ID: 1014674718

View in Genome Browser
Species Human (GRCh38)
Location 6:124349317-124349339
Sequence GGGAGAATGGGGTGGAGCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 970
Summary {0: 1, 1: 22, 2: 43, 3: 127, 4: 777}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014674718_1014674724 -9 Left 1014674718 6:124349317-124349339 CCGAGGCTCCACCCCATTCTCCC 0: 1
1: 22
2: 43
3: 127
4: 777
Right 1014674724 6:124349331-124349353 CATTCTCCCAGTGCACAGGCCGG 0: 11
1: 19
2: 40
3: 124
4: 344
1014674718_1014674726 -4 Left 1014674718 6:124349317-124349339 CCGAGGCTCCACCCCATTCTCCC 0: 1
1: 22
2: 43
3: 127
4: 777
Right 1014674726 6:124349336-124349358 TCCCAGTGCACAGGCCGGTTGGG 0: 1
1: 1
2: 4
3: 19
4: 99
1014674718_1014674729 7 Left 1014674718 6:124349317-124349339 CCGAGGCTCCACCCCATTCTCCC 0: 1
1: 22
2: 43
3: 127
4: 777
Right 1014674729 6:124349347-124349369 AGGCCGGTTGGGTATTCTCCAGG 0: 1
1: 0
2: 3
3: 23
4: 151
1014674718_1014674732 24 Left 1014674718 6:124349317-124349339 CCGAGGCTCCACCCCATTCTCCC 0: 1
1: 22
2: 43
3: 127
4: 777
Right 1014674732 6:124349364-124349386 TCCAGGGACCCCTTTTTACTTGG 0: 4
1: 14
2: 26
3: 70
4: 199
1014674718_1014674730 8 Left 1014674718 6:124349317-124349339 CCGAGGCTCCACCCCATTCTCCC 0: 1
1: 22
2: 43
3: 127
4: 777
Right 1014674730 6:124349348-124349370 GGCCGGTTGGGTATTCTCCAGGG No data
1014674718_1014674725 -5 Left 1014674718 6:124349317-124349339 CCGAGGCTCCACCCCATTCTCCC 0: 1
1: 22
2: 43
3: 127
4: 777
Right 1014674725 6:124349335-124349357 CTCCCAGTGCACAGGCCGGTTGG 0: 4
1: 25
2: 73
3: 121
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014674718 Original CRISPR GGGAGAATGGGGTGGAGCCT CGG (reversed) Intronic
900158322 1:1212309-1212331 GGGAGAAGGGTGTGTGGCCTTGG - Intronic
900411085 1:2513007-2513029 GGGAGAATGGCGTGGCGCTGAGG - Exonic
901206219 1:7497334-7497356 TGGAGGATGGGATGGGGCCTGGG - Intronic
901215214 1:7551140-7551162 TGGAGACTGGGGTGGAGACCAGG - Intronic
901624728 1:10617509-10617531 GGGAGAACGGAGAGGAGCCAAGG - Intronic
901836409 1:11926505-11926527 GAGAGAAGGGGGCGGAGCCACGG + Intergenic
901857310 1:12052718-12052740 GGGTGGAGGGGGTGGAGGCTGGG - Intergenic
901885215 1:12217972-12217994 GGGAGAGTGGTGTGAAGCCATGG + Intergenic
902030614 1:13419511-13419533 AGGAGAATGGCGTGAACCCTGGG - Intronic
902331011 1:15731269-15731291 GGGAGAAGCGGGTGTATCCTGGG + Intronic
902603518 1:17556045-17556067 GGGAGCACGGGGTTGAGCCTGGG + Intronic
902876989 1:19346555-19346577 AGGAGAACAGGGTGGAGTCTGGG + Intronic
902902602 1:19529876-19529898 AGGAGACTGGGGAGGAGCGTGGG - Intergenic
903025846 1:20429463-20429485 GGGAGAATAGGATGGATCCCAGG - Intergenic
903096698 1:20983151-20983173 GGCTGAATGGGGATGAGCCTTGG - Intronic
903845874 1:26279824-26279846 GTGAGACTGGGGAGGGGCCTGGG - Exonic
903878234 1:26490857-26490879 TGGAGACTGGGGTGGAGGTTGGG + Intergenic
904831298 1:33307895-33307917 GTGAGAAGGGGGTGAAGGCTGGG - Intronic
905556646 1:38890790-38890812 GGGAGAATTCGCTTGAGCCTGGG - Intronic
905858284 1:41329608-41329630 GGGGGAAGGGAGGGGAGCCTGGG - Intergenic
905935620 1:41821786-41821808 GAGAGAATGGGGCTGGGCCTTGG + Intronic
906410268 1:45573363-45573385 GGGAGAATGGGGTGGAGCCATGG - Intergenic
906614708 1:47226095-47226117 GGGAGAAGGGAGGGGTGCCTGGG + Intronic
906874848 1:49525998-49526020 AGGAGAATGGCGTGAACCCTGGG + Intronic
907145815 1:52230318-52230340 GGGAGGACGGGGTGGGGCCTTGG - Intronic
907237321 1:53061633-53061655 TGGAGGGTGGGGTGGAGCGTGGG + Intergenic
908446451 1:64202410-64202432 GGGAGGTTGTGGAGGAGCCTGGG - Intergenic
908751636 1:67429955-67429977 GGCAGAATGTGGGGGAGACTGGG - Intronic
909050511 1:70762133-70762155 AGGAGAATGGCGTGAACCCTAGG + Intergenic
909635533 1:77813071-77813093 GGGAGAATCGGCTTGAACCTGGG - Intronic
909982289 1:82116992-82117014 GAGTGAAAAGGGTGGAGCCTTGG + Intergenic
910153247 1:84180419-84180441 GGGAGAATGGGAGGGAGGCAAGG + Intronic
910399678 1:86826190-86826212 GGGAGGATTGCTTGGAGCCTAGG - Intergenic
910626436 1:89313026-89313048 GGGAGGATGGGGTAGAGCCTTGG - Intergenic
911154965 1:94628165-94628187 GGGAGAGTGTGCTGGAGACTAGG + Intergenic
911265096 1:95733906-95733928 GGGAGAACTGGGTGGAGCCCTGG - Intergenic
912513137 1:110201795-110201817 GGGGGAGTGGGGTGGGGCGTGGG - Exonic
914676798 1:149912320-149912342 GGGAGAATAGAGAGGACCCTGGG - Intronic
914744998 1:150495085-150495107 AGGAGAATGGCGTGAACCCTGGG + Intronic
915146402 1:153798197-153798219 GGGTGAATGGCTTGGGGCCTTGG - Intergenic
915600442 1:156920250-156920272 GGGGGATCGGGGCGGAGCCTGGG - Intergenic
916002092 1:160626839-160626861 GAGAGTATGGAGTGGAGCCTGGG - Intronic
916519120 1:165547466-165547488 GGTAGACTGGGGTGAAACCTGGG - Intronic
916827089 1:168452889-168452911 GGAAGAAGGGGCTGGAGTCTTGG - Intergenic
917098291 1:171421845-171421867 GGGAGGACTGGGTGGAGCCTTGG - Intergenic
918122746 1:181554109-181554131 GGGAGGCTGGGGTGGATCCCTGG - Intronic
918161238 1:181902062-181902084 GGGAGGATGGGGTGAGGCCTTGG + Intergenic
918175551 1:182041147-182041169 GGGGGAAAGGGGTGGAGCCAGGG - Intergenic
918682352 1:187371106-187371128 AGGAGAATGGCGTGAACCCTGGG + Intergenic
919974690 1:202602949-202602971 GGGGGAATGGGGAGAGGCCTGGG - Intronic
920398908 1:205665006-205665028 GGCAGAAGGGGGTGGCACCTCGG - Intronic
920840342 1:209548587-209548609 GAGAGAATCTGGTGAAGCCTAGG + Intergenic
921315678 1:213888180-213888202 GGGAGCAGGGGGTGGAGCAATGG - Intergenic
921836842 1:219787202-219787224 GGGAGAATGGGGCTGGGGCTTGG - Intronic
921901742 1:220458177-220458199 GGGAGAATGGGGTGGAGCCAGGG + Intergenic
922063484 1:222113915-222113937 AGGAGAATGACGTGGAACCTGGG - Intergenic
923412654 1:233725439-233725461 GGAGGGATGGGGTGGAGTCTCGG - Intergenic
923413357 1:233731435-233731457 GGGTGGATGGGGTGGAGCCTTGG - Intergenic
923414214 1:233739031-233739053 GGGAGGATGGGGTGGAGCCTAGG + Intergenic
923484835 1:234419078-234419100 AGGAGAATGGCGTGAACCCTGGG + Intronic
923570961 1:235114527-235114549 AGGAGAATGGCGTGAACCCTGGG - Intronic
1062777750 10:168401-168423 AGGAGAATGGAGTCCAGCCTGGG + Intronic
1062799964 10:371646-371668 GGGAGGCTGGGGTGAGGCCTGGG + Intronic
1062799976 10:371689-371711 GGGAGGCTGGGGTGAGGCCTGGG + Intronic
1063079856 10:2756024-2756046 GGGAGACTGAGGAGGAGGCTTGG - Intergenic
1063306974 10:4911324-4911346 GGGAGAGTGGAGTGGAGCCATGG + Intergenic
1063307472 10:4918392-4918414 GGGAGACTGGAGTGGAGCCATGG - Intergenic
1063468222 10:6262360-6262382 AGGAGAATGGCGTGAACCCTGGG + Intergenic
1064772468 10:18737768-18737790 GGCAGAAAGGGTTGGAGCCTTGG + Intergenic
1065032565 10:21602819-21602841 AGGAGAATGGTGTGAACCCTGGG - Intronic
1065534508 10:26703987-26704009 AGGAGAATGGCGTGAACCCTGGG + Intronic
1066086338 10:31975323-31975345 GGGAAACGTGGGTGGAGCCTGGG + Intergenic
1066721541 10:38345054-38345076 AGGAGAATGGCGTGAACCCTGGG + Intergenic
1066749329 10:38636408-38636430 GGGATTACGGGGTGGAGCCTCGG - Intergenic
1066967322 10:42281384-42281406 GGGATTACGGGGTGGAGCCTCGG + Intergenic
1067027721 10:42858820-42858842 GGGCAAATGTGGTGGAGTCTGGG + Intergenic
1067044562 10:42976978-42977000 GGGAGAGGGAGGTGGAACCTGGG - Intergenic
1067121394 10:43475019-43475041 GGGAGAATGAGGTGGAGGCAGGG - Intronic
1067223019 10:44357423-44357445 GGCAGGTTGGGGTGGAACCTAGG - Intergenic
1067282380 10:44882109-44882131 GGGACAAGGGCATGGAGCCTGGG - Intergenic
1067695488 10:48532323-48532345 GGGAGAAGGGGGTGGGGGCAGGG - Intronic
1068161365 10:53269304-53269326 GGGAGAAAGGAGAGGAGCATAGG + Intergenic
1068565356 10:58568736-58568758 GGGAGAAGGGAGTGGAGCACAGG - Intronic
1068878398 10:62022409-62022431 GGGAGGATGGGGTGGAGCCTTGG + Intronic
1070290752 10:75111786-75111808 GGGAGTCTGGGATGGAGCCGGGG + Intronic
1070406298 10:76100453-76100475 GGGAGAAAGGGCTGAAGCCACGG - Intronic
1071137764 10:82471305-82471327 GGGAGAATGGGGTGGAGCCGTGG - Intronic
1071326061 10:84519429-84519451 GGGAGAACTGGGTGGAGCCACGG - Intergenic
1071513633 10:86282811-86282833 TGGAGAATGGGTTGGAGGCAGGG - Intronic
1072478089 10:95782861-95782883 GGGATAATGGGATGGAGGCATGG + Intronic
1072520221 10:96224350-96224372 GCCAGGCTGGGGTGGAGCCTAGG - Intronic
1073071819 10:100799044-100799066 GGAAGACTGGGGGGCAGCCTGGG + Intronic
1073105949 10:101032168-101032190 GGGAGGAGGGGCTGGAGCCGCGG - Intronic
1073237812 10:102033508-102033530 GGGGGAATGGCGTGAACCCTGGG - Intronic
1073352264 10:102828312-102828334 GGGAGAAGGAGGTGGAACCCAGG + Intergenic
1073429886 10:103479185-103479207 GGGAGCCTGGGCTGGGGCCTGGG - Exonic
1074062145 10:109976391-109976413 TAGAGATTGGGGTGGGGCCTAGG - Intergenic
1074183512 10:111082617-111082639 GGGAGAGAGGGCTGGAGCCCAGG + Intergenic
1075145190 10:119876646-119876668 GGGAGAATTGGGGGAACCCTGGG + Intronic
1075209768 10:120481138-120481160 TGGAGCATGGGGTGGAGTCTGGG + Intronic
1075257820 10:120939405-120939427 GCCAGAGTGGGCTGGAGCCTGGG - Intergenic
