGAGAATGGCGTGAACCCTGGGG + Intergenic
982055179 4:151541980-151542002 GGAGGATGGGTTGGAGCCTTGGG + Intronic
982473439 4:155821859-155821881 GGAGGACAGAGTGGAGCCTCAGG + Intergenic
982474324 4:155831678-155831700 GGAGAATGGTGTGAACCCCCTGG + Intronic
982475282 4:155842997-155843019 GGAGGAAGGGGTGGAGCCTTGGG - Intronic
982478205 4:155878149-155878171 GAAGAATGGGACGTAGCCTCAGG - Intronic
982526639 4:156487329-156487351 GGAGAATGGGGTGGAGCCACTGG + Intergenic
982916076 4:161211271-161211293 GGAGAATGGCGTGGACCCGGAGG - Intergenic
983040625 4:162921324-162921346 GGAGTACAGGGTGGAGCCGCAGG + Intergenic
984039915 4:174719052-174719074 GGAGAATGGGGTGAACCCCAGGG - Intronic
984327329 4:178270995-178271017 GGAGAATGGGGTGGAGCCACTGG + Intergenic
984512775 4:180698988-180699010 GGAGAATGGGGTGGAGCCACAGG + Intergenic
984732925 4:183085214-183085236 GGAGAATGGCGTGAACCCTGGGG - Intergenic
984767483 4:183410576-183410598 AGAGAATGGGGTGGAGACCCGGG - Intergenic
985511239 5:315402-315424 GGAGAATGAGGCTGGGCCTCGGG - Intronic
985530896 5:433365-433387 GGAGAGTGGGGAGGGGCCTGTGG - Intronic
985839282 5:2293899-2293921 GGAGAAAGCGCTGGAGCCTCGGG + Intergenic
985956596 5:3270430-3270452 GGAGAATGGCGTGAACCCCCAGG - Intergenic
986213295 5:5694546-5694568 GTGCACTGGGGTGGAGCCTCGGG + Intergenic
986439243 5:7763946-7763968 GGAAATTGACGTGGAGCCTCGGG - Intronic
987082139 5:14435343-14435365 GCACATTGTGGTGGAGCCTCGGG - Intronic
987155134 5:15081586-15081608 GGGCACTGGGGTGGAGCCTTGGG - Intergenic
987831554 5:23102164-23102186 GGAGGATGGGGTGGGTCCTGAGG + Intergenic
987963079 5:24835827-24835849 GCACACTGGGATGGAGCCTCGGG - Intergenic
988069842 5:26273827-26273849 GGAGAATCAGGTGGAGCCACCGG + Intergenic
988211375 5:28209212-28209234 GGAGAATGGTGTGGGGCCATGGG + Intergenic
988304585 5:29478721-29478743 GGAGAAGGGCGTGGAGCCACCGG + Intergenic
988440714 5:31229146-31229168 GGAGAATCGGGTAGAGCTTGAGG - Intronic
988585971 5:32507854-32507876 GGAGGATCGGGTGGAGCCTTGGG - Intergenic
989438148 5:41438458-41438480 GGAGAATGGGGTGGAACCAGGGG + Intronic
989558107 5:42820429-42820451 GGAGAATGGGGTGGAGCCACTGG - Intronic
990444899 5:55885529-55885551 GGAGAATGGGGTGGAGCCACGGG - Intronic
990850107 5:60193577-60193599 GGAGAATGGCGTGAACCCCCAGG + Intronic
991083029 5:62621465-62621487 GGAGGACAGGGTGGAGCCTTGGG - Intronic
991202294 5:64008489-64008511 GGAGGATGGGGTGGAGCCATGGG + Intergenic
991465418 5:66907306-66907328 GGAGGATGAGGTAAAGCCTCGGG - Intronic
992894126 5:81232501-81232523 GGAGCAAGGGGTGGAGCCCCAGG - Intergenic
993316495 5:86413579-86413601 GGAGAATGGCGTGAAGCCCGGGG - Intergenic
993728688 5:91397285-91397307 GGAGGATGGAGTGGAGCCTTAGG - Intergenic
994979635 5:106857021-106857043 GGGGAAGGGGGTGGAGCCAGGGG - Intergenic
