ID: 1014674720

View in Genome Browser
Species Human (GRCh38)
Location 6:124349327-124349349
Sequence ACCCCATTCTCCCAGTGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 577
Summary {0: 13, 1: 32, 2: 70, 3: 99, 4: 363}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014674711_1014674720 11 Left 1014674711 6:124349293-124349315 CCCCCCTACAAAGGCGGGAACTT 0: 1
1: 0
2: 2
3: 11
4: 62
Right 1014674720 6:124349327-124349349 ACCCCATTCTCCCAGTGCACAGG 0: 13
1: 32
2: 70
3: 99
4: 363
1014674712_1014674720 10 Left 1014674712 6:124349294-124349316 CCCCCTACAAAGGCGGGAACTTC 0: 1
1: 0
2: 0
3: 1
4: 70
Right 1014674720 6:124349327-124349349 ACCCCATTCTCCCAGTGCACAGG 0: 13
1: 32
2: 70
3: 99
4: 363
1014674713_1014674720 9 Left 1014674713 6:124349295-124349317 CCCCTACAAAGGCGGGAACTTCC 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1014674720 6:124349327-124349349 ACCCCATTCTCCCAGTGCACAGG 0: 13
1: 32
2: 70
3: 99
4: 363
1014674715_1014674720 7 Left 1014674715 6:124349297-124349319 CCTACAAAGGCGGGAACTTCCCG 0: 1
1: 0
2: 1
3: 4
4: 37
Right 1014674720 6:124349327-124349349 ACCCCATTCTCCCAGTGCACAGG 0: 13
1: 32
2: 70
3: 99
4: 363
1014674708_1014674720 17 Left 1014674708 6:124349287-124349309 CCTGCTCCCCCCTACAAAGGCGG 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1014674720 6:124349327-124349349 ACCCCATTCTCCCAGTGCACAGG 0: 13
1: 32
2: 70
3: 99
4: 363
1014674706_1014674720 21 Left 1014674706 6:124349283-124349305 CCAGCCTGCTCCCCCCTACAAAG 0: 1
1: 0
2: 1
3: 20
4: 288
Right 1014674720 6:124349327-124349349 ACCCCATTCTCCCAGTGCACAGG 0: 13
1: 32
2: 70
3: 99
4: 363
1014674714_1014674720 8 Left 1014674714 6:124349296-124349318 CCCTACAAAGGCGGGAACTTCCC 0: 1
1: 0
2: 0
3: 6
4: 65
Right 1014674720 6:124349327-124349349 ACCCCATTCTCCCAGTGCACAGG 0: 13
1: 32
2: 70
3: 99
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014674720 Original CRISPR ACCCCATTCTCCCAGTGCAC AGG Intronic
900727636 1:4228221-4228243 CCCCCTTTCTCCCAGTGTGCAGG - Intergenic
902363272 1:15953965-15953987 ACCCCATGTGCCCAGTGCAAAGG - Intronic
902545368 1:17186435-17186457 ACCCCGTGCTCCCAGGGCAGAGG + Intergenic
903573859 1:24325732-24325754 ATCCCCTCCTCCCAGAGCACTGG + Intronic
903701838 1:25254681-25254703 ACCTCAGCCTCCCAGAGCACTGG + Intronic
903955413 1:27022053-27022075 ACCCCATCTTCCCAGTGGACAGG - Intergenic
905121502 1:35685706-35685728 ACCTCATTCTCCCAAAGTACTGG - Intergenic
905420191 1:37837304-37837326 ACCTCAGTCTCCCAAAGCACTGG + Intronic
905859931 1:41343414-41343436 ACCCCAGCCTCCCAAAGCACTGG - Intergenic
906410270 1:45573373-45573395 ACCCCATTCTCCCAGTGCGCAGG + Intergenic
907023500 1:51092404-51092426 ACCTCATACTCCCAAGGCACTGG - Intergenic
909199360 1:72669974-72669996 ACCCCATTCTCCAAGTACACAGG + Intergenic
910190060 1:84585930-84585952 ACCCCACTCTTCCAGTGCACAGG + Intergenic
910626437 1:89313036-89313058 ACCCCATCCTCCCAGTTCACAGG + Intergenic
911734880 1:101326066-101326088 TCCCCGTCCTCCCAGTGCGCAGG + Intergenic
913030393 1:114897046-114897068 AGCCTGTCCTCCCAGTGCACAGG + Intronic
913103061 1:115587340-115587362 ACCCTGTCCTCCCAGTGCTCAGG - Intergenic
913103623 1:115592726-115592748 ACCCCATCCTCCTACTGCACAGG - Intergenic
914461351 1:147888715-147888737 ACCCCAGCCTCCCAAAGCACGGG - Intergenic
915139816 1:153760449-153760471 CCCCTAATCTCCCAGTGAACGGG + Intronic
915836298 1:159178640-159178662 ACCATCTTCTCCCAGAGCACAGG + Intronic
916047826 1:161013844-161013866 ACCCCATCTTCCCAGTGCAAGGG + Intronic
916125133 1:161563294-161563316 ACCCCTCTCTCTCAGTGCTCAGG + Intergenic
916437596 1:164791348-164791370 ACGCCATCCTACCAGAGCACTGG + Intronic
916638741 1:166703114-166703136 ATCCCATTCTCCCAGTGTGCAGG - Intergenic