1076434344 10:130429898-130429920 GGGAGCATGAGCTGGAGGCTGGG + Intergenic
1076439947 10:130474688-130474710 AGGAGAATGTGATGAAGCCTTGG + Intergenic
1076579021 10:131494520-131494542 GGGAGATTGGGATGGAGCAGGGG + Intergenic
1077438241 11:2555285-2555307 GGGAAAAGGGGGTGGAGCGGGGG - Intronic
1077867529 11:6235066-6235088 GCGAGAAAGGGGTGGGGCCATGG + Intronic
1078188525 11:9072925-9072947 GGGAGAGTGGGGCTGAGCCAGGG + Intronic
1078535821 11:12172815-12172837 GGGAGGATGGGGCGGGGCCTCGG - Intronic
1078536132 11:12175899-12175921 GAGAGAGTGGGGTTGGGCCTTGG + Intronic
1079085882 11:17444536-17444558 GGGAGCATGAGGAGGAGCCAGGG - Intronic
1079749139 11:24173745-24173767 GGGAGGACGAGGTGGAGACTTGG - Intergenic
1079820075 11:25115440-25115462 AGGAGAATGGCGTGAACCCTGGG + Intergenic
1079869974 11:25784998-25785020 GGCAGAAAAGGGTGGATCCTTGG + Intergenic
1079954906 11:26850398-26850420 GGGAGCATGGGGTGGAGAGGAGG - Intergenic
1080077987 11:28174721-28174743 GGGAGAATGGTATGAAGCCGGGG + Intronic
1080217112 11:29856654-29856676 TGAACACTGGGGTGGAGCCTTGG - Intergenic
1080851192 11:36071828-36071850 GTGGGTCTGGGGTGGAGCCTGGG - Intronic
1081170633 11:39866556-39866578 AGGAGAATGGCGTGAACCCTGGG - Intergenic
1081214780 11:40382783-40382805 AGGAGAATGGCGTGAACCCTGGG - Intronic
1081435839 11:43026666-43026688 GGGAGGACTGGGTGGAGCCTTGG - Intergenic
1081648058 11:44803644-44803666 GGGACACTGGGGTGGAGACGAGG + Intronic
1081772544 11:45658858-45658880 GGGAGGATGGGCCGGAGCCCCGG - Intronic
1081865151 11:46355666-46355688 TGGAGAGTGGGGTGGGGCCCTGG + Intronic
1082810332 11:57475855-57475877 GGAGGTTTGGGGTGGAGCCTGGG - Intronic
1082859866 11:57845410-57845432 GAGAGAATGGCTTTGAGCCTAGG + Intergenic
1082918089 11:58461238-58461260 AGGAGAATGGCGTGAACCCTGGG - Intergenic
1083307161 11:61767149-61767171 GGGAGAAGGGAGTGGAGGCCAGG + Intronic
1083467800 11:62860411-62860433 AGGAGAATGGTGTGAAACCTGGG + Intronic
1083480008 11:62937991-62938013 TAGAGAATGGGGTGGGGCCAGGG - Intronic
1083581373 11:63827445-63827467 GGGAGAATGGTGGGGAGCAGGGG - Exonic
1083611912 11:64008376-64008398 GGGAGTCTGCGGTGGGGCCTGGG + Intronic
1083676777 11:64330375-64330397 GGGAGCAGGGGGTGGAGGGTGGG + Intergenic
1084400740 11:68941512-68941534 GGAAGAATGGGGTGGAGGTCAGG - Intergenic
1084956112 11:72692578-72692600 GGGATAAAGGGGAGGAGCTTAGG + Intronic
1084965277 11:72741333-72741355 GGGAGAGTGGGGAGGGTCCTGGG - Intronic
1085083495 11:73651906-73651928 GAGAGGATGGGGTGGAATCTCGG + Intronic
1085566580 11:77520016-77520038 GGGGGAATGGGGTGGAGCCACGG - Intronic
1085639475 11:78183725-78183747 AGGAGAATGGCGTGAACCCTGGG - Intronic
1085968730 11:81561092-81561114 GGCAGCATGGTGAGGAGCCTTGG + Intergenic
1086008539 11:82069516-82069538 GGCTGAATGGGGAGGAGGCTAGG - Intergenic
1086479798 11:87222404-87222426 AGGAGAATGGCGTGAACCCTGGG + Intronic
1086853168 11:91835550-91835572 CTGAGAATGGGGTAGAGACTGGG - Intergenic
1087258261 11:95980986-95981008 GGGAAGACAGGGTGGAGCCTTGG + Intronic
1087462820 11:98466820-98466842 GGGAGAACTGGGTGGAGCCATGG + Intergenic
1087840103 11:102911744-102911766 GGGAGAACGGGGTGGAGCCACGG + Intergenic
1088010472 11:104995000-104995022 TGCACACTGGGGTGGAGCCTTGG + Intronic
1088613085 11:111597887-111597909 GGGAGAATGGTGTGAACCCAGGG - Intergenic
1089648607 11:119896806-119896828 GGGTGAATGGGGAGGAGTTTTGG + Intergenic
1090049792 11:123367953-123367975 GGGAGAAAGAGGAGGAGCCAGGG + Intergenic
1090634489 11:128682288-128682310 GGGAGAATGGGGTGGGGAGGGGG - Intergenic
1090706126 11:129338672-129338694 GGGAGAACAGGGAGGAGCCGTGG + Intergenic
1090844187 11:130517372-130517394 GGAAGGATGGGATGGGGCCTTGG + Intergenic
1091120143 11:133050545-133050567 GGAATAATGAGGTGGAGCCCAGG + Intronic
1091251326 11:134146657-134146679 GGGAGAATGGCTTGAAGGCTGGG - Intronic
1091837846 12:3598259-3598281 AGGGGAATGGGGTGGGGACTAGG + Intergenic
1091876365 12:3936814-3936836 AGGAGAATGGCGTGAACCCTGGG + Intergenic
1092052241 12:5480209-5480231 GGGTGGAGGGGGTGGCGCCTGGG + Intronic
1092061933 12:5558107-5558129 GGGAGGAGGGGGTAGAGACTCGG - Intronic
1092563044 12:9636841-9636863 GGGAGGATGGGGTGGAGCCGTGG - Intergenic
1093845680 12:23968537-23968559 GGAAGAATGGGGTGGGGAGTAGG - Intergenic
1094381243 12:29845645-29845667 AGGAGAATGGCATGGAACCTGGG - Intergenic
1094623155 12:32099456-32099478 GGGGTAATGGGGTGGAGGATGGG + Intergenic
1094819380 12:34212569-34212591 GTAAGAAGGTGGTGGAGCCTGGG + Intergenic
1095593504 12:43933290-43933312 AGGAGAATGGCGTGAACCCTGGG - Intronic
1095765298 12:45887765-45887787 GGAAGGACGGGGTGGAGCCTCGG - Intronic
1096217263 12:49804839-49804861 GGGAGAATACAGTTGAGCCTGGG + Intronic
1096264143 12:50110484-50110506 GGAAGAAAGGGGTGGAGTCAGGG - Exonic
1096356297 12:50943616-50943638 AGGAGAATGGTGTGAACCCTGGG + Intergenic
1096509937 12:52122107-52122129 GGGAGAGAGGGGTGGGGTCTTGG - Intergenic
1096609201 12:52789948-52789970 GGGAGCATGGGGTGGCGCTGGGG + Exonic
1096675476 12:53223468-53223490 AGGAGAGGGGGGTGCAGCCTGGG + Intronic
1097061679 12:56289533-56289555 AGGAGAATGGTGTTGAACCTTGG - Intronic
1097126545 12:56780755-56780777 AGGAGAATGGGGTGAACCCGGGG + Intronic
1097141897 12:56908969-56908991 GCAAGATTGGGGTTGAGCCTGGG + Intergenic
1097450729 12:59734116-59734138 GGCAGAAAGGGGTGGATCCTTGG - Intronic
1097987063 12:65794767-65794789 AGGAGAATGGCGTGAACCCTGGG + Intergenic
1100040423 12:90311046-90311068 AGGAGAATGGGGTGAACCCGGGG - Intergenic
1100236747 12:92669251-92669273 AGGAGAATGGGGAGGAGGCATGG + Intergenic
1100272234 12:93037507-93037529 GGGAGGACGGGGTGGAGCCTCGG - Intergenic
1100361586 12:93884518-93884540 GGGAGGACGGGGTGGGGCCTCGG + Intronic
1100813666 12:98364745-98364767 GGGAGATTGGGTTGGACACTTGG - Intergenic
1101527466 12:105544707-105544729 GGGAGATTAGGATGGGGCCTGGG - Intergenic
1101580905 12:106040222-106040244 GGCAGAAAGGGGTGGGTCCTTGG - Intergenic
1102198344 12:111040362-111040384 GAGAGAATGGGGCAGATCCTGGG - Intronic
1103246862 12:119465219-119465241 GGGAGAATGGCGTGGAACCCGGG + Intronic
1103312775 12:120025140-120025162 GGGAGAATGGTGTGAACCCCAGG - Intronic
1103566055 12:121816245-121816267 GGGGGAATGGGGTGGAGGGGAGG - Intronic
1103891232 12:124240591-124240613 GGGGGAGTGGGGAGGAGCCCAGG - Intronic
1103964717 12:124631479-124631501 AGGAGAATGGCGTGAAGCCGGGG + Intergenic
1104930245 12:132335181-132335203 TGGAGAAACGGGTGGTGCCTCGG - Intergenic
1105494058 13:20914934-20914956 AGGAGAATGGTGTGAACCCTGGG - Intergenic
1106848455 13:33762753-33762775 AAGAGAATGGGCTGGAGGCTGGG - Intergenic
1107053167 13:36074395-36074417 AGGAGAATGGCGTGAACCCTGGG + Intronic
1107261205 13:38493824-38493846 AGGAGAATGGCGTGGAACCTGGG - Intergenic
1108492838 13:50998772-50998794 CGGTGAATGGGGTGAAGCCGTGG - Intergenic
1109382161 13:61577037-61577059 AGGAGAATGGCGTGAATCCTGGG + Intergenic
1109597220 13:64571587-64571609 GGGAGAATGGCGTGAACCCGGGG - Intergenic
1109638935 13:65161431-65161453 GGAAGAATGGAGTGGAGCCATGG - Intergenic
1109822065 13:67669840-67669862 AGGAGAATGGCGTGGACCCCCGG - Intergenic
1110612666 13:77506232-77506254 AGGAGAATGGCGTGAACCCTGGG + Intergenic
1111243714 13:85508237-85508259 GGCAGAAAGGGGTGGATCCCTGG + Intergenic
1111732471 13:92094426-92094448 GGGAAAATGGCGTTGAACCTGGG + Intronic
1112012791 13:95306100-95306122 GGGAGGATGGGCTTGAGCCCGGG - Intergenic
1112015351 13:95326874-95326896 GGGAGAATGGGGTGGAGTGGCGG + Intergenic
1112197496 13:97240146-97240168 GGGAGTCTGAGGTGGGGCCTAGG + Intronic
1112260705 13:97875440-97875462 GGGAGAGTGGGGTGGAGCCGGGG - Intergenic
1112286142 13:98106111-98106133 GGGACAATAGGGTGGAGCCATGG - Intergenic
1112758958 13:102671800-102671822 GGGAGAAGGGGGAGGAACCATGG + Intronic
1112941891 13:104873423-104873445 GGCTGAGTGGGGTGGAGCTTTGG - Intergenic
1112957061 13:105073227-105073249 AGGAGCATGGGGTGGAGCCACGG - Intergenic
1113338700 13:109401443-109401465 GGGAGAATGGGGTGGAGCCACGG + Intergenic
1113895093 13:113759246-113759268 GGGAGAGCCGGGTGGGGCCTCGG + Exonic
1113916718 13:113878288-113878310 AGGAGAATGGCGTGAAACCTGGG - Intergenic
1114198221 14:20498045-20498067 AGGAGAATGGGGTGAACCCAGGG + Intergenic
1114455008 14:22848553-22848575 GGGAGTTTGGGCTGGAGCCCAGG - Intronic
1114520642 14:23332684-23332706 AGGAGAATGGCGTGAACCCTGGG - Intergenic
1114855178 14:26430438-26430460 AGGAGAATGGCGTGAACCCTGGG - Intergenic
1115769560 14:36655873-36655895 TGGAGAATGATGCGGAGCCTTGG + Intergenic
1116599599 14:46902989-46903011 GCAAGAATGGGTTGGAGCCACGG + Intronic
1117070569 14:52052306-52052328 GTGGGAATGGGGTGGAGGATGGG - Intronic
1117289285 14:54316819-54316841 GGGAGAACAAGGTGGAGCCACGG + Intergenic
1117920836 14:60723919-60723941 GGGAAAAGGGGCTGGAGCCGGGG + Exonic
1118378019 14:65193568-65193590 GGGAGAACGGGGTGGAGCTGTGG - Intergenic
1118474558 14:66104690-66104712 GGGGGAATGGGGTGGAGCCACGG + Intergenic