995662364 5:114499618-114499640 GGAGCAGTGGGTGGAGGCTCAGG - Intergenic
995700011 5:114924987-114925009 GGGGAATGGGGTGGAGCTACTGG + Intergenic
996223862 5:120965557-120965579 GAAGGATGGAGTGGAGCCTTGGG - Intergenic
996670184 5:126108652-126108674 AAAGAATGGGGTGGAACCACGGG + Intergenic
996677022 5:126188068-126188090 GGAGGTTGGGGTGTAGCCTTGGG + Intergenic
996703271 5:126471181-126471203 GGAGAATGGGTAGGAGGCCCTGG - Intronic
996709030 5:126525745-126525767 GGAGGATGGGGTGGAGCCTCAGG + Intergenic
997377601 5:133408487-133408509 GGAGAAGGGGCTGGAGCCAGAGG + Intronic
998651121 5:144122807-144122829 GGAGGATGGGGTAGAGCCTCGGG - Intergenic
999256624 5:150213221-150213243 GGAGGCTGGTGTGGAGCCTTGGG + Intronic
999451594 5:151682313-151682335 AGAGGCTGGGGTGGAGCTTCAGG + Intronic
999992030 5:157058470-157058492 GGAGAATGGCGTGAACCCGCGGG + Exonic
1000241811 5:159415722-159415744 GGAGAACGGGGTGGAACCAGGGG + Intergenic
1000675682 5:164119974-164119996 GGGGAAGTGGGTGGAGCCACAGG - Intergenic
1001169385 5:169404352-169404374 GAAGACTGGGGTGGAGGTTCAGG - Intergenic
1001291985 5:170470263-170470285 GGGGCATAGGGAGGAGCCTCAGG - Intronic
1001760046 5:174200050-174200072 GGAGAATGGTGTGAAGCCAGGGG - Intronic
1001822127 5:174718648-174718670 GGAGAAGGGGGTGGAGCAACTGG + Intergenic
1002473787 5:179452688-179452710 GGAGAGTGGGAAGGAGCCCCAGG - Intergenic
1002702047 5:181131055-181131077 CGAGAGTCGGGTGGAGCCTGGGG + Intergenic
1003245291 6:4377747-4377769 GGTCAAAGGGGTGGAGACTCTGG - Intergenic
1005042073 6:21608868-21608890 GGAGAACGGGGTGGAGTCGCGGG + Intergenic
1005055213 6:21722692-21722714 GGAGGATAGGGTGGAGCCGCAGG - Intergenic
1005638357 6:27772199-27772221 TGACAATGTGGTGCAGCCTCTGG + Intergenic
1005693443 6:28329350-28329372 GGAGAGTGGGGAGGAGGCTGTGG - Exonic
1005851471 6:29826416-29826438 CAAGAATGAGGTGGAGCCACTGG + Intergenic
1005981578 6:30840844-30840866 GGAAAATGGGGTGGAGCCACGGG - Intergenic
1005981938 6:30843393-30843415 GGAGAAGGGGGTGGAGCCACGGG + Intergenic
1006056699 6:31390563-31390585 GGAGGATGGGGTGGAGCTACCGG - Intergenic
1006069419 6:31487478-31487500 GGAGGATGGGGTGGAGCTACCGG - Intergenic
1006173213 6:32107378-32107400 GGAGATTGGGAAGGAGCCTCTGG - Intronic
1006442710 6:34062069-34062091 GGAGAGTGGTGGGGAGACTCAGG - Intronic
1007154070 6:39725225-39725247 GGGGTACGGGCTGGAGCCTCCGG - Exonic
1007281992 6:40719690-40719712 GGAGAGTGGGGTGGAGCGTGGGG + Intergenic
1007580370 6:42955525-42955547 GGAGAATGGTGTGAACCCTGGGG - Intergenic
1008197562 6:48543152-48543174 GGAGAATGGCGTGAACCCCCGGG + Intergenic
1008985930 6:57543028-57543050 GGAGAATGGCGTGAAGCCCAGGG - Intronic
1009631541 6:66207583-66207605 GGAGAATGAGGTGGAGCCACTGG + Intergenic
1009632347 6:66214881-66214903 GGAGAGTGGGGTGGAGACACTGG + Intergenic