916925593 1:169517182-169517204 ATCCCATTCTCCCAGTAAACAGG - Intronic
917098293 1:171421855-171421877 ACCCAGTCCTCCCAGTGCGCAGG + Intergenic
917209402 1:172616224-172616246 AACCTGTTCTCTCAGTGCACAGG - Intergenic
917210057 1:172622047-172622069 ACCTCATTCTCCCAGTGCACAGG - Intergenic
917211511 1:172636547-172636569 ACCGTGTTCTCCCAGTGCATAGG + Intergenic
917267365 1:173235431-173235453 ACCCCATTGTCCCAGTGCACAGG + Intergenic
918011875 1:180594385-180594407 AACACATTCTCCAAGTGCTCGGG + Intergenic
918174916 1:182035296-182035318 ACTCCCTTCCCCCAGAGCACAGG + Intergenic
918175554 1:182041157-182041179 ACCCCTTTCCCCCAGTGCACAGG + Intergenic
920652272 1:207847435-207847457 ACCCCGACCTCCCAGAGCACTGG - Intergenic
921081734 1:211744775-211744797 TCCCCATTCTCCCAATCCAGTGG - Exonic
921901739 1:220458167-220458189 ACCCCATTCTCCCAGTGTGCAGG - Intergenic
923413361 1:233731445-233731467 ACCCCATCCACCCAGTGGGCAGG + Intergenic
1063306695 10:4909285-4909307 ACCTTATTCTCCCAGTGCACAGG - Intergenic
1064002407 10:11674579-11674601 ACCCCATTCTTCCAGTGGGCAGG - Intergenic
1064296248 10:14081452-14081474 ACTCAATTCTGCCACTGCACAGG - Intronic
1064414134 10:15134320-15134342 GCCCCCTGCTCCCAGTGCTCTGG + Intronic
1065882239 10:30046840-30046862 ACCTCAGCCTCCCAGAGCACTGG - Intronic
1065927864 10:30452082-30452104 ACCCCAGCCTCCCAAAGCACTGG - Intronic
1066091030 10:32020671-32020693 ACCCCAGCCTCCCAAAGCACTGG + Intronic
1066241388 10:33539265-33539287 ACCCCATTCTCTCAGTGTGCAGG - Intergenic
1066242578 10:33552484-33552506 ACCCCACCCTCCCAGTGCGCAGG + Intergenic
1066749331 10:38636418-38636440 ACCCCGTAATCCCAGTGCGCAGG + Intergenic
1066967320 10:42281374-42281396 ACCCCGTAATCCCAGTGCGCAGG - Intergenic
1067121398 10:43475029-43475051 ACCTCATTCTCCCAGTGTGCAGG + Intronic
1068014186 10:51494170-51494192 ACCCCACTCTCTCAGTTCACTGG + Intronic
1068055208 10:52004810-52004832 ACCTCAGTCTCCCAGTGTGCTGG - Intronic
1068279835 10:54854421-54854443 ACCTCATTCTTCCTGGGCACAGG - Intronic
1068417713 10:56745664-56745686 ATCCCACTCTCCCAGTTCACAGG - Intergenic
1068428398 10:56898352-56898374 AACCCATTCTCCCAGTGCACAGG + Intergenic
1068648983 10:59500597-59500619 ATCTCAGTCTCCCAGTGCTCAGG - Intergenic
1068878396 10:62022399-62022421 ACCCCATCCTCCCAGTGCACAGG - Intronic
1069713027 10:70502047-70502069 GCCTCAGTCTCCCAGGGCACTGG - Intronic
1069969267 10:72151936-72151958 ACCTCAGTCTCCCAAGGCACTGG + Intronic
1070021148 10:72587221-72587243 ACCTCAGTCTCCCAAGGCACTGG - Intronic
1070406299 10:76100463-76100485 AGCCCTTTCTCCCAGTGTGCAGG + Intronic
1070520211 10:77246087-77246109 ACCTCATCCTGCCAATGCACTGG - Intronic
1071050653 10:81444426-81444448 AGGGCATTCTCCCAGTGCACAGG - Intergenic
1071137766 10:82471315-82471337 ACCCCATTCTCCCAGTGTGCAGG + Intronic
1071885985 10:89951329-89951351 ACCTCATTCTTCCTGGGCACAGG - Intergenic
1072019141 10:91381380-91381402 TCCCCGCTCTCCCAGTGCCCTGG + Intergenic
1072253001 10:93596444-93596466 ACCTCATTCTCGCAGTGCTCTGG - Intronic
1072354811 10:94597780-94597802 ACCCCAGCCTCCCAAAGCACTGG + Intronic
1073143336 10:101263005-101263027 ACACCATTCTCCTAGACCACTGG - Intergenic
1073953476 10:108839071-108839093 TCCCCATTCTCCCAGTGTGCAGG + Intergenic
1074373797 10:112922377-112922399 ACCCCACCCTCCCAAAGCACTGG - Intergenic
1075587640 10:123669100-123669122 AGCCCCTGCTCCCAGTGCCCTGG + Intronic
1076191960 10:128489423-128489445 CCACCATTCTCACAGTGCCCTGG - Intergenic
1076865918 10:133166197-133166219 CCCCCCCTCCCCCAGTGCACAGG - Intronic
1077789638 11:5424512-5424534 CCTCCATCCTCCCAGTACACAGG + Intronic
1078148270 11:8737129-8737151 ACTCTATTCTACCAGTGCTCAGG - Intronic
1078535825 11:12172825-12172847 GCCCCATCCTCCCAGTGCACAGG + Intronic