1118549956 14:66939618-66939640 GGGAGGATGGGGTGGAGTTACGG - Intronic
1118550583 14:66945333-66945355 GGGAGGATGGGGTGGAGCTATGG - Intronic
1118929126 14:70223796-70223818 GGGAGGAAGCGGTGGGGCCTCGG - Intergenic
1119489061 14:75014357-75014379 TGGAGAATGGGGAGGGGGCTTGG - Exonic
1120195718 14:81480279-81480301 AGGAGAATGGCGTGAACCCTGGG - Intronic
1120296046 14:82642557-82642579 GGGAGAATGGGGTGGAGCCACGG + Intergenic
1120919145 14:89738895-89738917 AGGAGAATGGCGTGAACCCTGGG - Intergenic
1120969578 14:90196199-90196221 GGGAGGACGGGGTGGAGCCTGGG + Intergenic
1121461986 14:94087516-94087538 AGGAGAATGGCGTGAAGCCTGGG - Intronic
1121486217 14:94317412-94317434 GGGAGAATGGGGTGGAGCTGTGG + Intronic
1122027520 14:98888421-98888443 GGGAACCTGGGGTGGAGCCCAGG - Intergenic
1122062705 14:99147377-99147399 TGGAGAATGGCCTGGAGCTTGGG - Intergenic
1122117516 14:99535264-99535286 GGGAGACTGGGATGAAGCCAGGG + Intronic
1122436154 14:101701287-101701309 GGTAGAAAGGGGTGGAGGGTAGG + Intergenic
1122785929 14:104163243-104163265 GGGAGACTGGGCAGGGGCCTGGG - Intronic
1123002175 14:105301377-105301399 GGGGGAAGGGGGCGGAGCCTGGG + Exonic
1123121228 14:105918011-105918033 GGGAGAAAGGGCTGGAGGCAGGG + Intronic
1123418240 15:20108037-20108059 AGGAGAATGGGGAGGGTCCTGGG + Intergenic
1123468944 15:20535953-20535975 AGGAGAATGGCGTGAAGCCGGGG + Intronic
1123527458 15:21114559-21114581 AGGAGAATGGGGAGGGTCCTGGG + Intergenic
1123649112 15:22464737-22464759 AGGAGAATGGCGTGAAGCCGGGG - Intronic
1123729220 15:23130937-23130959 AGGAGAATGGCGTGAAGCCGGGG + Intronic
1123747388 15:23328423-23328445 AGGAGAATGGCGTGAAGCCGGGG + Intergenic
1123772433 15:23541640-23541662 TGGAGAATGGAGTGGAGCGTGGG + Intergenic
1123777659 15:23596844-23596866 GGGAGGGCGGGGTGGAGCCTCGG - Intronic
1123887315 15:24739536-24739558 GGGAGAATGGGGTGAACCCGGGG - Intergenic
1124279748 15:28352275-28352297 AGGAGAATGGCGTGAAGCCGGGG + Intergenic
1124302950 15:28559333-28559355 AGGAGAATGGCGTGAAGCCGGGG - Intergenic
1124435501 15:29645648-29645670 AGGAGAATGGCGTGAACCCTGGG - Intergenic
1125137237 15:36357883-36357905 GGGTGAATAGGGTGGAGACTAGG - Intergenic
1125194481 15:37030743-37030765 GGCAGTATGAGGTGGAGCCCAGG - Intronic
1125633062 15:41163650-41163672 AGGAGAATGGCGTGAACCCTGGG + Intergenic
1126106464 15:45150136-45150158 GGAACAATGGGGTGGCTCCTGGG + Intronic
1126910038 15:53408202-53408224 GGGTGAATGGGCTGAATCCTTGG - Intergenic
1126972646 15:54134609-54134631 AGGAGAATGGCGTGAACCCTGGG - Intronic
1127450299 15:59109892-59109914 AGGAGAATGGCGTGAACCCTGGG + Intronic
1127470461 15:59285447-59285469 AGGAGAATGGCGTGAAGCCGGGG - Intronic
1127583181 15:60356043-60356065 GGGAGATTGGGGTGGATGGTTGG - Intronic
1127668736 15:61174130-61174152 TGGAGAATGGGCTTGAGCCCTGG - Intronic
1128648416 15:69393592-69393614 GAGAGGCAGGGGTGGAGCCTGGG - Intronic
1128815797 15:70607168-70607190 GAGAGGCTGGGGTGGAGCCTTGG + Intergenic
1128914363 15:71546446-71546468 GGGAGCATGGGGAGCAGGCTGGG - Intronic
1128920184 15:71603395-71603417 GGGAGAACGGGGTGGAGCCACGG - Intronic
1129330780 15:74826219-74826241 GGGAGAATGGGGGGCACCCAAGG + Intergenic
1129666673 15:77583101-77583123 GGGAGGCTGGGGAGGAGCCCAGG - Intergenic
1129860242 15:78855090-78855112 GAGAGAAGGGGGTGAAGCCAAGG - Intronic
1129868886 15:78928611-78928633 GGGAGACTGAGTTGGAGTCTGGG + Intronic
1130635991 15:85620517-85620539 GGCAGATGGGGGTGGAGTCTGGG - Intronic
1130867180 15:87942996-87943018 GTGGGATTGGGGTGGAGTCTGGG - Intronic
1131007649 15:88991461-88991483 GGGAGAATGGGCTGGAGCCATGG - Intergenic
1131047457 15:89325409-89325431 GGAGGAAGGGGCTGGAGCCTAGG - Intronic
1131243572 15:90770264-90770286 GGGAGAATGGCGTGAACCCCGGG - Intronic
1131885073 15:96903733-96903755 GGGAGAATGGGGTGGAGCCGTGG + Intergenic
1132164575 15:99573194-99573216 AGGAGAATGGCGTGAACCCTGGG + Intronic
1132378630 15:101349597-101349619 GGGAGAGGGGAGAGGAGCCTGGG + Intronic
1132669886 16:1098206-1098228 GGGAGAGAGGGGTGGAGTCGGGG - Intergenic
1132755458 16:1482330-1482352 GGCAGAGTGGGGTGGAGCAAGGG + Intergenic
1132943930 16:2521874-2521896 AGGAGAATGGCGTGAACCCTGGG - Intronic
1133033175 16:3021210-3021232 GGGAGCAGGGGGCGGTGCCTGGG - Exonic
1133050059 16:3112576-3112598 GGGGGAGTTGGGTGGAGACTGGG - Exonic
1133724862 16:8527998-8528020 GGGAGAATAAAGTTGAGCCTGGG - Intergenic
1134125387 16:11612686-11612708 GGGAGAATGGGGTGGGGAAGTGG - Intronic
1134823305 16:17264219-17264241 GGGGGATTGGGGAGGAGCATGGG - Intronic
1135103661 16:19628270-19628292 GGGAGAATTGCTTGGAGCCCAGG + Intronic
1135169078 16:20167101-20167123 GGGAGATTGGGTTGGAGCTTTGG + Intergenic
1135380747 16:21994381-21994403 GGCAGAATGGGCTGGCGCCATGG - Intronic
1135589869 16:23697076-23697098 GGGAGGATTGGCTTGAGCCTGGG + Intronic
1136069571 16:27779642-27779664 GGGAGAAGGGGTGGGGGCCTGGG - Exonic
1136546711 16:30958569-30958591 GGGAGAATCCGGGGGAGCCCCGG + Intronic
1136707584 16:32202176-32202198 TTGAGACTGGTGTGGAGCCTGGG + Intergenic
1136733387 16:32440725-32440747 GGGATTACGGGGTGGAGCCTTGG + Intergenic
1136760326 16:32727234-32727256 TTGAGACTGGTGTGGAGCCTGGG - Intergenic
1136807778 16:33143152-33143174 TTGAGACTGGTGTGGAGCCTGGG + Intergenic
1137354302 16:47744680-47744702 AAGAGGTTGGGGTGGAGCCTCGG - Intergenic
1137624868 16:49901171-49901193 GGGAGCATGGGGTGGGGCTCAGG + Intergenic
1137751054 16:50861408-50861430 GGGAGAATGTGGTGGAGTGGAGG - Intergenic
1138522357 16:57578077-57578099 GATGGAATGGGGTGGAGTCTGGG + Intronic
1138562800 16:57812132-57812154 AGGAGAATGGCGTGAACCCTAGG - Intronic
1138943066 16:61813554-61813576 GGGGGAACAGGGTGGAGCCACGG + Intronic
1139427807 16:66894118-66894140 GGGAAAATGGGGTGAGGCATGGG - Intronic
1139475201 16:67199494-67199516 GGAGGGATGGGGAGGAGCCTGGG - Intronic
1141307397 16:82878636-82878658 GGTAGATTCGAGTGGAGCCTGGG + Intronic
1141523008 16:84593922-84593944 GGGGGAATGGGGTGGAGAATGGG - Intronic
1141524711 16:84604061-84604083 GGGAGTATGGGGTTGGGCCGTGG - Intronic
1141665383 16:85462937-85462959 GGGAGACGGGGATGGAGCCCCGG - Intergenic
1141878387 16:86841919-86841941 GGGAGAGTGGAGAGGAGACTTGG - Intergenic
1142029598 16:87831942-87831964 GGGAGAGCGGGGAGGTGCCTAGG + Exonic
1203019696 16_KI270728v1_random:388877-388899 GGGATTACGGGGTGGAGCCTTGG - Intergenic
1203038031 16_KI270728v1_random:662035-662057 GGGATTACGGGGTGGAGCCTTGG - Intergenic
1203062480 16_KI270728v1_random:987556-987578 TTGAGACTGGTGTGGAGCCTGGG - Intergenic
1142575354 17:903472-903494 GGGAGAATCTGCTTGAGCCTGGG - Intronic
1142592211 17:1011291-1011313 TGGAGGACGGGGTGGGGCCTGGG - Intronic
1142785455 17:2218453-2218475 AGGAGAATGGCGTGGACCCAGGG + Intronic
1142804638 17:2364996-2365018 TGGAGAATGGGCTGCTGCCTCGG + Exonic
1142906890 17:3049416-3049438 GGGAGGCTGGGGTGGAGCCCTGG + Intergenic
1143063590 17:4224312-4224334 GGGAGAATGGCGTGAACCCCGGG - Intronic
1143146828 17:4781978-4782000 GGAAGGGTGGGGTGGGGCCTGGG + Intronic
1143196678 17:5081183-5081205 AGGAGAATGGTGTGAAGCCCGGG - Intronic
1143440074 17:6964596-6964618 GGGAGACTGGAATAGAGCCTGGG - Intronic
1143596197 17:7915764-7915786 GCGAGAAGGGGGCGGGGCCTAGG - Intergenic
1144143796 17:12377316-12377338 GGGAGGATGGGGTGGAGCCTCGG - Intergenic
1144187473 17:12809950-12809972 GGGATGAGGGGCTGGAGCCTGGG + Intronic
1144390065 17:14784935-14784957 TGGGGAATGTGGTGGTGCCTGGG - Intergenic
1144612390 17:16733409-16733431 AGGAGAATGGCGTGAACCCTGGG + Intronic
1144796433 17:17894510-17894532 GGGAGAAAGTGGTGGAGCTGAGG - Intronic
1144900339 17:18581879-18581901 AGGAGAATGGCGTGAACCCTGGG - Intergenic
1146007370 17:29169140-29169162 AGGAGAATGGCGTGAACCCTGGG - Intronic
1146030944 17:29365512-29365534 AGGAGAATGGTGTGAACCCTGGG - Intergenic
1146175139 17:30661275-30661297 GAGAGAATGGGGTGGAGGGGAGG + Intergenic
1146214282 17:30966585-30966607 AGGAGAATGGTGTGAACCCTGGG - Intergenic
1146409928 17:32573942-32573964 AGGAGAATGGCGTGAACCCTGGG - Intronic
1146787030 17:35729903-35729925 AGGAGAATGGGTATGAGCCTGGG - Intronic
1147607791 17:41784279-41784301 GAGGGAATGGGGTGGAGCCAGGG + Intronic
1147848111 17:43419664-43419686 GGGAGAATGGCGTGAACCCAGGG - Intergenic
1147947180 17:44086744-44086766 GGGAGAATGGGAGGGGGCCTGGG + Intronic
1148797876 17:50205910-50205932 GGGAGAATGAGGGGGAGGCTGGG - Intergenic
1148978708 17:51552072-51552094 GACAGAATGAGCTGGAGCCTGGG + Intergenic
1149102353 17:52922018-52922040 GGGGGGATGGGGTGAGGCCTCGG - Intergenic
1149107579 17:52987959-52987981 TGTACACTGGGGTGGAGCCTTGG + Intergenic
1149458319 17:56807459-56807481 GGAAGTATGGAGAGGAGCCTGGG + Intronic
1150834840 17:68554924-68554946 GGGAGACTGTGATGTAGCCTGGG + Intronic
1150839135 17:68591736-68591758 GGAGGATGGGGGTGGAGCCTCGG + Intronic
1150970676 17:70023950-70023972 GGGAGAATGGCGTGAACCCGGGG - Intergenic