1010035149 6:71317307-71317329 AGAGAATGTGGTGGGGCCTGGGG + Intergenic
1010609452 6:77935573-77935595 CGAAAATGGGGAAGAGCCTCAGG + Intergenic
1010873025 6:81064747-81064769 GGAGGATGGGAGGGAGACTCAGG - Intergenic
1011330734 6:86203444-86203466 TGAGAATTTGGGGGAGCCTCTGG + Intergenic
1011591276 6:88972663-88972685 GTACACTGGGGTGGAGCCTCGGG + Intergenic
1011882381 6:92045784-92045806 GGAGAATGGGGTGGAGCCACCGG + Intergenic
1012583070 6:100892265-100892287 GGAGGATGGGGTGGAGCCTCAGG + Intergenic
1012595459 6:101032764-101032786 GGAGAGTGGGGTGGAACCACTGG + Intergenic
1012742796 6:103041122-103041144 GGAGAATGGGGTGCAGCCACTGG - Intergenic
1012795202 6:103750771-103750793 GGAGAATGGGGTGGAGCCATGGG + Intergenic
1012804505 6:103877549-103877571 GGGGAAATGGGTGGAGCCACGGG + Intergenic
1013286822 6:108689269-108689291 GGAGGATGGGAGGGAGGCTCAGG + Intergenic
1014221204 6:118800501-118800523 GGAGAAGGGGAGGGCGCCTCAGG - Intergenic
1014274210 6:119368351-119368373 GGGGAATGGGGTGGAGCCACTGG + Intergenic
1014674717 6:124349316-124349338 GGAGAATGGGGTGGAGCCTCGGG - Intronic
1014793042 6:125696507-125696529 GGAGAATGGCGTGAACCCCCGGG - Intergenic
1014800519 6:125772135-125772157 GGAGAATGGGGTGAACCCGGTGG - Intergenic
1014953399 6:127586463-127586485 GCAGCATGGGGTGGAGCCACAGG - Intronic
1015751471 6:136564230-136564252 TGGGAATGGGGTCGAGCCTGGGG - Intronic
1015813111 6:137180721-137180743 GGAGAATGGGGTGGAGCCACTGG - Intergenic
1015814169 6:137191126-137191148 GGTTACTGGGGTGGAGCCTAAGG - Intergenic
1015855793 6:137623143-137623165 TGAAAATGGCGAGGAGCCTCTGG - Intergenic
1016409345 6:143765581-143765603 GGAGAAGGTGCTGGAGCCACAGG - Exonic
1016889551 6:148992376-148992398 GGAGAATGGGGTGAACCCGAGGG + Intronic
1017240031 6:152157847-152157869 GGAGAATGAGGAGGAGAATCAGG - Intronic
1018260854 6:161969389-161969411 GGAGAAAGGGATGGAGCCTTGGG + Intronic
1018494731 6:164337691-164337713 GGTGAGTGGGGTGAGGCCTCTGG - Intergenic
1018902645 6:168059068-168059090 GGAGAAGGGGGTGGAGGAGCAGG + Intronic
1019206211 6:170364203-170364225 GGAGAAGGTGGAGGAGACTCAGG - Intronic
1019327512 7:445655-445677 AGAGAGTGGGGTGGGGCCTCAGG - Intergenic
1019395203 7:814396-814418 GGAGAATGGCGTGAACCCCCGGG + Intergenic
1019513335 7:1429218-1429240 GGAGAAGTGGGGGGAGCTTCGGG + Intronic
1019988225 7:4673767-4673789 GGAGAATGGCGTGAACCCTGGGG + Intergenic
1020676652 7:11192002-11192024 GCCCACTGGGGTGGAGCCTCGGG + Intergenic
1020819960 7:12954963-12954985 GGAAAATGGTGTGGAGTGTCAGG - Intergenic
1020904906 7:14052803-14052825 GGACACTGGGATGGAGCCTGGGG - Intergenic
1021054954 7:16035954-16035976 GCCCACTGGGGTGGAGCCTCAGG + Intergenic
1021550861 7:21869626-21869648 GGAGAATGTGGTAGAGCCATAGG - Intronic
1021647636 7:22802089-22802111 GGAAAATGGGGCGGAGCCATAGG + Intergenic