1078737010 11:14029648-14029670 ACCCCATTCTCCCAGTGCTCAGG + Intronic
1078774940 11:14385212-14385234 ACCCCTTTCCCCCAGTGTGCAGG - Intergenic
1080334065 11:31175391-31175413 ACACCATTCTCCCAAGGAACAGG + Intronic
1080587025 11:33691664-33691686 ACCCCACTTTCCCAGTGGATAGG + Intergenic
1081100626 11:38997266-38997288 ACTCCATCCTCCCAGTGCTCAGG + Intergenic
1081634237 11:44710236-44710258 ACTCCATCCTTCCAGTGCTCTGG - Intergenic
1083351827 11:62034925-62034947 ACCCCAGTCTCCCAGGGAGCTGG - Intergenic
1085723887 11:78937205-78937227 TACCCACTCTCCCAGTGCAAAGG + Intronic
1085987518 11:81805021-81805043 TCCCCATTCCCACAGAGCACAGG - Intergenic
1087120055 11:94564253-94564275 ACCCCATTCTCCCAGTGTGCAGG + Intronic
1087258259 11:95980976-95980998 ACCCTGTCTTCCCAGTGCACAGG - Intronic
1087470028 11:98561503-98561525 ACCCCATTATCCCAGTGAGCAGG - Intergenic
1087840101 11:102911734-102911756 ACCCCGTTCTCCCAGTGCGCAGG - Intergenic
1087850570 11:103023604-103023626 ACCTCAGCCTCCCAATGCACTGG + Intergenic
1088559375 11:111097340-111097362 ACCCCGTTCTCCCAGTGCAAAGG + Intergenic
1089591954 11:119547317-119547339 ACCCCATTCTTCCTGGTCACAGG + Intergenic
1089655575 11:119944473-119944495 ACCCCATTCTCCCAACCCCCAGG - Intergenic
1090706124 11:129338662-129338684 TCCCTGTTCTCCCAGTACACAGG - Intergenic
1090760610 11:129833881-129833903 AACCCATTCTGCCAATGCATTGG + Intronic
1090960808 11:131555045-131555067 ACCTCATACTCCCAAAGCACTGG - Intronic
1091489994 12:924669-924691 ACCCCATTCTCCAAAGGCAAAGG + Intronic
1092563046 12:9636851-9636873 ACCCCATCCTCCCAGTGCACAGG + Intergenic
1093120009 12:15258055-15258077 ACCCTTTTATCCCAGAGCACAGG + Intronic
1094003190 12:25718527-25718549 ACCCCATCCTCCCAGTGTGAAGG - Intergenic
1094443627 12:30506559-30506581 GCCCCATCCTCCCAGTGCACAGG - Intergenic
1094472568 12:30817235-30817257 GCCCCATCCTCCCAGTGCACAGG - Intergenic
1095345282 12:41142536-41142558 ACCCCATTTTTCCAGTGTACAGG + Intergenic
1095765300 12:45887775-45887797 ACCCCGTCCTTCCAGTGCAGAGG + Intronic
1095878775 12:47109709-47109731 ACCCCCTTCTCTCCTTGCACAGG - Intronic
1096588227 12:52638315-52638337 TCCCTATACTCCCAGTGTACTGG - Intergenic
1096928182 12:55172889-55172911 CACTCATTCTCCCAGTGCCCAGG - Intergenic
1097367141 12:58729432-58729454 ACCTCATCCTCCCAAAGCACTGG - Intronic
1097514298 12:60585229-60585251 CACCCATTCTCCCAGTGTGCAGG + Intergenic
1097646984 12:62248216-62248238 ACCCCATTGTCCCAGTGCAGGGG + Intronic
1097691521 12:62738845-62738867 ATCCCTCTCTCCCAGTGCAGAGG + Intronic
1098643859 12:72873140-72873162 ACCCTGTCCTCCCAGTGCGCAGG - Intergenic
1098947844 12:76608266-76608288 ACCCCACTCTCCCAGTGCGCGGG + Intergenic
1099973452 12:89524316-89524338 CCCCCACTCCCCAAGTGCACGGG + Exonic
1100272236 12:93037517-93037539 ACCCCGTCCTCCCAGTGTGCAGG + Intergenic
1100301729 12:93314219-93314241 GCCTCAGTCTCCCAATGCACTGG + Intergenic
1101852219 12:108412810-108412832 ACCTCAGCCTCCCAGAGCACTGG - Intergenic
1103894556 12:124264478-124264500 TCCCCATTCGCCCAGTTCCCTGG + Intronic
1107517538 13:41145716-41145738 ACCCCATCTTCCCAGTGCACAGG - Intergenic
1107852843 13:44588290-44588312 ATCCTATTCTCCCAGTGTGCAGG - Intergenic
1108167607 13:47709546-47709568 ATCCCATTCCCCCAGTGCTCAGG - Intergenic
1108871171 13:54988170-54988192 ACCCCATTCTCCCAGTGTGCAGG + Intergenic
1108940419 13:55946781-55946803 ACCCCACTCTCCCAGTGCATAGG - Intergenic
1109863635 13:68232947-68232969 ACCCCATCCTCCCAGTGCACAGG + Intergenic
1111365300 13:87235066-87235088 CCCCCATCCTTCCAGTCCACTGG + Intergenic
1111696922 13:91636703-91636725 ACCTCAGTCTCCCAAAGCACTGG - Intronic
1112015348 13:95326864-95326886 ACCCCATTCTCCCAGTGTACCGG - Intergenic
1112260709 13:97875450-97875472 ACCCCACTCTCCCAGTGCGCAGG + Intergenic