1151175439 17:72284281-72284303 AGGAGAATGAGGTTGGGCCTAGG + Intergenic
1151306438 17:73265614-73265636 GGGAGACAGAGGTGGAGACTGGG + Intergenic
1151396540 17:73826775-73826797 GGGGGAATGGGGAGGAGTCGGGG + Intergenic
1151598830 17:75094022-75094044 GAGAGAGTGGGGAGGTGCCTGGG + Intronic
1151731553 17:75914393-75914415 GGGAGGAGGTGGTGGAGCCAGGG + Intronic
1151796728 17:76351421-76351443 AGGAGAATGGCGTGAACCCTGGG + Intronic
1151906303 17:77051554-77051576 GGGTGCATGGGGTGCAGCCGGGG + Intergenic
1151939173 17:77281884-77281906 GGGTGAATGGGGTCGGGGCTAGG + Intronic
1152139910 17:78530218-78530240 GGTAGCAGGGGGTGGAGGCTGGG - Intronic
1152365114 17:79851072-79851094 GGGAGAGCGGGGAGAAGCCTGGG - Intergenic
1152379899 17:79937040-79937062 GCGAGCAAAGGGTGGAGCCTTGG + Exonic
1152399604 17:80057782-80057804 AGGAGAATGGCGTGAACCCTGGG + Intronic
1152472130 17:80495500-80495522 GGTAGAATGGGGGGGTGCCCAGG - Intergenic
1152576597 17:81143911-81143933 GGGGGAATGGCTGGGAGCCTTGG - Intronic
1152672370 17:81616636-81616658 AGGAGAATGGGGTGAACCCAGGG + Intronic
1153127164 18:1808470-1808492 GGGAGGAGAGGGTGGGGCCTGGG + Intergenic
1154004925 18:10519157-10519179 GGGAGAATGGGGAGGTGACGAGG - Intergenic
1154394114 18:13971188-13971210 GGGAGAGCAGGGTGGTGCCTGGG + Intergenic
1155623933 18:27813085-27813107 GGGAGGATGGGGTGGAGCCTCGG - Intergenic
1156293376 18:35769664-35769686 GGGAGAAGGGGCTGAAGCCATGG - Intergenic
1156384835 18:36595467-36595489 GGGAGAAGGGGGTGGCAGCTGGG - Intronic
1156747238 18:40407087-40407109 GGGAGAATGGGATGGAAGCAGGG + Intergenic
1156972294 18:43170933-43170955 GGGAGAATGGGGTGAAGACTTGG + Intergenic
1157514648 18:48302188-48302210 TGGGGAATGGGGAGGAACCTAGG - Intronic
1157777840 18:50410172-50410194 GGGGAAACGGGGTGGAGCCATGG - Intergenic
1158053342 18:53250551-53250573 GGAAGAAAGGGGAGGAGACTAGG - Intronic
1158632960 18:59132143-59132165 GGGCGGTTGGGGTGGAGCCCTGG + Intergenic
1158968236 18:62642516-62642538 GGGAGGATGAGGTGCAGCCTTGG - Intergenic
1159400798 18:67931448-67931470 AGGAGAATGGCGTGAAACCTGGG - Intergenic
1160328926 18:77974969-77974991 AGGAGGGTGGGGTGGAGGCTAGG + Intergenic
1160410756 18:78673934-78673956 GGGAGGCTGGGGGGGAGTCTCGG + Intergenic
1160509852 18:79447279-79447301 GGGAGAAGGCGGGGGAGCCCGGG - Intronic
1160685596 19:435109-435131 GGCAGAAAGGAGTGGAGACTGGG - Intronic
1160821913 19:1062865-1062887 ATGAGTATGGGGTGGGGCCTTGG - Intronic
1160918347 19:1508206-1508228 GGAAGATGGGGGTGGAGCCTAGG + Intronic
1160918391 19:1508316-1508338 GGGGGAAGGCGGTGGAGCCTAGG + Intronic
1161500270 19:4610508-4610530 GGGGGAAAGAAGTGGAGCCTGGG + Intergenic
1161505006 19:4639290-4639312 GGGGGGAAGGGGCGGAGCCTGGG - Intergenic
1161741134 19:6021851-6021873 GTGAGAAGGGGCTGGAGGCTGGG + Intronic
1161778333 19:6275946-6275968 GGGGGGAGGGGGAGGAGCCTTGG + Intronic
1161785582 19:6323326-6323348 AGGAGAATGGTGTGAACCCTAGG + Intronic
1161824615 19:6554049-6554071 AGGAGAATGGTGTGAACCCTGGG - Intergenic
1161967161 19:7555130-7555152 GGGAGACTGGGGCGGGGCCTGGG + Intronic
1162243594 19:9379630-9379652 GGCAGAACAGGGTGCAGCCTTGG + Intronic
1162291762 19:9785794-9785816 GTGAGACGGGGGCGGAGCCTCGG - Intronic
1162293000 19:9792847-9792869 GGGAGACGGGGGTGGGGTCTTGG - Intronic
1162377967 19:10316263-10316285 GGGAGACTGGGGTGGGGTCGGGG + Exonic
1162582525 19:11539765-11539787 GGGGGACTGGGTTGGAACCTGGG + Intronic
1162948612 19:14057724-14057746 GGGTGTAGGGGGTGGGGCCTTGG + Intronic
1163353504 19:16794605-16794627 TGGAGAAGGGGGTGGGGCTTGGG + Intronic
1164406782 19:27955650-27955672 GGGAGAATGGGGTGGGGTCACGG + Intergenic
1164810852 19:31154712-31154734 GGGAGGATGGGATGGAACCTCGG - Intergenic
1165448131 19:35868069-35868091 AGGAGAATGGGCTGGGGGCTTGG + Intronic
1165497626 19:36162804-36162826 AGGAGAATGGCGTGAACCCTGGG + Intergenic
1166369670 19:42293837-42293859 GTGAGCATGGGCTGGGGCCTTGG + Intronic
1166531636 19:43546560-43546582 GGGAGGAGGGGCTGGGGCCTGGG - Intronic
1166555601 19:43697697-43697719 GTGACAATGTGGTAGAGCCTAGG + Intergenic
1166712060 19:44944108-44944130 GGGAGAAGGGGGTAGTTCCTGGG + Intronic
1166827129 19:45616592-45616614 GCGAGGAGGGGATGGAGCCTGGG - Intronic
1166855998 19:45782861-45782883 GGGAGAAAGGGGTTGAGGCCTGG + Intronic
1166858776 19:45797286-45797308 AGGAGAATGGCGTGAACCCTGGG + Intronic
1167337292 19:48894966-48894988 GGGACATTGGGGTGAAACCTGGG - Intronic
1167419467 19:49394617-49394639 GGCAGGATGGGGTGGAGGCTGGG + Intronic
1167474484 19:49691972-49691994 GGGAGGAGGGGCTGGGGCCTGGG + Intronic
1167605726 19:50480517-50480539 GGGAGGTTAGGGTGGAGCCCAGG + Intronic
1167791782 19:51687997-51688019 GGGAGAGACGGGTGGAGGCTGGG - Intergenic
1168242060 19:55093305-55093327 GGGAGGAGGGGCTGGGGCCTGGG - Intronic
1168242153 19:55093560-55093582 GGGAGGAGGGGCTGGGGCCTGGG - Intronic
1168242194 19:55093669-55093691 GGGAGGAGGGGCTGGGGCCTGGG - Intronic
1168242223 19:55093741-55093763 GGGAGGAGGGGCTGGGGCCTGGG - Intronic
1168242306 19:55093958-55093980 GGGAGGAGGGGCTGGGGCCTGGG - Intronic
1168242361 19:55094103-55094125 GGGAGGAGGGGCTGGGGCCTGGG - Intronic
1168280732 19:55304141-55304163 AGGAGAAAGGGGTGGAGACATGG + Intronic
1168677028 19:58286031-58286053 GGGAGTCTGGTCTGGAGCCTGGG + Exonic
925062592 2:904886-904908 GAGAGAATGGAGGGGAGCATGGG + Intergenic
925927581 2:8681652-8681674 GGGAGAAGGGGGCAGACCCTGGG - Intronic
926007235 2:9381809-9381831 GGGAGAATGGACTTGAGCTTAGG + Intronic
926239153 2:11071445-11071467 AGGAGGACGGGGTGGAGCCAGGG + Intergenic
926748770 2:16181696-16181718 GGGACAAGGGGGTGGAGCGCTGG - Intergenic
926829118 2:16941184-16941206 GGGAGGACAGGGTGGAGCCTTGG + Intergenic
926926288 2:17991358-17991380 GGGTGCAGGGGGTGGAGGCTGGG + Intronic
927457918 2:23273343-23273365 GGGAGACCGGGAAGGAGCCTGGG - Intergenic
927900829 2:26817116-26817138 GTGAGAAGGGGAGGGAGCCTGGG - Intergenic
929115717 2:38442244-38442266 GGGAGAACAGGGTGGAGCCTTGG + Intergenic
929238018 2:39626861-39626883 GGGAGAACAGGGTGGAACCATGG - Intergenic
929520598 2:42647062-42647084 AGGAGAATGGCGTGGAACCCAGG + Intronic
929830906 2:45345522-45345544 GTGGGGATGGGGTGGAGGCTGGG + Intergenic
932046771 2:68357791-68357813 GGGAGGATGGAGTGGGGCCTTGG - Intergenic
932245030 2:70189623-70189645 AGGAGAATGGCGTGAACCCTGGG + Intronic
932356281 2:71070840-71070862 GTGAGTCTGGGGCGGAGCCTGGG + Intronic
932749432 2:74362023-74362045 GGGAGCATGGGGTGGAGGATGGG - Intronic
933132192 2:78685457-78685479 GGGAGAATGGGAGGGGGACTAGG + Intergenic
933310294 2:80652239-80652261 GGGAGGATGGGGTGGAGCCTCGG - Intergenic
933495540 2:83046162-83046184 GGGAGAAATGGGTGGAGCCATGG - Intergenic
934084959 2:88502275-88502297 AGGAGAATGGGGCTGAGCCCAGG - Intergenic
934151120 2:89148458-89148480 GTGAGAAAGGGGAGGAGACTGGG + Intergenic
934649794 2:96084333-96084355 GGGATGATGGGGTGGAACCCAGG - Intergenic
934856534 2:97733401-97733423 GGGAGGCTGGGATGGAGGCTGGG + Intronic
934931532 2:98429659-98429681 GGGAGAACCGGGTGGAGCCGGGG + Intergenic
934932380 2:98436950-98436972 GGGAGAACAGGGTGGAGCCAGGG + Intergenic
935221619 2:101019978-101020000 AGGAGAATGGTGTGGAACCCGGG + Intronic
935267635 2:101408391-101408413 AGGAGAATGGCGTGAACCCTGGG + Intronic
935282657 2:101532621-101532643 AGGAGTCTGGGGTGGGGCCTGGG + Intergenic
935668300 2:105533790-105533812 AGGAGAATGGCGTGAACCCTGGG - Intergenic
935756580 2:106280938-106280960 GGGAGGAAAGGCTGGAGCCTTGG - Intergenic
935795195 2:106634208-106634230 AGAAGAATGGGGTGGAGCTGTGG + Intergenic
936112942 2:109679768-109679790 GGGAGGAAAGGCTGGAGCCTTGG + Intergenic
936578607 2:113676051-113676073 TGCACACTGGGGTGGAGCCTCGG + Intergenic
937011309 2:118565258-118565280 GTGAGAGTGGGCAGGAGCCTGGG - Intergenic
937402028 2:121592742-121592764 AGGAGAATGGCGTGAACCCTGGG - Intronic
937563008 2:123247772-123247794 AGGAGAATGGTGTGAACCCTGGG + Intergenic
937564787 2:123271594-123271616 GGGAGAATGGCGTGAACCCGGGG + Intergenic
938053547 2:128196293-128196315 GGGGGAATGGGTTTGATCCTGGG + Intergenic
938098036 2:128475929-128475951 GGCAGAGTGGGGTGGCGCATGGG - Intergenic
938199168 2:129358777-129358799 GGCAGAAAGGGGTGGAGATTAGG + Intergenic
938544071 2:132311516-132311538 GGGAGAATGGGGTGTAGGCTGGG + Intergenic
938850901 2:135258349-135258371 GGGAGGATGTGGTGGAGCCTTGG + Intronic
939089749 2:137765819-137765841 GGGAGCATGGTGTGGTGTCTTGG + Intergenic
939419198 2:141944036-141944058 GGGAGAACAGGGTGGAGCCATGG - Intronic
940264162 2:151818926-151818948 GGGGGAATGGGGTGGAGGCGGGG - Intronic
941234195 2:162948468-162948490 GGGAGAATGGTGTGAACCCCGGG + Intergenic
941854113 2:170212767-170212789 GGGGGAAATGGGTGGAGCCACGG - Intronic
942574042 2:177343942-177343964 GGGAGGCTGAGGTGGAGCCCAGG + Intronic
943246290 2:185455665-185455687 GGGAGAATGGGGTGGAGCCACGG + Intergenic
943846535 2:192656099-192656121 GGGGGAACTGGGTGGAGCCATGG - Intergenic