1021648336 7:22808318-22808340 GGGGAACGGGGTGGAGCCATGGG + Intergenic
1021692483 7:23243856-23243878 GGAGAATGGCGTGAACCCTGGGG + Intronic
1022084502 7:27053383-27053405 AGAGAATGGGGTAGAGCCCTGGG - Intergenic
1022164521 7:27744214-27744236 GGAGAATGGCGTGAACCCTGGGG - Intronic
1022678914 7:32526110-32526132 GGAGGACAGGATGGAGCCTCAGG - Intronic
1022679047 7:32526929-32526951 GGAGGATGGGATGCAGCCTCAGG - Intronic
1022741353 7:33124545-33124567 GGAGAATGGCGTGAACCCTGGGG - Intergenic
1022946977 7:35295916-35295938 GGAGAATGGCGTGAACCCTGCGG - Intergenic
1023098235 7:36685376-36685398 GGAGGATGGGATGGAGCATGTGG + Intronic
1023373975 7:39538023-39538045 GGAGAATGGCGTGAACCCTGGGG + Intergenic
1023938153 7:44754351-44754373 GGAGCAAGGGGAGGAGCCTATGG + Intronic
1023990557 7:45125991-45126013 GGAGAATGGGGGCTATCCTCAGG - Intergenic
1024035293 7:45503032-45503054 GCACATTGGGGTGGAGGCTCAGG - Intergenic
1024373129 7:48608714-48608736 GGAGAGTGGGGAGCAGCCTATGG + Intronic
1024397877 7:48889900-48889922 GGAAGATGGGGTGGAGCCATGGG + Intergenic
1024490990 7:49985847-49985869 GGAAAATGGGGTGCAGCCACTGG + Intronic
1024914129 7:54479896-54479918 GGAGATGGGGGTGGAGCCAGAGG + Intergenic
1027196393 7:76033473-76033495 GGAGAGCAGAGTGGAGCCTCTGG + Intronic
1028107961 7:86902681-86902703 GAAGAATGGGGTGGGGCCTTGGG + Intronic
1028455133 7:91030441-91030463 GGAGAGCAGGATGGAGCCTCTGG - Intronic
1028542364 7:91956307-91956329 GGAGAATGGCGTGGACCCGGGGG + Intronic
1029595149 7:101533731-101533753 GGAGCGTGGGATGGAGCCCCAGG - Intronic
1030818288 7:114063904-114063926 GGAGAATGGCGTGAACCCACGGG + Intronic
1031172056 7:118304322-118304344 GGAGAATGGGGTGGAGCTAAGGG - Intergenic
1031456060 7:121981049-121981071 GGAGAATGGCGTGAACCCTGGGG + Intronic
1031534202 7:122913806-122913828 GGAAGACGGGGTGGAGCTTCGGG - Intergenic
1031586324 7:123535060-123535082 GGAGAAAGGGGAGGAGCCAGAGG + Intronic
1032155696 7:129465837-129465859 GGAAAATGGGGTAGAGCCTCTGG - Intronic
1032250888 7:130256340-130256362 GGAGAATGGGGTAGAGCCATGGG + Intergenic
1032251605 7:130262346-130262368 GGAGGATGGGGTGGTGCCATGGG + Intergenic
1032329255 7:130962484-130962506 GGAGGAGGGGATGGAGCCTCAGG - Intergenic
1032579729 7:133093110-133093132 AGAGAATAGGTTGGAGCCTGAGG + Intergenic
1032580085 7:133096290-133096312 GGAGGATGGGGTGAGGCCTCAGG - Intergenic
1033051761 7:138010888-138010910 GGAGAATGGTGTGAACCCTGGGG + Intronic
1033387563 7:140893338-140893360 GGAGAATGGTGTGAACCCTGGGG - Intronic
1033464365 7:141577685-141577707 GCACACTGGGGTGAAGCCTCAGG - Intronic
1034430241 7:151037672-151037694 GTAGAATGGGGTGGGGGCCCCGG - Intronic
1035454585 7:158999685-158999707 GGAAGATGGGGCGGAGCCCCAGG - Intergenic
1036084577 8:5599632-5599654 GCACACTGGGTTGGAGCCTCAGG - Intergenic