1112286144 13:98106121-98106143 ACCCTATTGTCCCAGCACACAGG + Intergenic
1112774655 13:102830910-102830932 ACCCCATCCTCCCAGCACGCAGG + Intronic
1113338696 13:109401433-109401455 ACCCCATTCTCCCAGGGCGCAGG - Intergenic
1113726104 13:112603473-112603495 ACCTCAGTCTCCCAAAGCACTGG - Intergenic
1113929327 13:113958037-113958059 ACCCCTTTCATCAAGTGCACCGG + Intergenic
1116594178 14:46819287-46819309 ACCCGGTTCACCCAGTGCACAGG - Intergenic
1117877974 14:60275719-60275741 ACCTCAGTCTCCCAAAGCACTGG + Intronic
1117903897 14:60564892-60564914 ACCCCATGTTCACAGTGCAGTGG + Intergenic
1118137556 14:63045807-63045829 ACCCTCTTCTCCCATTCCACCGG - Intronic
1118378021 14:65193578-65193600 ACCCCGTTCTCCCAGTGCACAGG + Intergenic
1118395838 14:65335780-65335802 ACCCTGTTCTCCCAGTGCGCAGG + Intergenic
1118486966 14:66223553-66223575 ACCCCATCCTCCCAGTGTGCAGG + Intergenic
1118550585 14:66945343-66945365 ACCCCATCCTCCCAGTGTGCAGG + Intronic
1119329151 14:73781084-73781106 ACCCCATTCTCCATTTCCACTGG - Intronic
1119499386 14:75110802-75110824 CCCCAATTCTCCCAGTCAACTGG + Intronic
1119973407 14:78998269-78998291 ACCCTAATCTCACAGTGCAAAGG - Intronic
1120153583 14:81065224-81065246 ACACACTTCTCCCAGGGCACAGG + Intronic
1120164937 14:81187521-81187543 TCCCCATTCTCCCTGTCCCCTGG + Intronic
1120296044 14:82642547-82642569 ACCCCATTCTCCCAGTGCGCAGG - Intergenic
1120969575 14:90196189-90196211 ACCCCGTCCTCCCAGTGTGCAGG - Intergenic
1121486215 14:94317402-94317424 ACCCCATTCTCCCAGTGTGCAGG - Intronic
1122031658 14:98916661-98916683 ACCCCAACTTCCCTGTGCACTGG + Intergenic
1122611982 14:102990912-102990934 ACCCCTTTCTCCCTGTGTATTGG - Intronic
1122812039 14:104293872-104293894 ACCCCATCCTCCCAAAGCAAAGG + Intergenic
1122858402 14:104571144-104571166 GCCCCACTCTCCCAGTTCCCCGG - Intronic
1122860533 14:104580457-104580479 AGCCCCTTCTCCCACTGCCCAGG - Intronic
1122936215 14:104957550-104957572 CCCCCATTCTCCCTGGGCCCTGG - Intronic
1123777661 15:23596854-23596876 ACCCCGCCCTCCCAGTGCTCAGG + Intronic
1124844420 15:33276364-33276386 ACACCATTCTGCCACTGCAGGGG + Intergenic
1128920186 15:71603405-71603427 ACCCCGTTCTCCCAGTGCAGAGG + Intronic
1130658567 15:85811344-85811366 ACCTCATCCTCCCAAAGCACTGG - Intergenic
1131300320 15:91194039-91194061 AACCCATCATCCCAGTGCCCTGG - Intronic
1131885070 15:96903723-96903745 ACCCCATTCTCCCAGTGCCAGGG - Intergenic
1202948532 15_KI270727v1_random:9462-9484 ACCTCATCCTCCCAAAGCACTGG - Intergenic
1132862572 16:2078845-2078867 ACCACATTGTCCCAGAGAACGGG - Intronic
1134353522 16:13460197-13460219 ACCCCCATCTCCCAGAGGACAGG - Intergenic
1134502203 16:14777984-14778006 ACCTCAGTCTCCCAAAGCACTGG - Intronic
1134578357 16:15350908-15350930 ACCTCAGTCTCCCAAAGCACTGG + Intergenic
1134724232 16:16406636-16406658 ACCTCAGTCTCCCAAAGCACTGG - Intergenic
1134943198 16:18305233-18305255 ACCTCAGTCTCCCAAAGCACTGG + Intergenic
1135048769 16:19175402-19175424 ACCTCAGTCTCCCAAAGCACTGG - Intronic
1135233968 16:20738729-20738751 ACCCCATTCTACCTCTCCACAGG + Intronic
1135398832 16:22151620-22151642 ACCTCAGTCTCCCAAAGCACTGG - Intronic
1135764719 16:25167559-25167581 ACCCCAGTCTCCCAAAGCCCTGG + Intronic
1135788094 16:25368390-25368412 ACCCCATTCTCCCAGTGTGCAGG - Intergenic
1135927296 16:26706789-26706811 ATCCCACTCTCCCAGTGCCAAGG - Intergenic
1136733385 16:32440715-32440737 ACCCCGTAATCCCAGTGCACAGG - Intergenic
1136946006 16:34652049-34652071 ACCCCAGCCTCCCAAAGCACTGG + Intergenic
1137521859 16:49201662-49201684 ACTCCATCCTGCCTGTGCACTGG + Intergenic
1138787993 16:59869182-59869204 GCCCCATTCTCCCAGTGTGCAGG + Intergenic
1139625764 16:68187432-68187454 ACCTCATTCTTCCTGGGCACAGG - Intronic
1139675055 16:68517779-68517801 ATCCCATTCTCCGAGTGGCCTGG + Intergenic