944730669 2:202514226-202514248 AGGAGAATGGCGTGAACCCTGGG - Intronic
944809581 2:203315067-203315089 GGGAGAATGGCGTGAACCCAGGG + Intergenic
944816753 2:203385221-203385243 AGGAGAATGGCGTGAAACCTGGG - Intronic
944964397 2:204914090-204914112 TGCACAATGGGGCGGAGCCTTGG + Intronic
945202000 2:207291304-207291326 GGGTGAGTGGTCTGGAGCCTGGG - Intergenic
945217245 2:207446846-207446868 CGCACACTGGGGTGGAGCCTCGG + Intergenic
945468638 2:210201098-210201120 GGGAGGACGGGGTGGAGCCTCGG + Intronic
946652959 2:221913913-221913935 GGGAGGATGGGGTGGAGCCACGG - Intergenic
947136264 2:226979475-226979497 GGGAGGATGGGGTGGGGTCTCGG - Intronic
947398078 2:229706127-229706149 GGGAAAAGGGAGAGGAGCCTTGG + Intronic
948051192 2:234980686-234980708 GGGAGCATGCGGAGGAGCCTGGG - Intronic
1168874973 20:1165101-1165123 AGGAGAATGGAGGGAAGCCTGGG - Exonic
1169080800 20:2796838-2796860 GGGAAAGTGGGATGGAGCTTAGG + Intronic
1169603545 20:7290000-7290022 GGGACGATGGGGTGGAGTCTTGG - Intergenic
1169615951 20:7445506-7445528 AGGAGAATGGCGTGAACCCTGGG + Intergenic
1169711329 20:8567403-8567425 GGGAGAATGAAGTGAAGACTTGG - Intronic
1170150236 20:13220874-13220896 GGGTGGGTGGGGTGGTGCCTGGG - Intergenic
1170222343 20:13953574-13953596 GGGTGAATGAGGTGAATCCTTGG + Intronic
1170335681 20:15267760-15267782 GGGAGGATGGGACGGGGCCTTGG + Intronic
1170805890 20:19631252-19631274 GGGAGACTGAGGTTAAGCCTTGG + Intronic
1170867812 20:20175616-20175638 AGGAGAATGGCGTGAAACCTGGG - Intronic
1171136488 20:22699531-22699553 CGGATAATGGGGTGGAGCAGAGG - Intergenic
1171238242 20:23545267-23545289 GGGAAGATGGGGTGGAGCCTGGG - Intergenic
1171872935 20:30544247-30544269 GGGAGAATGGGGTGTAGGCTGGG + Intergenic
1171933333 20:31248364-31248386 GGGAGGGTGGGGTGGAGCCTCGG - Intergenic
1172151461 20:32793373-32793395 GGGAGAATTGGCTTGAGCCCAGG + Intronic
1172516757 20:35540270-35540292 GGGAGGCTGGGGTTGAGCCCAGG - Intergenic
1172555419 20:35836750-35836772 GGGAGAATGGCGTGAACCCCCGG + Intronic
1173194587 20:40903878-40903900 GGGAGAATTAGGTGGAGCTCAGG + Intergenic
1173617576 20:44413076-44413098 GGGAGCAGGCAGTGGAGCCTGGG + Intronic
1174165211 20:48579396-48579418 AGGAGAATGGCGTGAACCCTGGG - Intergenic
1174268335 20:49348090-49348112 GGGACAATGGAGTGGGGGCTGGG + Intergenic
1175120604 20:56713344-56713366 GGGAGAATGGTGTGAACCCGGGG + Intergenic
1175985844 20:62763838-62763860 GGGGGAGAGGGGAGGAGCCTTGG + Intergenic
1176040801 20:63064818-63064840 AGGAGAATGGGAGGGAACCTCGG - Intergenic
1176128548 20:63486806-63486828 GGGAGGGTGGGGTGGAGGGTGGG - Intergenic
1176233473 20:64043048-64043070 GGGAGGATGGGGTGGGGTCCCGG + Intronic
1176300426 21:5096535-5096557 GGGAGGGCGGGGTGGAGCCGAGG - Intergenic
1176886427 21:14261346-14261368 GGGAGGACAGAGTGGAGCCTTGG + Intergenic
1176972341 21:15281154-15281176 GGGAGAATGCTGTGGAGCCATGG - Intergenic
1177332548 21:19682036-19682058 AGGAGAATGGCGTGAACCCTGGG - Intergenic
1177817511 21:25993412-25993434 AGGAGAAAGGGGTGGTGCATAGG + Intronic
1177868731 21:26544844-26544866 GGGAGGTTGAGGTGGATCCTAGG + Intronic
1177945816 21:27468615-27468637 AGGAGAATGGCGTGGAACCTGGG + Intergenic
1178388596 21:32179832-32179854 GTGTGAATGGGGTGGAGGTTGGG + Intergenic
1178599694 21:33984993-33985015 CGGGGAATGGGGTGGAGACGGGG + Intergenic
1178908033 21:36652310-36652332 GGGGGAAGGGGTGGGAGCCTGGG - Intergenic
1179804322 21:43827180-43827202 GGGGGTATGGGGTGGGGTCTCGG + Intergenic
1179856618 21:44165446-44165468 GGGAGGGCGGGGTGGAGCCGAGG + Intergenic
1179956193 21:44740448-44740470 GGGAGAATGGGGTGGAGGCATGG + Intergenic
1179956913 21:44745966-44745988 GGGAAGATGCGGTGGAGCCATGG + Intergenic
1180092153 21:45538689-45538711 GGGAGGATGGGATGGAGCCGAGG + Intronic
1180539079 22:16424361-16424383 GGGATTACGGGGTGGAGCCTCGG - Intergenic
1180920589 22:19519669-19519691 GGGAGAGTGGGGAGGACCCCAGG - Intronic
1181560744 22:23698122-23698144 GGGAGAAGGGGCTGGTCCCTGGG - Intronic
1181600655 22:23949891-23949913 GGGGCAATGGGGTGGGGCGTGGG - Intergenic
1181607856 22:23991431-23991453 GGGGCAATGGGGTGGGGCGTCGG + Intergenic
1181618011 22:24068202-24068224 GGGAGAAGGGGGTGGAGGGAAGG + Intronic
1181620354 22:24086894-24086916 GAGAGAATGGGGTAGAAGCTGGG + Intronic
1181747749 22:24967637-24967659 GGGACAATGGGGCCGAGGCTGGG - Intronic
1181846252 22:25711777-25711799 GGGGGCAGGGGGTAGAGCCTGGG - Intronic
1181950757 22:26551979-26552001 GGGAGAATGTGCTTGAGCCCAGG - Intronic
1181977597 22:26742014-26742036 GGGGGAATGGAGTGGAGAGTGGG - Intergenic
1182262748 22:29086849-29086871 GGGAGGCTGAGGTGGAGCCCAGG - Intronic
1182318774 22:29464859-29464881 GGGAGAAGGGGAAGGGGCCTGGG - Intergenic
1182428008 22:30285048-30285070 GGGACCATGAGGTGGAGCCATGG + Intergenic
1182546687 22:31080928-31080950 GCGAGAAAGGGGTGGAGTCGAGG + Intronic
1182943993 22:34305253-34305275 AGGAGAATGGTGTGAACCCTGGG - Intergenic
1183012169 22:34955759-34955781 AGGAGAATGGCGTGAAACCTAGG + Intergenic
1183303255 22:37068958-37068980 GGGCCTATGGGGTGGAGCCCCGG + Intronic
1183930572 22:41233852-41233874 GTGAGAATAGAGTGGGGCCTGGG - Intronic
1184244752 22:43230320-43230342 GGGGGACTGGGGTGGTGTCTGGG + Intronic
1184704825 22:46203764-46203786 GGGAGAATGGGGTGGAGCCACGG - Intronic
1184924589 22:47627968-47627990 GGGGGAATTGGGTGGAGTCCTGG + Intergenic
1184966172 22:47973757-47973779 GGGGGAAGGGGGTGGAGGCCGGG + Intergenic
949166947 3:954371-954393 GGGGGAACAGGGTGGAGCCATGG - Intergenic
949516301 3:4810320-4810342 GGGAGAATGGTGGGGAGTGTGGG - Intronic
950406923 3:12810456-12810478 GGGAGGATGGGGCGGGGCCTGGG + Intronic
950582395 3:13871150-13871172 AGAAGTATGGGGTGGAGCTTTGG + Intronic
950641084 3:14348750-14348772 GGTAGAATGGCGGGGTGCCTGGG + Intergenic
951046028 3:18039521-18039543 GGTAGAAAGTGGTAGAGCCTGGG - Intronic
951319297 3:21225809-21225831 GGTAGAGTGGGGTGGATCATGGG - Intergenic
951845420 3:27079596-27079618 GGGAGAATGGAGTGGAGCCATGG - Intergenic
952325035 3:32313289-32313311 GGGAGAACAGGGTGGGGCCTTGG + Intronic
952417406 3:33101786-33101808 AGGAGAATGGCGTGGAACCCGGG + Intergenic
953321743 3:41978850-41978872 AGGAGAATGGCGTGAACCCTGGG - Intergenic
953508773 3:43513600-43513622 AGGAGAATGGCGTGAACCCTTGG - Intronic
954240858 3:49292406-49292428 GGGAGAAGGGGGTTGGGACTGGG - Intronic
954309289 3:49752394-49752416 AGGAGAATGGCGTGGAACCTGGG + Intronic
954358783 3:50106230-50106252 GGGAGAATGGCGTGAACCCTGGG - Intronic
954420943 3:50418741-50418763 GGGAGAATGAGGTGGAGGGATGG + Intronic
954608830 3:51933633-51933655 GTGGAAATGGGGTGGAGACTGGG - Intronic
954676862 3:52320707-52320729 GGGAAAATGGGATGGGGCCAGGG + Intronic
954713618 3:52516614-52516636 GGGTGAGTGGCGGGGAGCCTGGG + Intronic
954790266 3:53127608-53127630 AGGAGAATGGCGTGAAGCCTGGG + Intronic
955238542 3:57160826-57160848 GTGAGAGTGAGGTGGAGCCCAGG - Intronic
955331130 3:58048345-58048367 TGGAGAACAGGGTGGAGCCTGGG + Intronic
955574268 3:60342129-60342151 GGGAGAACAGGGTGAAGCCAGGG - Intronic
956002363 3:64742800-64742822 GGGAGAATGGCGTGAACCCGGGG + Intergenic
956413570 3:69003728-69003750 GGGGGATGGGGGTAGAGCCTGGG + Intronic
957059028 3:75466519-75466541 GGGAGAATGGCGTGAACCCCGGG + Intergenic
957618873 3:82569333-82569355 GGGAGAATGGGTTTGGGACTAGG - Intergenic
958006788 3:87822344-87822366 AGGAAAATAGGGTGGAGACTTGG + Intergenic
958047942 3:88307838-88307860 GGGAGGACGGGGTGGAGCCTTGG + Intergenic
958536188 3:95407795-95407817 GGAAGAATGGGGTGAAGCCATGG + Intergenic
958536700 3:95412670-95412692 GGGAGAAGGGGGTGGAGTCATGG + Intergenic
958974683 3:100654130-100654152 GGGAGAACGGGGTGGAGCTGTGG - Intronic
959055406 3:101562557-101562579 AGGAGAATGGCGTGAACCCTGGG + Intronic
959572933 3:107904893-107904915 GGGAGGATGGGGTGGAGCCTGGG - Intergenic
959660605 3:108863939-108863961 GGGAGGACAGGGTGCAGCCTCGG - Intergenic
960064938 3:113361585-113361607 AGGAGAATGGCGTGAAACCTGGG - Intronic
960702375 3:120451049-120451071 AGGAGAATGGGGAGGAGCTGGGG - Exonic
960768516 3:121165786-121165808 TGCACACTGGGGTGGAGCCTCGG - Intronic
961082469 3:124037990-124038012 AGGAGCATGGGCTGGAGGCTAGG + Intergenic
961559251 3:127717520-127717542 GGGAGAAGGGGGTTGCCCCTGGG - Intronic
962007336 3:131361800-131361822 GGGATAAGGGGGAGGAACCTGGG - Intergenic
962388982 3:134956082-134956104 GGGAGGAAGGGGAGGAGGCTGGG + Intronic
962859806 3:139389371-139389393 GGGAGAAGGCGGTGGGGCCTAGG - Intronic
962882378 3:139590377-139590399 GGGAGCATGTGGTGGAGGCGAGG + Intronic
963502325 3:146143512-146143534 GGGAGAAGAGGATGGTGCCTAGG - Intronic
963975960 3:151480864-151480886 GGGGGAATGGGGTGATACCTTGG - Intergenic
965887290 3:173462554-173462576 GGGAGAAGGTGGTGGAGTCAGGG - Intronic
966143846 3:176787677-176787699 GGGAGGGTGGGGTGGAGCCACGG - Intergenic
966196536 3:177319479-177319501 AGGAGAATGGGGTGAACCCTCGG + Intergenic
966465545 3:180227700-180227722 GGGAGAATGGAGTTGAACCATGG + Intergenic