1036155591 8:6339214-6339236 GGAGAATGGGGTGGAGCCACTGG + Intergenic
1036378283 8:8219121-8219143 GGAGGGTTGGGTGGAGGCTCAGG - Intergenic
1036977243 8:13427371-13427393 GGAGAAATGGGTGGAGACTAGGG - Intronic
1037412491 8:18613302-18613324 GGAGGAGGGGGTGGGGCCTTGGG + Intronic
1037875920 8:22548334-22548356 GGAGAAAGGGATGGAGCCCAGGG + Intronic
1038345179 8:26725871-26725893 GGGGAATGGGGAGGAGACTCAGG + Intergenic
1038370268 8:26981936-26981958 GGAGGATGGGGCAGGGCCTCAGG + Intergenic
1038433027 8:27515042-27515064 GTGCACTGGGGTGGAGCCTCAGG + Intronic
1039125518 8:34197182-34197204 GGAGAATGGGGTGAAACCAGGGG - Intergenic
1039308668 8:36292520-36292542 AGAGGGTGGGGTGGAGCCTCAGG + Intergenic
1039469024 8:37802318-37802340 AGAGAAGGGGGTGGAGGCGCCGG - Intronic
1039757600 8:40540171-40540193 GTGCACTGGGGTGGAGCCTCAGG + Intronic
1039802417 8:40970832-40970854 GGAGGACGGGGTGGAGCCTCAGG - Intergenic
1039856795 8:41422014-41422036 GGAGAATGGCGTGAAGCCCAGGG + Intergenic
1040354883 8:46608006-46608028 GGAGAATGGCGTGAACCCTGGGG + Intergenic
1040664403 8:49615512-49615534 GAGCACTGGGGTGGAGCCTCGGG - Intergenic
1040949691 8:52925034-52925056 GTGCACTGGGGTGGAGCCTCAGG + Intergenic
1041362288 8:57066517-57066539 GGTGAATGGGGTGGATGCACAGG + Intergenic
1041911868 8:63097552-63097574 GGAGAATGGGGTGGAGCACCAGG + Intergenic
1043740684 8:83807870-83807892 GGAGGATGGAGTAGAGCCTCAGG - Intergenic
1045792926 8:106007071-106007093 GGAGAATGGCGTGAAGCCCGAGG - Intergenic
1046132910 8:109990385-109990407 GGAGGATGGGGTGGAGCCTCAGG - Intergenic
1046412122 8:113859251-113859273 GGAGAGTAGGGTGGAGCCACAGG + Intergenic
1046885995 8:119367831-119367853 GGAGAAGCAGGTGGAGCCACGGG + Intergenic
1047588634 8:126302652-126302674 GCACAGTGGGGTGGAGCCTCGGG + Intergenic
1048051014 8:130816514-130816536 GGAGAATGGGGTGAACCCGAGGG - Intronic
1049333886 8:142071735-142071757 AGAGAATGTGGTGTCGCCTCCGG - Intergenic
1049532389 8:143160793-143160815 GGAGAACGGCCTGGAGCCACTGG - Intergenic
1049586065 8:143432869-143432891 GGAGAAGGTGGTGGAGGCTGGGG + Intergenic
1049774178 8:144397069-144397091 GGGAGATGGGGTGGAGCCACGGG + Intronic
1049774196 8:144397109-144397131 GGGAGATGGGGTGGAGCCACGGG + Intronic
1050986327 9:12087801-12087823 GGAGAATGGCGTGAACCCGCAGG + Intergenic
1051251354 9:15161943-15161965 ATACACTGGGGTGGAGCCTCGGG + Intergenic
1051547613 9:18293893-18293915 GGAGAATGGGGTGGAGGAGGAGG + Intergenic
1052059262 9:23941198-23941220 GGAGAATGGGGTGGAGCCACAGG - Intergenic
1052316328 9:27119602-27119624 GGAGAGTCGGGTGGAGAGTCGGG + Intronic
1052359856 9:27541839-27541861 GGAAAATGGGATGAGGCCTCTGG + Intergenic
1052375698 9:27715707-27715729 GGAGAATGTGGTGTACCCACAGG - Intergenic
1052795339 9:32918791-32918813 GGAGGACGGGGTGGGGCCTCAGG + Intergenic