1140840434 16:78833294-78833316 ACCTCATTCTCTCAAAGCACTGG + Intronic
1141248912 16:82337177-82337199 ACTCCATTCTCCCATTTAACTGG + Intergenic
1141330729 16:83108567-83108589 ACCCCATCCTCCCAGTGCACAGG + Intronic
1203019698 16_KI270728v1_random:388887-388909 ACCCCGTAATCCCAGTGCACAGG + Intergenic
1203038033 16_KI270728v1_random:662045-662067 ACCCCGTAATCCCAGTGCACAGG + Intergenic
1143368261 17:6422414-6422436 ACCCCATCTTCCTAGTGCAGAGG - Intronic
1143694385 17:8600795-8600817 AACCCTATCTCCCAGTGCATAGG + Intronic
1144143798 17:12377326-12377348 ACCCCATCCTCCCAGTGTGCAGG + Intergenic
1144228527 17:13175432-13175454 AACCCATTCTCCCAGTGCACAGG - Intergenic
1145925402 17:28643219-28643241 GCCCCATTCTCCCAGAGCGCTGG - Exonic
1146015243 17:29227894-29227916 ACCTCAGTCTCCCAAAGCACTGG - Intergenic
1146479699 17:33195169-33195191 ACCCCAACCTCCCTGAGCACAGG + Intronic
1147006268 17:37406706-37406728 GCCCCATCCTCCCAGTCCTCGGG + Intronic
1147195304 17:38762577-38762599 ACCCCATTTTCCCAGCCCCCTGG + Intronic
1147625852 17:41899446-41899468 AGCCCATTCCCCCAGGGCTCTGG + Intronic
1149102355 17:52922028-52922050 ACCCCATCCCCCCAATGCACAGG + Intergenic
1149494852 17:57110926-57110948 ACCGCATTCTCCCAGGGCCCTGG + Intronic
1150839132 17:68591725-68591747 CCCCCATCCTCCCAGTGCGCAGG - Intronic
1151754467 17:76065198-76065220 ACCTCAGCCTCCCAGTGTACTGG - Intronic
1152065182 17:78108503-78108525 ACCTTGTTCTCCCAGCGCACAGG - Exonic
1152229981 17:79109612-79109634 ACCCCACCCTCCCATTGGACAGG + Intronic
1152387593 17:79984254-79984276 ACCTCAGTCTCCCAAAGCACTGG + Intronic
1152694945 17:81739360-81739382 AGCCCATTCTCCCACTGTCCTGG + Intergenic
1153039075 18:793584-793606 ACCTCAGTCTCCCAAAGCACTGG + Intronic
1155623936 18:27813095-27813117 ACCCCATCCTCCCGGTGCACAGG + Intergenic
1156972293 18:43170923-43170945 ACCCCATTCTCCCAGTGCTCAGG - Intergenic
1157057023 18:44241984-44242006 AACACAGTCTCCCAGAGCACAGG + Intergenic
1157200059 18:45652428-45652450 ACCCCCTTCTACCGCTGCACAGG + Intronic
1157497972 18:48170130-48170152 ACCCCATCACCCCAATGCACAGG - Intronic
1157859657 18:51129418-51129440 ACCCTCTTCTCTCAGTGCACAGG - Intergenic
1158968237 18:62642526-62642548 ACCTCATCCTCCCAGTGCGCAGG + Intergenic
1159357022 18:67349500-67349522 ACCACGTCCTCCCAGTGCACAGG + Intergenic
1160844827 19:1161562-1161584 ACCCCCAGCTCCCAGTGCTCAGG - Intronic
1161217236 19:3100615-3100637 ACCCCTTCTGCCCAGTGCACAGG - Intronic
1162539741 19:11287577-11287599 ACCTCACTCTCCCAAAGCACTGG + Intergenic
1164037977 19:21470429-21470451 CCTCCATTCTCCCAGTACAGTGG - Intronic
1164203086 19:23034446-23034468 GCCCCATCCTCCCAGTGCATAGG + Intergenic
1164406778 19:27955640-27955662 ACCCCATTCTCCCAGTGCACAGG - Intergenic
1164439147 19:28258794-28258816 ACCCTGCTCTCCCATTGCACAGG - Intergenic
1164810854 19:31154722-31154744 ATCCCATCCTCCCAGTGTGCAGG + Intergenic
1164972786 19:32546790-32546812 ACCCCAGTCTCCCAGGGTGCTGG + Intergenic
1165390077 19:35533748-35533770 ACCCCACTCTGCCAGCACACTGG - Intronic
1165456727 19:35916121-35916143 ACCTCATTCTCCCAAAGCCCTGG + Intergenic
1166120698 19:40684626-40684648 ACCCCATGCTCCCTGAGCACTGG - Intronic
1166329213 19:42069139-42069161 ACCACATTCTCCCCGTTCTCCGG - Intronic
1166854091 19:45774199-45774221 ACCTCATCCTCCCAAAGCACTGG + Intronic
1167399187 19:49253660-49253682 ACCTCGGTCTCCCAGTGTACTGG + Intergenic
1167443264 19:49522323-49522345 ACCTCATTCTCCCAAAGCGCTGG + Intronic
925175026 2:1776856-1776878 ACCCCACCCTCCCAAAGCACTGG + Intergenic
925908422 2:8554249-8554271 ACCGCATTTTCCCAGGGCATTGG + Intergenic
926754817 2:16226397-16226419 ACCCCGTTCTGCCCGAGCACAGG - Intergenic
928326411 2:30322960-30322982 GCCCTCTTCTCCCAGGGCACAGG + Intronic
928833485 2:35517310-35517332 ACCCCACTCTCCCAGTGCATAGG + Intergenic