966642057 3:182202810-182202832 GAGAGTATGGGTTAGAGCCTGGG + Intergenic
967546235 3:190732064-190732086 GGGAGAACAGGGTGGAGCCACGG - Intergenic
967858044 3:194133225-194133247 GGGAACATGGTCTGGAGCCTAGG - Intergenic
968275925 3:197440178-197440200 GGGTGGATGGGGAGTAGCCTTGG - Intergenic
968398559 4:267210-267232 AGGAGAATGGTGTGAACCCTGGG + Intergenic
968669363 4:1840573-1840595 AGGAGAATGGTGTGGACCCCGGG + Intronic
968691404 4:1992176-1992198 GGCAGCAGGGGGTGGGGCCTGGG + Intronic
968886053 4:3333139-3333161 AGGAGAATGGCGTGAACCCTGGG - Intronic
968890291 4:3365109-3365131 AGGAGCCTGGGCTGGAGCCTGGG + Intronic
968963802 4:3759271-3759293 GGGAGTGTGAGGTGGAGCCCGGG - Intergenic
969073807 4:4561219-4561241 GGGGGAAAGGGGTAGAGCCAGGG - Intergenic
969582942 4:8076388-8076410 GGTGGAATGGGGTGTACCCTTGG - Intronic
969751080 4:9111816-9111838 GGGAGAATGGCGTGAACCCCAGG - Intergenic
969810992 4:9648108-9648130 GGGAGAATGGCGTGAACCCTGGG - Intergenic
970300985 4:14681054-14681076 TGGAGATTGGGGTGGAGGCTGGG + Intergenic
970643155 4:18090055-18090077 GGGTGGATGGGGAGGAGCATGGG - Intergenic
971145744 4:23974722-23974744 GGGAGAATGGCGTGAACCCGGGG - Intergenic
972194925 4:36641901-36641923 GGGAGAATGGCGTGAACCCGCGG + Intergenic
972419120 4:38869585-38869607 CAGAGAATAGGCTGGAGCCTGGG + Intronic
972679384 4:41290699-41290721 GGGAGAACAGGGTGGAGCCTCGG - Intergenic
974259243 4:59503605-59503627 GGGGGCATGGGGTAGAGCATTGG - Intergenic
974613086 4:64241752-64241774 AGGAGAATTGGGTTGAACCTGGG - Intergenic
974910820 4:68117373-68117395 AGGAGAATGGAGTGAACCCTGGG + Intronic
975169512 4:71216692-71216714 GGGAGCATGGCATGGAGCATTGG + Intronic
975347028 4:73303654-73303676 GTAAAAATGGGGTTGAGCCTGGG - Intergenic
975424325 4:74208755-74208777 GAGAGAATGGGTTGGAGCCATGG - Intronic
976724520 4:88202645-88202667 GGGAGAACGGGGTGGAGCCATGG - Intronic
977315648 4:95444421-95444443 AGGAGAATGGCGTGAAGCCAGGG - Intronic
977405835 4:96597552-96597574 AGGAGAATGGCGTGAACCCTGGG + Intergenic
977891837 4:102321375-102321397 GGGAGAATAGGATGGAGCCATGG + Intronic
977944519 4:102896560-102896582 GGGATTACGGGGTGGAGCCTCGG - Intronic
978230324 4:106389736-106389758 GTGAGAATTGGGTGGGGCCACGG + Intergenic
978257406 4:106709195-106709217 GGGAGAACTGGGTGGAGGTTAGG + Intergenic
978366899 4:107991729-107991751 GGGAGATTTGGGTGGAGCCTGGG - Intronic
978665528 4:111176912-111176934 AGGAGAATGGCGTGAACCCTGGG + Intergenic
978749298 4:112229076-112229098 GGGGGAATGGGGTGGAACCAGGG + Intergenic
978887087 4:113776866-113776888 GGGAAGACGGGGTGGAGCCTTGG + Intergenic
978912674 4:114082904-114082926 GGGAGAATGGGAGGGAGAATGGG - Intergenic
979104194 4:116663911-116663933 GGGAGAGCAGGGTGGAGCCGTGG + Intergenic
979707673 4:123739717-123739739 GGAAGAATGGATTGGAGACTTGG - Intergenic
979734436 4:124065042-124065064 GGGAGAATGGGGTGTAGGGAGGG - Intergenic
979755772 4:124338770-124338792 GGGAGAATGGCGTTGAACCCGGG - Intergenic
979772350 4:124543464-124543486 AGGAGAATGGCGTGAACCCTGGG + Intergenic
980048079 4:128011238-128011260 AGGAGAATGGTGTGAACCCTGGG - Intronic
980299746 4:130973214-130973236 GGGAGCCTGTGGTGGTGCCTTGG - Intergenic
980339864 4:131531442-131531464 GGGAGGATGGGATGGGGCCTGGG - Intergenic
980479358 4:133367234-133367256 GGGAGGACAGGGTGGAGCCTCGG + Intergenic
980795509 4:137677227-137677249 GGGATGATGGAGTGGAGCCATGG - Intergenic
981189960 4:141851179-141851201 GGGAGGACGGAGTGGAGCCTCGG + Intergenic
982041261 4:151399197-151399219 AGGAGAATGGCGTGAACCCTGGG + Intergenic
982055178 4:151541979-151542001 GGGAGGATGGGTTGGAGCCTTGG + Intronic
982145066 4:152378420-152378442 GAGAGAATGGAGTAGAGCTTTGG - Intronic
982475283 4:155842998-155843020 GGGAGGAAGGGGTGGAGCCTTGG - Intronic
982477535 4:155872166-155872188 GGGAGGATGGGATGGAACCTTGG - Intronic
982739557 4:159043437-159043459 AGGAGAATGGCGTGAACCCTGGG - Intergenic
983226325 4:165089411-165089433 AGGAGAATGGCGTGAAACCTGGG - Intronic
983552742 4:169033873-169033895 GGGGGAAGTGGGTGGAGCCATGG - Intergenic
984026682 4:174551252-174551274 GGGATAAAAGGGTGGAGCATAGG - Intergenic
984039916 4:174719053-174719075 AGGAGAATGGGGTGAACCCCAGG - Intronic
984271757 4:177556932-177556954 GGGAGAATGGTGTGAACCCGGGG - Intergenic
984592921 4:181636630-181636652 GGGAGAAGTGGGTGGAGTGTGGG - Intergenic
984732926 4:183085215-183085237 AGGAGAATGGCGTGAACCCTGGG - Intergenic
984767484 4:183410577-183410599 CAGAGAATGGGGTGGAGACCCGG - Intergenic
985670674 5:1205058-1205080 GAGAGAATGGGGTGGGGACGTGG - Intronic
985839281 5:2293898-2293920 AGGAGAAAGCGCTGGAGCCTCGG + Intergenic
986171697 5:5319653-5319675 GGGAGGAGGAGGAGGAGCCTGGG - Exonic
986645472 5:9912383-9912405 GGGAGAGAGGGTTGGAGCCGAGG - Intergenic
987155135 5:15081587-15081609 TGGGCACTGGGGTGGAGCCTTGG - Intergenic
988211374 5:28209211-28209233 GGGAGAATGGTGTGGGGCCATGG + Intergenic
988403707 5:30796602-30796624 GGGAGGAGAGGGTGGAGTCTAGG + Intergenic
988585972 5:32507855-32507877 GGGAGGATCGGGTGGAGCCTTGG - Intergenic
988807256 5:34751985-34752007 AGGAGTCTGGGGTGGAGCCCTGG - Intronic
989438147 5:41438457-41438479 GGGAGAATGGGGTGGAACCAGGG + Intronic
989691603 5:44151775-44151797 GGGAGAACAGGGTAGAGCCAGGG + Intergenic
990444900 5:55885530-55885552 GGGAGAATGGGGTGGAGCCACGG - Intronic
991083030 5:62621466-62621488 GGGAGGACAGGGTGGAGCCTTGG - Intronic
991202293 5:64008488-64008510 GGGAGGATGGGGTGGAGCCATGG + Intergenic
991465419 5:66907307-66907329 GGGAGGATGAGGTAAAGCCTCGG - Intronic
992751323 5:79865459-79865481 GGGAGGATCGCATGGAGCCTCGG - Intergenic
992939842 5:81751161-81751183 GGGCGAAGGGGGCGGAGCTTTGG - Exonic
993316496 5:86413580-86413602 AGGAGAATGGCGTGAAGCCCGGG - Intergenic
993710015 5:91215293-91215315 GGGGCAATGGGGAGGAGACTGGG + Intergenic
994063605 5:95509489-95509511 GGGAGAACCGGGTGAAGCCAGGG - Intronic
994232614 5:97325129-97325151 AGGAGGCTGGGGTTGAGCCTGGG + Intergenic
994321498 5:98400087-98400109 GAGAGAAAGAGGTGGGGCCTGGG - Intergenic
994509891 5:100689270-100689292 GAGAGAGTGGGGTCCAGCCTTGG + Intergenic
994913149 5:105939189-105939211 GTGAGAATGGGGTGGAACCACGG - Intergenic
994979636 5:106857022-106857044 GGGGGAAGGGGGTGGAGCCAGGG - Intergenic
995440044 5:112181357-112181379 AGGAGAATGGCGTGGAACCCGGG + Intronic
996223863 5:120965558-120965580 GGAAGGATGGAGTGGAGCCTTGG - Intergenic
996278165 5:121693981-121694003 GGGAGAACAGGGTGGAGTTTTGG - Intergenic
996507318 5:124282468-124282490 ATGAGAATGGGGTGGAGACTTGG - Intergenic
996670183 5:126108651-126108673 GAAAGAATGGGGTGGAACCACGG + Intergenic
996677021 5:126188067-126188089 GGGAGGTTGGGGTGTAGCCTTGG + Intergenic
997471123 5:134117501-134117523 GGGAGGCTGGAGTAGAGCCTTGG - Intronic
997989100 5:138529034-138529056 AGGAGAATCGGCTTGAGCCTGGG + Intronic
998639672 5:143995485-143995507 GGAAGGATGGGATGGGGCCTGGG - Intergenic
998641169 5:144013022-144013044 GGGAGAACAGGGTGTAGCCATGG - Intergenic
998651122 5:144122808-144122830 GGGAGGATGGGGTAGAGCCTCGG - Intergenic
999256623 5:150213220-150213242 GGGAGGCTGGTGTGGAGCCTTGG + Intronic
999321293 5:150616745-150616767 TGGAGAAGAGGGAGGAGCCTAGG - Intronic
999534216 5:152499701-152499723 GGGAGAACGCAGTGGAGCCATGG - Intergenic
999697440 5:154199343-154199365 GGGAGAATGGAGTGGGTCCCTGG - Intronic
1000241810 5:159415721-159415743 GGGAGAACGGGGTGGAACCAGGG + Intergenic
1000352714 5:160364767-160364789 GGAAGGATGGGGTGTTGCCTTGG + Intronic
1000760936 5:165223708-165223730 AGGAGAATGGCGTGAACCCTGGG - Intergenic
1001760047 5:174200051-174200073 AGGAGAATGGTGTGAAGCCAGGG - Intronic
1001938907 5:175727285-175727307 GGGTGTATGGGATGGAGCCCAGG + Intergenic
1002515449 5:179754734-179754756 GTGAGTATGGGGTAGTGCCTGGG + Intronic
1002534247 5:179867526-179867548 GGCAGAGTGGGGAGGAGCCAAGG + Intronic
1002702046 5:181131054-181131076 ACGAGAGTCGGGTGGAGCCTGGG + Intergenic
1003921812 6:10839629-10839651 GGGAGGATGGGAGAGAGCCTAGG + Intronic
1004743946 6:18491457-18491479 AGGAGAATTGGAAGGAGCCTCGG + Intergenic
1004943707 6:20588002-20588024 GGGAGGATGGCTTGAAGCCTGGG + Intronic
1004979488 6:21007388-21007410 GGGAGGCTGAGGTTGAGCCTGGG + Intronic
1005042072 6:21608867-21608889 GGGAGAACGGGGTGGAGTCGCGG + Intergenic
1005409334 6:25526249-25526271 GGGAGAATGGCGTGAACCCGGGG + Intronic
1005720874 6:28600992-28601014 AGGAGAATGGCGTGAACCCTGGG - Intronic
1005981579 6:30840845-30840867 GGGAAAATGGGGTGGAGCCACGG - Intergenic
1005981937 6:30843392-30843414 GGGAGAAGGGGGTGGAGCCACGG + Intergenic
1006103373 6:31701097-31701119 GGGAGTGTGGGGTGGAGGTTGGG - Intronic
1006187720 6:32190202-32190224 GGGAGAAGGGGGGGGAGCGAGGG + Intergenic
1006360204 6:33583454-33583476 GGGGAAAGGGGGTGGAGACTTGG - Intergenic
1006942718 6:37763555-37763577 GGGAGGATGGGATGGAGAGTGGG - Intergenic
1006985831 6:38175005-38175027 GGGAGCGTGAGTTGGAGCCTGGG + Exonic