1053006099 9:34605653-34605675 GGAAGATGGGGTGGAGACACAGG + Intergenic
1053053661 9:34980935-34980957 GGAGGATGTGGTGGAGCTGCAGG + Exonic
1053100811 9:35370933-35370955 GGAGGATGGGATGGAGGCCCTGG - Intronic
1053708145 9:40776705-40776727 GCACAATGAGGTGGTGCCTCGGG - Intergenic
1054418055 9:64897491-64897513 GCACAATGAGGTGGTGCCTCGGG - Intergenic
1054438143 9:65232433-65232455 GGAGAATGGCGTGAACCCTGGGG + Intergenic
1055325441 9:75123329-75123351 GGAGAATGGCGTGAACCCTTGGG + Intronic
1055536681 9:77254032-77254054 GGAGAATGGTGTGAACCCTGGGG - Intronic
1055877549 9:80961658-80961680 GCACACTGGGGTGGAGCTTCAGG + Intergenic
1056520364 9:87395543-87395565 GTACACTGGGGTGGAGCCTCAGG + Intergenic
1056914455 9:90733414-90733436 GGAGAATGGGGTGCAGCTGTGGG - Intergenic
1056985708 9:91362054-91362076 GGAGAATGGGGCAAGGCCTCGGG - Intergenic
1057342394 9:94214391-94214413 GGAGGACTGGGTGGGGCCTCGGG + Intergenic
1057501690 9:95601476-95601498 GGAGAATGGCGTGAACCCCCGGG + Intergenic
1057558813 9:96111285-96111307 GAAGAATGTGGAGGAGCCTGTGG + Intronic
1058281925 9:103127035-103127057 GGAGGATGGGGTGGAGCCTAGGG - Intergenic
1058327780 9:103719591-103719613 GAAGAATGGGATGCAGCATCTGG + Intergenic
1058379322 9:104361389-104361411 GGAGAACAGGGTGGAGCCACAGG + Intergenic
1059036706 9:110761664-110761686 GGAGAATGGCGTGAACCCCCGGG - Intronic
1059343764 9:113614807-113614829 GGAGATTGGGCTGGAGCCACTGG + Intergenic
1059811081 9:117856366-117856388 GGAGAATGGGGTGGAGGCTCGGG - Intergenic
1060282015 9:122221287-122221309 GGAGCTGGGGGAGGAGCCTCGGG - Intronic
1060596641 9:124852786-124852808 TGAGGATGGGGTGGAGGCTGGGG - Intergenic
1061196037 9:129107834-129107856 GCAGAAGGGGCTGGAGCGTCGGG - Exonic
1061217868 9:129232052-129232074 GGATAGTGGGGAGGAGCCCCAGG + Intergenic
1061802540 9:133120404-133120426 GGGGGATGGGGTGGAGCAGCAGG - Intronic
1061905052 9:133692492-133692514 GAAGGATGGGGAGGAGCCACTGG - Intronic
1061954672 9:133955511-133955533 GGGGAATGGGGAGGAGCTTGGGG - Intronic
1062276234 9:135732835-135732857 GGAGAAGGGCATGGAGCCCCAGG - Intronic
1062505626 9:136874061-136874083 GGAGAATGGTGTGAACCCTGGGG + Intronic
1062666611 9:137676705-137676727 GGGGAAGTGGGTGGAGCCACAGG + Intronic
1062737307 9:138144478-138144500 GGACAGCAGGGTGGAGCCTCAGG + Intergenic
1062737318 9:138144512-138144534 GGACAGCAGGGTGGAGCCTCAGG + Intergenic
1186522849 X:10221122-10221144 GTAAAAAGGGGTGGAGCCACAGG + Intronic
1187300250 X:18041911-18041933 GGAGAATGGGCTCCAGCCTATGG - Intergenic
1187860875 X:23681139-23681161 GGAGAATGGCGTGAACCCTGGGG + Intronic
1188220588 X:27536777-27536799 GGAGAACGGGGTGGAGCCATGGG - Intergenic
1188756464 X:33969245-33969267 GGAGCATGGGGGGGAGCCTAAGG + Intergenic
1188799860 X:34515925-34515947 GGAGAATGGCGTGAACCCGCAGG + Intergenic