929115715 2:38442234-38442256 ACCCTGTTCTCCCAGTGCACAGG - Intergenic
929238020 2:39626871-39626893 ACCCTGTTCTCCCTGTGCACAGG + Intergenic
930630759 2:53752495-53752517 ACCCCATTCTTCCAGTGCACAGG + Intronic
931470982 2:62537370-62537392 ACCCCAGTCTCTCAGTGTGCAGG - Intergenic
932046775 2:68357801-68357823 ACTCCATCCTCCCAGTGCACAGG + Intergenic
932368252 2:71166818-71166840 CCCCCAGTCTCCCAGACCACTGG + Intergenic
932547740 2:72732409-72732431 ACCTCATCCTCCCAAAGCACTGG + Intronic
933310296 2:80652249-80652271 ACCCCATCCTCCCAGTGTGCAGG + Intergenic
933495542 2:83046172-83046194 ACCCATTTCTCCCAGTGTGCAGG + Intergenic
933541415 2:83647705-83647727 ACCCCATTCTCCCAGTGCGCAGG - Intergenic
933722537 2:85407461-85407483 ACCTCAGTCTCCCAGTGTGCTGG - Intronic
933777506 2:85779888-85779910 ACCCCATCCTCCCAGGGCCTGGG - Intronic
934312324 2:91878536-91878558 ACCCCGTAATCCCAGTGCGCAGG + Intergenic
934931528 2:98429649-98429671 ACCCGGTTCTCCCAGTGCACAGG - Intergenic
934932377 2:98436940-98436962 ACCCTGTTCTCCCAGTGTGCAGG - Intergenic
936733246 2:115408295-115408317 ACCCCAATCTCCCAGTGCGCAGG + Intronic
937289147 2:120771557-120771579 ACACTACTCTCCCAGAGCACTGG - Intronic
938850899 2:135258339-135258361 ACCACATCCTCCCAATGCACAGG - Intronic
939952939 2:148497436-148497458 ACCCCAGACTCCCAAAGCACTGG - Intronic
940116991 2:150219971-150219993 ACCCCGTCCTCCCAGTGTGCAGG + Intergenic
940391095 2:153133333-153133355 ACCCCATCCTCCCAGTGCATAGG - Intergenic
940694206 2:156958955-156958977 ACCTCATTCTTCCTGTACACGGG - Intergenic
942585705 2:177474499-177474521 ACCCCACTCTTCCAGTGCACAGG + Intronic
943109957 2:183592552-183592574 ATCCCATTCTCCCAGTGCACAGG - Intergenic
943149787 2:184097707-184097729 ACCCCATTCTCCCCATGCCCAGG - Intergenic
944960114 2:204862994-204863016 ACCCCGTCCTCCCAGTGTGCAGG + Intronic
945468636 2:210201088-210201110 ACCCCGTCCTCCCAGTGCACAGG - Intronic
945770352 2:214034931-214034953 ACCTCATTCTTCCTGGGCACAGG - Intronic
946165305 2:217859945-217859967 ACCCAATTCTCAGAGTGGACAGG + Intronic
946597021 2:221317147-221317169 ACCCCCTTCCCCAAGTGCAATGG - Intergenic
946652961 2:221913923-221913945 ACCCCATCCTCCCAGTGCACAGG + Intergenic
947136268 2:226979485-226979507 ACCCCATCCTCCCATTGCACAGG + Intronic
948784015 2:240341475-240341497 TCCACATTCTCCGAGTGCTCTGG - Intergenic
948788440 2:240365094-240365116 ACTACATTCTCCCAGGGAACTGG + Intergenic
948981004 2:241494716-241494738 GCCCCACCCTCCCAGGGCACAGG - Exonic
1169088025 20:2839340-2839362 ACCCCATTTTCCCAGGGCTGAGG + Intronic
1170305331 20:14931746-14931768 ACCTCATCCTCCCAAAGCACTGG - Intronic
1170335677 20:15267750-15267772 GTCCCATCCTCCCAGTGCTCAGG - Intronic
1170947000 20:20900473-20900495 ACCCCACTCTCCTAGTGCTCAGG + Intergenic
1171100333 20:22377125-22377147 ACCACATTCACCCAGTCCCCTGG + Intergenic
1171325349 20:24286528-24286550 ACCCCATTGCCTCAGTGCAAAGG - Intergenic
1171933335 20:31248374-31248396 ACCCCACCCTCCCAGTGCACCGG + Intergenic
1172046961 20:32087063-32087085 AGCCCCTTCTCCCATTGCCCAGG - Intronic
1172365196 20:34343716-34343738 ACCCTGTTCTTCCAGTGTACAGG - Intergenic
1173933400 20:46840326-46840348 AGCCCATTGTCCCAGTCCACAGG - Intergenic
1174535908 20:51251371-51251393 ACCCCATTCTCCCAGTGTGCAGG - Intergenic
1174544129 20:51312584-51312606 ACCCCATCCTCCCAGTGCTCAGG + Intergenic
1174677419 20:52371878-52371900 ATGCCAGTCTCCCACTGCACAGG + Intergenic
1175138619 20:56843197-56843219 ACCTCATTCTCCCTGGGCATGGG + Intergenic
1176886425 21:14261336-14261358 ACTCTGTCCTCCCAGTGCACAGG - Intergenic
1176907498 21:14520723-14520745 GTCCCCTTCCCCCAGTGCACAGG - Intronic
1176972343 21:15281164-15281186 ACAGCATTCTCCCAGCGCACTGG + Intergenic