1007007333 6:38378073-38378095 GGGAGGACGGGGCGGAGCCATGG - Intronic
1007058941 6:38918804-38918826 GGGAGATTGGGATGGGGCCCTGG - Intronic
1007115273 6:39338947-39338969 GGGTGGGTGGGGTGGGGCCTGGG + Intronic
1007118464 6:39361261-39361283 AGAAGAATGGGTTGGAGGCTGGG + Intronic
1007209999 6:40185756-40185778 AGGAGAAGGGGCTGGAGCCCAGG + Intergenic
1007281991 6:40719689-40719711 AGGAGAGTGGGGTGGAGCGTGGG + Intergenic
1007398373 6:41589974-41589996 TGGAGAATGAGGAGGAGCCGGGG - Exonic
1007494858 6:42252677-42252699 GGGAGAAGGAGGTGGTGGCTGGG + Intronic
1007517260 6:42422685-42422707 GGCAGAAAGGGGTGGAGCGAAGG - Intronic
1007580371 6:42955526-42955548 AGGAGAATGGTGTGAACCCTGGG - Intergenic
1007620414 6:43210068-43210090 AGGAGAATTGGCTTGAGCCTGGG - Intronic
1007633652 6:43285748-43285770 GGGAGCATGGAGCGTAGCCTAGG - Exonic
1007739787 6:44003349-44003371 GGGAGAGTGGGGAGGGGCCAGGG + Exonic
1007745019 6:44038375-44038397 GGGAGAACTGGGCGGGGCCTGGG + Intergenic
1008685854 6:53925617-53925639 TAGTGAATGGGGTGGAGGCTGGG + Intergenic
1008985931 6:57543029-57543051 AGGAGAATGGCGTGAAGCCCAGG - Intronic
1009774058 6:68181791-68181813 GGGTGAATGGGCAGGAGCCAAGG + Intergenic
1010035148 6:71317306-71317328 GAGAGAATGTGGTGGGGCCTGGG + Intergenic
1010436099 6:75833089-75833111 GGGAGAATGAGGTGGAACAGTGG - Intronic
1010822887 6:80436248-80436270 GGGAGAATGGCGTGAACCCGGGG - Intergenic
1011591275 6:88972662-88972684 TGTACACTGGGGTGGAGCCTCGG + Intergenic
1011888311 6:92125761-92125783 GGCAGAATGGGGTGGGGGCGGGG - Intergenic
1012629211 6:101442407-101442429 GGCAGGATGGGGTGAAACCTTGG - Intronic
1012795201 6:103750770-103750792 GGGAGAATGGGGTGGAGCCATGG + Intergenic
1012804504 6:103877548-103877570 GGGGGAAATGGGTGGAGCCACGG + Intergenic
1012804790 6:103879781-103879803 GGGAGAAGTGGGTGTAGCCATGG + Intergenic
1013301419 6:108808473-108808495 TGGAGAAGGGGGTGGTGCATGGG - Intergenic
1013747472 6:113362892-113362914 GGGAGAATGGGGGAGAACCAGGG - Intergenic
1014193465 6:118524868-118524890 GGGGGAAATGGGTGGAGCCATGG + Intronic
1014674718 6:124349317-124349339 GGGAGAATGGGGTGGAGCCTCGG - Intronic
1014920052 6:127203293-127203315 GGGTGAAAGGGGTGGAGGCAAGG - Intergenic
1015167808 6:130218323-130218345 GAGAGAATGGGGTGGAGCCACGG - Intronic
1015363886 6:132375515-132375537 AGGAGAATGGCGTGAACCCTGGG - Intronic
1015751472 6:136564231-136564253 GTGGGAATGGGGTCGAGCCTGGG - Intronic
1015787365 6:136931540-136931562 AGGTGAATGGGGTGGAGTGTGGG + Intergenic
1015935363 6:138403017-138403039 GGGAGGATCGGCTTGAGCCTGGG - Intergenic
1016153655 6:140776665-140776687 AGGAGAATGGCGTGAAACCTGGG - Intergenic
1016173693 6:141051732-141051754 GGGAAGATGGGGTAGATCCTGGG - Intergenic
1016233203 6:141831105-141831127 GGGAGGATGGGAGGGTGCCTTGG - Intergenic
1016621210 6:146110625-146110647 GGGAGACTTGAATGGAGCCTTGG - Intronic
1016889550 6:148992375-148992397 AGGAGAATGGGGTGAACCCGAGG + Intronic
1017156192 6:151324538-151324560 GGGAGGAGGGAGGGGAGCCTCGG - Intronic
1017205542 6:151800890-151800912 GGGAGAATGGGAAGGTGCCGTGG + Intronic
1017609536 6:156170498-156170520 GGGAGAATGGTGTGAACCCGGGG - Intergenic
1017775747 6:157679465-157679487 GAGAGAAGGGGGTGGGTCCTGGG - Intergenic
1018260853 6:161969388-161969410 GGGAGAAAGGGATGGAGCCTTGG + Intronic
1018569878 6:165197667-165197689 GCTAGAATGTGGTGGAGCCAAGG + Intergenic
1018618471 6:165709215-165709237 GGGAGCATGGGGTAGAGGGTGGG - Intronic
1019428521 7:988217-988239 GGGAAGATGGGATGGGGCCTGGG - Intronic
1019797590 7:3063304-3063326 AGGAGAAAGGGGAGGAGGCTGGG - Intergenic
1019988224 7:4673766-4673788 AGGAGAATGGCGTGAACCCTGGG + Intergenic
1020088339 7:5323469-5323491 GCGAGAGTGGGTTGTAGCCTGGG - Intronic
1020263269 7:6543460-6543482 GGAAGAAAGGGGTGGAGACTGGG - Intronic
1020904907 7:14052804-14052826 TGGACACTGGGATGGAGCCTGGG - Intergenic
1021648335 7:22808317-22808339 GGGGGAACGGGGTGGAGCCATGG + Intergenic
1021686225 7:23189386-23189408 GGGAGAATGGCTTGAAGCCAGGG + Intronic
1021692482 7:23243855-23243877 AGGAGAATGGCGTGAACCCTGGG + Intronic
1022084503 7:27053384-27053406 CAGAGAATGGGGTAGAGCCCTGG - Intergenic
1022164522 7:27744215-27744237 AGGAGAATGGCGTGAACCCTGGG - Intronic
1022300820 7:29100503-29100525 GGGAGGATAGGGTGGAGGATAGG - Intronic
1022473350 7:30694931-30694953 GGGAGAATGGGGAGGAGAGAAGG + Intronic
1022688363 7:32618667-32618689 GGGAGATGGGGGTGGTGCCGAGG - Intergenic
1022741354 7:33124546-33124568 AGGAGAATGGCGTGAACCCTGGG - Intergenic
1022834497 7:34100997-34101019 GGGGGCCTGGGGTGGGGCCTGGG - Intronic
1023098567 7:36689277-36689299 GGAAGAATATGGTGGAGACTGGG + Intronic
1023373974 7:39538022-39538044 AGGAGAATGGCGTGAACCCTGGG + Intergenic
1023788117 7:43728781-43728803 GGGAGAATGGGGAGGAATCAGGG + Intronic
1023961259 7:44928180-44928202 AGGAGAATGGTGTGAACCCTGGG + Intergenic
1024397876 7:48889899-48889921 GGGAAGATGGGGTGGAGCCATGG + Intergenic
1024398446 7:48895033-48895055 GGGAGGATGGGGTTGAGTCATGG + Intergenic
1025157380 7:56620570-56620592 GGGAAAAGGAGGTGGAGCCAGGG + Intergenic
1025205973 7:56993646-56993668 GCGAGAGTGGGTTGTAGCCTGGG + Intergenic
1025665967 7:63583293-63583315 GCGAGAGTGGGTTGTAGCCTGGG - Intergenic
1025757848 7:64362247-64362269 GGGGGAAGGGAGTGGAGCCATGG - Intergenic
1025829565 7:65038047-65038069 GGGAGAAAGGGGTGGGGCAGGGG - Intergenic
1025916802 7:65872996-65873018 GGGAGAAAGGGGTGGGGCAGGGG - Intergenic
1026521024 7:71118425-71118447 CAGGGAATGGGGTTGAGCCTGGG - Intergenic
1026861451 7:73792740-73792762 GTGGGAATGGGGTGGGGGCTAGG + Intergenic
1026915966 7:74120673-74120695 GGGTGAGTGGGGAGGAGCCCAGG - Intronic
1027995776 7:85423880-85423902 GGCAGAAAGGGGTGGATCCCTGG + Intergenic
1028107960 7:86902680-86902702 GGAAGAATGGGGTGGGGCCTTGG + Intronic
1028534862 7:91880900-91880922 TGGAGGGTGGGGTGGGGCCTGGG + Intergenic
1028542363 7:91956306-91956328 AGGAGAATGGCGTGGACCCGGGG + Intronic
1028849736 7:95524818-95524840 GGGAGAATGGGATGGAGCTATGG + Intronic
1029920226 7:104254695-104254717 GGGAGGATGGGGTGAATCCTTGG - Intergenic
1031165749 7:118225034-118225056 GGGAGGACGGGTTGGGGCCTGGG + Intronic
1031172057 7:118304323-118304345 GGGAGAATGGGGTGGAGCTAAGG - Intergenic
1031456059 7:121981048-121981070 AGGAGAATGGCGTGAACCCTGGG + Intronic
1031468267 7:122140391-122140413 TGGAGAATGGCGTGGAACCCGGG + Intronic
1031523832 7:122799509-122799531 GGGAGAATGGCGTGAACCCCGGG + Intronic
1031534203 7:122913807-122913829 GGGAAGACGGGGTGGAGCTTCGG - Intergenic
1031999309 7:128254449-128254471 GTCAGGATGGGGTGGAGCCCAGG - Exonic
1032055054 7:128677413-128677435 GGGAGAATGGCGTGAACCCCGGG + Intronic
1032128700 7:129212280-129212302 GGCAGAATGGGTTGGAGACCAGG - Exonic
1032129971 7:129219999-129220021 GGGAGAGTGGGGTGGGGTATTGG - Intergenic
1032144612 7:129367831-129367853 GGGAGGTTCGGATGGAGCCTAGG - Intronic
1032250887 7:130256339-130256361 GGGAGAATGGGGTAGAGCCATGG + Intergenic
1032251604 7:130262345-130262367 GGGAGGATGGGGTGGTGCCATGG + Intergenic
1032706569 7:134425175-134425197 GGGGGTATGGGGTGGGGTCTGGG + Intergenic
1033051760 7:138010887-138010909 AGGAGAATGGTGTGAACCCTGGG + Intronic
1033062454 7:138122036-138122058 TGGTGAATGGGCTGGAGCCTTGG + Intergenic
1033387564 7:140893339-140893361 AGGAGAATGGTGTGAACCCTGGG - Intronic
1033866199 7:145692735-145692757 GGGAGAATGGGGTGGAGCCAGGG + Intergenic
1034257223 7:149731285-149731307 TGAAGAATGTGGTGCAGCCTGGG - Intronic
1034317242 7:150143879-150143901 GTGAGAGTGGGCTGGAACCTGGG + Intergenic
1034449336 7:151129057-151129079 TTGAGAATGGGCTAGAGCCTCGG + Intronic
1034775510 7:153823338-153823360 GTGAGAGTGGGCTGGAACCTGGG - Intergenic
1035675582 8:1453269-1453291 GGGAGAAGCAGGAGGAGCCTGGG + Intergenic
1035705567 8:1671848-1671870 GAGAGAATGGGCTCCAGCCTTGG + Intronic
1036099321 8:5760169-5760191 TCCAGAATGGGATGGAGCCTTGG - Intergenic
1036977244 8:13427372-13427394 AGGAGAAATGGGTGGAGACTAGG - Intronic
1037259827 8:16996027-16996049 GGGACAACAGGATGGAGCCTTGG + Intronic
1037412490 8:18613301-18613323 GGGAGGAGGGGGTGGGGCCTTGG + Intronic
1037760338 8:21737732-21737754 GGGAGAGTGGTGTGGAGACAGGG - Intronic
1037776509 8:21839050-21839072 GGGAGGATGGGATGGAGGCGGGG + Intergenic
1037855212 8:22366984-22367006 GGGGGTGTGGGGTGGAGGCTAGG + Intergenic
1037875919 8:22548333-22548355 AGGAGAAAGGGATGGAGCCCAGG + Intronic
1037880060 8:22568953-22568975 TGGAGGATGGGGAGGAGTCTGGG - Intronic
1037950529 8:23016355-23016377 GAGAGATCGGGGTGGAGACTTGG - Intronic
1039125519 8:34197183-34197205 GGGAGAATGGGGTGAAACCAGGG - Intergenic
1039413553 8:37375372-37375394 GGGAGAAAGGGATGGGGGCTGGG - Intergenic
1039856794 8:41422013-41422035 AGGAGAATGGCGTGAAGCCCAGG + Intergenic
1040027361 8:42794331-42794353 GGGAGGACAGGGTGGAGCCATGG - Intronic
1040354882 8:46608005-46608027 AGGAGAATGGCGTGAACCCTGGG + Intergenic