1188803447 X:34559502-34559524 GGGGAAGTGGGTGGAGCCACAGG - Intergenic
1189415579 X:40809862-40809884 GGAGAACAGGGTGGAGCCAGGGG + Intergenic
1189616411 X:42788963-42788985 GGAGGACAGGGTGGAGCCTCGGG - Intergenic
1189617087 X:42794831-42794853 GGAAGACAGGGTGGAGCCTCGGG - Intergenic
1189649770 X:43176906-43176928 GAAGCATGGGGTGGAGCCACTGG + Intergenic
1190417788 X:50198416-50198438 GGAGGCTGGGGAGGAGCCTGAGG - Intronic
1190491217 X:50984029-50984051 GCACACTGGGGTGGAGCCTTGGG + Intergenic
1190495849 X:51027982-51028004 GGAGTCTGGGGAGAAGCCTCAGG - Intergenic
1190576805 X:51847685-51847707 GGAGAATGGGGTGGAGCCATGGG - Intronic
1190724632 X:53180817-53180839 GGAGAATGGGGTGAACCCCCGGG - Intergenic
1191638139 X:63400520-63400542 GGAGAATGGGGTGGAGCTATGGG + Intergenic
1191645081 X:63471252-63471274 GCACACTGGGTTGGAGCCTCAGG - Intergenic
1192308711 X:69990607-69990629 TGTGAATGGGGTGGGGCCACAGG + Intronic
1192941674 X:75919755-75919777 GGGGATTGGCGTGGAGCCACGGG + Intergenic
1193140508 X:78021948-78021970 GGAGGATGGGGTGGGGCCCCTGG + Intronic
1193698444 X:84737503-84737525 GGGGAAGGGGATGGAGCCACAGG + Intergenic
1194088902 X:89562305-89562327 GGAGAACAGGGTGGAGCCATGGG - Intergenic
1194162504 X:90471715-90471737 GGAGAATGGTGTGAACCCTGGGG - Intergenic
1194662537 X:96642884-96642906 GGAGGATGGGGTGGGGCCTCGGG - Intergenic
1196070764 X:111518983-111519005 GGAGAATGGCCAGGAGGCTCAGG - Intergenic
1196652128 X:118178618-118178640 GGAGCATAGGGTGGCGCCTCGGG + Intergenic
1197038794 X:121909027-121909049 GGAGGACGGGGTGGAGCCTTGGG + Intergenic
1197299426 X:124760064-124760086 GGAGGAAGGGGTGGAGCCTCAGG + Intronic
1197300814 X:124778215-124778237 GGAGGACGAGGTGGAGCCCCGGG + Intronic
1197509804 X:127356516-127356538 GAAGGATGGGGTGGAGACACCGG + Intergenic
1197858621 X:130946429-130946451 GGAGAGATGGGTGCAGCCTCTGG - Intergenic
1197902446 X:131388905-131388927 GGAGAATGGCGTGAACCCTGGGG - Intronic
1197911961 X:131492617-131492639 GGATAAAGGGGTGAAGCTTCTGG - Intergenic
1197971340 X:132118536-132118558 GGAGAACAGGGTGGAGCCATGGG - Intronic
1198074951 X:133185274-133185296 GCACACTGGGGTGGGGCCTCAGG + Intergenic
1198254876 X:134915650-134915672 TGAGGATGGGGTGGAGCCTGAGG - Intergenic
1198939181 X:141934414-141934436 GGAGGACAGGGTGGAGCCTCAGG + Intergenic
1199381247 X:147174801-147174823 GGAGGATGGGGTGGAGCCTTGGG - Intergenic
1199829846 X:151538605-151538627 GGGGAAGTGGGTGGAGCCACAGG - Intergenic
1199830373 X:151543871-151543893 GGGGAAGTGGGTGGAGCCACAGG - Intergenic
1200110342 X:153737661-153737683 GGAGACTGGGGTGGAGGGACAGG + Intronic
1200441578 Y:3218359-3218381 GGAGAACAGGGTGGAGCCATGGG - Intergenic
1201180287 Y:11336017-11336039 GGATTACAGGGTGGAGCCTCGGG - Intergenic
1201723343 Y:17128482-17128504 GAGGACTGAGGTGGAGCCTCAGG + Intergenic