1176991228 21:15498695-15498717 GCCCCATTCTCACAGTAAACAGG + Intergenic
1177349909 21:19924175-19924197 ACCCAATTCTCTCAATTCACTGG + Intergenic
1177405515 21:20662702-20662724 ACCCCATTCTCCCAGTGCTCAGG - Intergenic
1177414394 21:20775864-20775886 ACCCCACTCTCCCAGTGCACAGG + Intergenic
1177414822 21:20780118-20780140 AACCCATTCTCCCAGTGTGCAGG + Intergenic
1177568031 21:22848415-22848437 ACCCTATTCTCCCCGTGTGCAGG + Intergenic
1178690318 21:34744885-34744907 ACCTCAGCCTCCCAGAGCACTGG + Intergenic
1179009321 21:37543424-37543446 ACCTCAGTCTCCCAGAGTACTGG + Intergenic
1179447279 21:41441074-41441096 CCCCCATTCTCACCGAGCACAGG - Intronic
1179447287 21:41441103-41441125 CCCCCATTCTCACCGAGCACAGG - Intronic
1179447295 21:41441132-41441154 CCCCCATTCTCACCGAGCACAGG - Intronic
1179889530 21:44328581-44328603 GTCCCATTCACCCAGTTCACAGG - Intergenic
1179956190 21:44740438-44740460 ACCCCATTCTCCCAGTGCACAGG - Intergenic
1180153143 21:45962735-45962757 ACCCCATTCTCCCAGTGCACAGG + Intergenic
1180539081 22:16424371-16424393 ACCCCGTAATCCCAGTGCGCAGG + Intergenic
1182645936 22:31809401-31809423 AGTCCATTCCCCCAGTGGACAGG + Intronic
1183961613 22:41414642-41414664 ACCGCATGCTCCCAGGGCAAAGG - Intergenic
1184702886 22:46188729-46188751 ACCCCCCTGTCCCAGTGCACTGG + Intronic
1184704827 22:46203774-46203796 ACCCCATTCTCCCAATGCCCAGG + Intronic
1184905576 22:47483640-47483662 ACCCCGTCCTCCCAGTGTGCAGG + Intronic
1185094053 22:48796374-48796396 ACTCCATTGTCCAGGTGCACCGG - Intronic
949470750 3:4393580-4393602 ACCTCAGTCTCCCAAAGCACTGG + Intronic
949752806 3:7374426-7374448 ACCTCAGCCTCCCAGAGCACTGG + Intronic
950177926 3:10888938-10888960 ACCCCACTCCCACAGTGCCCAGG - Intronic
950261041 3:11543648-11543670 ACCTCAGTCTCCCAAAGCACTGG - Intronic
951845422 3:27079606-27079628 ACTCCATTCTCCCAGTGCTCAGG + Intergenic
952325031 3:32313279-32313301 ACCCTGTTCTCCCAGTGCTCAGG - Intronic
952884276 3:38003082-38003104 ACCCCATACACCCTGTGAACGGG + Intronic
953270848 3:41442706-41442728 ACCTCAGTCTCCCAAAGCACTGG + Intronic
953436290 3:42880625-42880647 TCCCCCTTCTCCGAGTGCCCTGG - Intronic
953437031 3:42885808-42885830 ACCCCAGTCTCCCAGTGCACAGG + Intronic
953441118 3:42918441-42918463 ACCCCGTTCTCCCAGTGTGCAGG + Intronic
954165257 3:48751919-48751941 TCCCCATTCTCCCACAGCCCTGG + Intronic
955158018 3:56436545-56436567 ACCCCCTACTCACAGTTCACTGG + Intronic
956048510 3:65222256-65222278 ACCCCATTCTCCCCCTGCCCCGG + Intergenic
958047940 3:88307828-88307850 ACCCCGTCCTCCCAGTGCGCAGG - Intergenic
958536187 3:95407785-95407807 ACCCCATTCTTCCAGTGCACAGG - Intergenic
958536698 3:95412660-95412682 ACCCCCTTCTCCCAGTGTGCAGG - Intergenic
958974686 3:100654140-100654162 ACCCCGTTCTCCCAGTGCGCGGG + Intronic
959190353 3:103103369-103103391 ACCCCAGGCTCCCAGTGGAATGG + Intergenic
959572936 3:107904903-107904925 ACCCCATCCTCCCAGTGTGCAGG + Intergenic
959574020 3:107914745-107914767 ACCCCGTCCTCCCAGAGCACAGG - Intergenic
959660606 3:108863949-108863971 ACCCTGTCCTCCCAGTGCGCAGG + Intergenic
960618703 3:119619217-119619239 TCACCATGCTCCCACTGCACGGG + Intronic
960925372 3:122790730-122790752 ACCTCAGCCTCCCAGAGCACTGG - Intronic
961025261 3:123550181-123550203 ACCCCATTCTCCCATGCCCCAGG + Intronic
961081861 3:124034087-124034109 ACCGCCTTCTCCCAGAGCGCGGG + Intergenic
962126711 3:132627137-132627159 ACCCCATTCCCCCAGTGTGCAGG - Intronic
962582606 3:136811899-136811921 ACCCCATTCTCTCAGTGCACAGG + Intergenic
962835772 3:139187076-139187098 ACCCCTTTATCCCAGACCACAGG - Intronic
962956848 3:140274550-140274572 TCTCAATTCTCCCAGTGCCCCGG - Intronic
963435467 3:145260032-145260054 ACCCCATTCTCCCAGTGTGCAGG + Intergenic
965247442 3:166291916-166291938 ATCCGATTCTTCCAGTACACTGG - Intergenic