1040374507 8:46810863-46810885 GGGAAAAGGAGGTGGAGCCATGG - Intergenic
1040560201 8:48517088-48517110 GTGGGAATGGGGTGGACCCCTGG - Intergenic
1041310706 8:56513676-56513698 GTGAGCATGGGGTGGATCCCAGG - Intergenic
1041386436 8:57309327-57309349 GGAAAAATGGGGTGGAGGCAGGG + Intergenic
1041848567 8:62360084-62360106 GGCTGCATGGGGTGAAGCCTGGG - Intronic
1042460169 8:69056490-69056512 AGGAGAATGGCGTGAACCCTGGG - Intergenic
1042548366 8:69971349-69971371 GGGAGGCTGAGGTTGAGCCTGGG - Intergenic
1042576004 8:70219485-70219507 GGGAAAGTGGGGTGGAGTCGGGG + Intronic
1042908772 8:73802929-73802951 AGGAGAATGGTGTGAACCCTGGG + Intronic
1043317306 8:78938550-78938572 AGGAGAATGGTGTGAACCCTGGG - Intergenic
1044111724 8:88283555-88283577 GAGAGAGTGGGGAGGTGCCTGGG - Intronic
1045372455 8:101538286-101538308 GGCAGAATGATCTGGAGCCTTGG + Intronic
1046337908 8:112813942-112813964 GGGAGGACGGGGCGAAGCCTTGG - Intronic
1046466932 8:114617201-114617223 AGGAGAATGGCGTGAACCCTGGG - Intergenic
1046885994 8:119367830-119367852 GGGAGAAGCAGGTGGAGCCACGG + Intergenic
1047588633 8:126302651-126302673 TGCACAGTGGGGTGGAGCCTCGG + Intergenic
1048051015 8:130816515-130816537 AGGAGAATGGGGTGAACCCGAGG - Intronic
1048074891 8:131058873-131058895 GGGAGCATGGCCTGTAGCCTAGG + Intergenic
1048459132 8:134605452-134605474 GGGAGAATGGCGTGAACCCAGGG + Intronic
1049239646 8:141530688-141530710 GGGTGATGGGGCTGGAGCCTGGG - Intergenic
1049586064 8:143432868-143432890 GGGAGAAGGTGGTGGAGGCTGGG + Intergenic
1049644290 8:143729120-143729142 GGGAGATTGGGGAGGACCCGTGG - Intronic
1049698644 8:143996348-143996370 TGGGGAATGGGGTGGAGACTTGG - Intronic
1049774195 8:144397108-144397130 GGGGAGATGGGGTGGAGCCACGG + Intronic
1049792347 8:144477936-144477958 GGGAGCCGGGGGCGGAGCCTGGG - Intergenic
1050785248 9:9392941-9392963 GGGAGAATGGGGTGGAGCCATGG + Intronic
1051434525 9:17016862-17016884 GGAAGAACAGGGTGGAGCCATGG - Intergenic
1052509066 9:29390976-29390998 GGGAGCAGGGGGTGGAGATTTGG - Intergenic
1053522821 9:38798137-38798159 AGGAGAATGGCGTGAACCCTGGG + Intergenic
1054195045 9:62022557-62022579 AGGAGAATGGCGTGAACCCTGGG + Intergenic
1054438142 9:65232432-65232454 AGGAGAATGGCGTGAACCCTGGG + Intergenic
1054643363 9:67566133-67566155 AGGAGAATGGCGTGAACCCTGGG - Intergenic
1055313607 9:75010807-75010829 GGGAGAATGGTGGGGAGAATGGG + Intronic
1055325440 9:75123328-75123350 AGGAGAATGGCGTGAACCCTTGG + Intronic
1055536682 9:77254033-77254055 AGGAGAATGGTGTGAACCCTGGG - Intronic
1056867151 9:90238077-90238099 GGGAGAATGGCGTTGAACGTGGG + Intergenic
1056914456 9:90733415-90733437 GGGAGAATGGGGTGCAGCTGTGG - Intergenic
1057342393 9:94214390-94214412 GGGAGGACTGGGTGGGGCCTCGG + Intergenic
1057402671 9:94738663-94738685 GGGAGAATGGTGTGAACCCGGGG - Intronic
1057406483 9:94775892-94775914 GGGAGAATGGTGTGAATCCGGGG + Intronic
1057445556 9:95111992-95112014 GGGAGAAAGAGGTGGAGGGTAGG + Intronic
1057622419 9:96647994-96648016 GGGAGAATCGATTGGAGCCTGGG - Intronic
1058281926 9:103127036-103127058 GGGAGGATGGGGTGGAGCCTAGG - Intergenic
1059162615 9:112049592-112049614 GCCAGAATGGGGCTGAGCCTTGG + Intronic
1059518250 9:114915564-114915586 GGGAGAAGAGGGAGGAGCCCCGG + Intronic
1059811082 9:117856367-117856389 GGGAGAATGGGGTGGAGGCTCGG - Intergenic
1059857797 9:118419837-118419859 GGGGAATTGGAGTGGAGCCTGGG + Intergenic
1060084530 9:120684924-120684946 AGGAGAATGGCGTGAACCCTGGG - Intronic
1060268985 9:122128059-122128081 GGGAGCATGGGGCTGAGTCTTGG - Intergenic
1060282016 9:122221288-122221310 GGGAGCTGGGGGAGGAGCCTCGG - Intronic
1060500406 9:124149471-124149493 GGGAGAATGGCGTGAACCCAGGG - Intergenic
1060596642 9:124852787-124852809 CTGAGGATGGGGTGGAGGCTGGG - Intergenic
1060624362 9:125096727-125096749 GGGAGAATGGGATAGAGGCAGGG - Intronic
1060725342 9:126002525-126002547 GGGTGGCTGGAGTGGAGCCTGGG + Intergenic
1061254027 9:129443292-129443314 GGCAGGATGGGGTGGAGAATTGG - Intergenic
1061542854 9:131287611-131287633 GGGAGAATGGGGTGAGTGCTTGG + Intergenic
1061580776 9:131534510-131534532 TGGAGAGTTGGGTGGAGGCTTGG + Intergenic
1061940866 9:133883075-133883097 GGGACATAGGGATGGAGCCTGGG - Intronic
1061954673 9:133955512-133955534 TGGGGAATGGGGAGGAGCTTGGG - Intronic
1061954728 9:133955657-133955679 GGGGGAATGGGGAGCAGCATGGG - Intronic
1061954737 9:133955679-133955701 GGGGGAGTGGGGAGGAGCTTTGG - Intronic
1062111177 9:134782860-134782882 GGGACAGTGGCGTGGAGCCCAGG + Intronic
1062426481 9:136508476-136508498 TGTAGAATGGGTTGCAGCCTGGG - Intronic
1062444362 9:136587510-136587532 TGGAGGCTGGGGTGGAGGCTCGG - Intergenic
1062451052 9:136616024-136616046 GGGAGACGGGGGAGGTGCCTAGG - Intergenic
1062505625 9:136874060-136874082 AGGAGAATGGTGTGAACCCTGGG + Intronic
1203770255 EBV:46383-46405 GCGAGATTGGGGTGGATCATAGG - Intergenic
1185572814 X:1147456-1147478 GGGAGGATGGAATGGATCCTGGG - Intergenic
1185880062 X:3732813-3732835 GGGAAAATGGGCTGGAGCCACGG - Intergenic
1186442080 X:9595131-9595153 GGGAGCCTGGGGAGGAGCCGGGG - Intronic
1187033125 X:15509220-15509242 GGGAGATTGGGGTGGGGGGTGGG - Intronic
1187295769 X:17999187-17999209 GTGAGAAAGGGGTGGAGTCATGG - Intergenic
1187771286 X:22699716-22699738 GGAAGAATGTGGTGGGGCTTTGG - Intergenic
1187860874 X:23681138-23681160 AGGAGAATGGCGTGAACCCTGGG + Intronic
1188126357 X:26373997-26374019 GGGGGAAATGGGTGGAGCCATGG - Intergenic
1188220589 X:27536778-27536800 AGGAGAACGGGGTGGAGCCATGG - Intergenic
1188848139 X:35099507-35099529 GGGTGAATGTGGTGGTGACTCGG - Intergenic
1189117318 X:38356608-38356630 GGGAGGACAGGGTGGGGCCTTGG - Intronic
1189144603 X:38643001-38643023 GGAAGAATGGGATGGAGAGTGGG + Intronic
1189376128 X:40467376-40467398 GGGAGGAGGGGGTGGAGGGTGGG + Intergenic
1189415578 X:40809861-40809883 GGGAGAACAGGGTGGAGCCAGGG + Intergenic
1189616412 X:42788964-42788986 GGGAGGACAGGGTGGAGCCTCGG - Intergenic
1189617088 X:42794832-42794854 GGGAAGACAGGGTGGAGCCTCGG - Intergenic
1190084422 X:47383008-47383030 GTGAAAATGGGGAGAAGCCTAGG + Intronic
1190237406 X:48627098-48627120 GGGAGGCTGAGGTGGAGCCCAGG + Intergenic
1190491216 X:50984028-50984050 TGCACACTGGGGTGGAGCCTTGG + Intergenic
1190576806 X:51847686-51847708 GGGAGAATGGGGTGGAGCCATGG - Intronic
1190724633 X:53180818-53180840 AGGAGAATGGGGTGAACCCCCGG - Intergenic
1191189418 X:57650731-57650753 GGGACAATGGGGTAGAGCCATGG + Intergenic
1191638138 X:63400519-63400541 GGGAGAATGGGGTGGAGCTATGG + Intergenic
1191887928 X:65908410-65908432 GGGGGAATGGTGTGAACCCTGGG - Intergenic
1192907621 X:75568004-75568026 GGGTGCATGTGGTGGAGCCAAGG + Intergenic
1193930658 X:87547109-87547131 ATGAGATTTGGGTGGAGCCTGGG + Intronic
1194088903 X:89562306-89562328 GGGAGAACAGGGTGGAGCCATGG - Intergenic
1194162505 X:90471716-90471738 AGGAGAATGGTGTGAACCCTGGG - Intergenic
1194662538 X:96642885-96642907 GGGAGGATGGGGTGGGGCCTCGG - Intergenic
1194809665 X:98375064-98375086 GGGTGGATGGGATGGGGCCTTGG - Intergenic
1195968214 X:110448467-110448489 GGCAGAGTGGGGTGGGGCATAGG + Intronic
1196385193 X:115141144-115141166 GGGAGAATGGCGTGAACCTTGGG + Intronic
1196652127 X:118178617-118178639 GGGAGCATAGGGTGGCGCCTCGG + Intergenic
1196655515 X:118213612-118213634 GGGAGGATTGCTTGGAGCCTAGG + Intergenic
1197038793 X:121909026-121909048 GGGAGGACGGGGTGGAGCCTTGG + Intergenic
1197162885 X:123343894-123343916 GGGAGAATGGGAAGCAGCATTGG + Intronic
1197300813 X:124778214-124778236 GGGAGGACGAGGTGGAGCCCCGG + Intronic
1197902447 X:131388906-131388928 AGGAGAATGGCGTGAACCCTGGG - Intronic
1197971341 X:132118537-132118559 GGGAGAACAGGGTGGAGCCATGG - Intronic
1198139286 X:133786608-133786630 GGGAGAAGTGAGTGGAGCCATGG + Intronic
1198330350 X:135617133-135617155 GGGGGAAGGGTGTGGAGCCATGG - Intergenic
1198336577 X:135671866-135671888 GGGGGAAGGGTGTGGAGCCATGG + Intergenic
1198480602 X:137036243-137036265 GGAAGTATGTGGTGGAGCTTTGG + Intergenic
1199005712 X:142693736-142693758 GGTAGTATGCGGTGGATCCTGGG + Intergenic
1199110553 X:143928843-143928865 AGGAGAATGGTGTGGAACCCGGG + Intergenic
1199381248 X:147174802-147174824 GGGAGGATGGGGTGGAGCCTTGG - Intergenic
1200441579 Y:3218360-3218382 GGGAGAACAGGGTGGAGCCATGG - Intergenic
1200785800 Y:7259394-7259416 GGGAAAATGGGCTGGAGCCACGG + Intergenic
1201180288 Y:11336018-11336040 GGGATTACAGGGTGGAGCCTCGG - Intergenic
1201704799 Y:16924940-16924962 AGGAGAATGGCGTGAACCCTGGG - Intergenic
1202258981 Y:22949753-22949775 GGGGGAAGGGAGTGGAGGCTTGG - Intergenic
1202270615 Y:23069672-23069694 GGGAAAAGGAGGTGGAGCCATGG - Intergenic
1202295411 Y:23351010-23351032 GGGAAAAGGAGGTGGAGCCATGG + Intergenic
1202411968 Y:24583510-24583532 GGGGGAAGGGAGTGGAGGCTTGG - Intergenic
1202423610 Y:24703416-24703438 GGGAAAAGGAGGTGGAGCCATGG - Intergenic
1202447179 Y:24966669-24966691 GGGAAAAGGAGGTGGAGCCATGG + Intergenic
1202458813 Y:25086562-25086584 GGGGGAAGGGAGTGGAGGCTTGG + Intergenic