965594517 3:170397480-170397502 ACCCCAGACTCCCAAAGCACTGG - Intergenic
965744484 3:171909975-171909997 ACCTCCATCTCCCAGAGCACTGG + Intronic
966466508 3:180235653-180235675 ACCACATTTTCCTGGTGCACAGG - Intergenic
966611072 3:181868397-181868419 ACCCCAGTCTCCCAGAGTGCTGG + Intergenic
966840201 3:184081890-184081912 ACCTCATTCTTCCAGGACACAGG + Intergenic
967293628 3:187945159-187945181 TGCCCATTCTCCCACTGCCCAGG - Intergenic
967531031 3:190549246-190549268 ACCCCATTCTCCCAGTGCGCAGG + Intronic
967546237 3:190732074-190732096 ACCCTGTTCTCCCAGTGCACAGG + Intergenic
967555365 3:190850466-190850488 TCCCCATCTTCCCAGTGCACAGG - Intergenic
967827574 3:193890372-193890394 ACCCAAACCTCCCAGGGCACAGG + Intergenic
968286690 3:197513120-197513142 ACCACACTCTCCCAGTGCCCAGG - Intronic
968380906 4:95027-95049 ATCCCATTCCCCCAGTGCACTGG - Intergenic
968565376 4:1309784-1309806 ACCCTTTGCTCCCAGTGCAAGGG - Intronic
969111165 4:4845186-4845208 GCCCCATTCTCCCAGAGCTACGG + Intergenic
970721303 4:18992543-18992565 ACGCACTCCTCCCAGTGCACAGG - Intergenic
970729896 4:19090368-19090390 ACTCCATTCTCGCAGTGCGCAGG - Intergenic
971326193 4:25645880-25645902 ACCTCATCCTCCCAGGGTACTGG + Intergenic
971572409 4:28230195-28230217 ACCTCATTCTCCCAGTGCCCAGG - Intergenic
973571112 4:52240668-52240690 ACCCCATTAGCCCAGTTCATTGG - Intergenic
974256332 4:59459572-59459594 TCCCGGTACTCCCAGTGCACAGG + Intergenic
974618522 4:64323518-64323540 ACACCATTCTCCCGGTGCTTTGG - Intronic
975228199 4:71899341-71899363 ACCCACTCCTCCCAATGCACGGG - Intergenic
975756706 4:77578512-77578534 ACCCCATTCTCCCAGTGCACAGG - Intronic
976316382 4:83663628-83663650 ACCCTGTTCTCCCAGTGCGCAGG + Intergenic
976345419 4:83994102-83994124 GCTCATTTCTCCCAGTGCACAGG - Intergenic
976724522 4:88202655-88202677 ACCCCGTTCTCCCAGTGTACAGG + Intronic
976751560 4:88455470-88455492 ACCCCACTCTCCTGGTGCAGTGG + Intergenic
976862421 4:89681405-89681427 ACCCCACTCTCCCGGTACGCAGG - Intergenic
977054590 4:92175471-92175493 ACCCTATTCTCCCAGGGTGCAGG + Intergenic
977645875 4:99410706-99410728 ACCTCATTCTTCCAGTTCGCAGG - Intergenic
977823426 4:101502580-101502602 ACCCCAGTCTCCCAGGGCTCAGG - Intronic
977891835 4:102321365-102321387 ATCCTATTCTCCCACTGCTCAGG - Intronic
977944521 4:102896570-102896592 ACCCCGTAATCCCAGTGCACAGG + Intronic
978328512 4:107586486-107586508 ACCCCATCCTCCCAGTGTGCAGG + Intergenic
978663369 4:111154221-111154243 ACCTCATTCTTCCAGGACACAGG - Intergenic
979104192 4:116663901-116663923 ACCCTGCTCTCCCAGTGCGCAGG - Intergenic
979600975 4:122586260-122586282 ACCCGATTCTCCCAGGATACTGG + Intergenic
979624948 4:122834229-122834251 ACCCCATTCTCCCAGTGTGCAGG + Intronic
980253574 4:130349048-130349070 ACCTCATTCTCCCTGGACACGGG - Intergenic
980339869 4:131531452-131531474 ATCCCATCCTCCCAGTGCATAGG + Intergenic
980795511 4:137677237-137677259 ACTCCATCATCCCAGTGCACAGG + Intergenic
981189958 4:141851169-141851191 ACTCCGTCCTCCCAGTGCACAGG - Intergenic
981208620 4:142073891-142073913 ACCTCATTTTCCAAGTGCAAAGG + Intronic
981212524 4:142124753-142124775 ACCCCCTTCCCCCAGAGGACTGG - Exonic
981455970 4:144953785-144953807 GCCTTGTTCTCCCAGTGCACAGG - Intergenic
981456869 4:144962635-144962657 ACTTCATTCTCCCAGTGCACAGG - Intergenic
981770051 4:148298950-148298972 ACCCCATTCTCCCACTGCACAGG - Intronic
981770753 4:148304762-148304784 ACCGCATTCTCCCAGTGCTCAGG - Intronic
982055176 4:151541969-151541991 AACCCATCCTCCCAGTGCACAGG - Intronic
982477537 4:155872176-155872198 ATCCCATCCTCCCAGTGCACAGG + Intronic
982526637 4:156487318-156487340 ACCCCATTCTCCCAGTGCACAGG - Intergenic
984219112 4:176951802-176951824 ACCCCAACCTCCCAGTGCACAGG + Intergenic
984387721 4:179084694-179084716 ACCCCATTACCCCAGTGCCTAGG + Intergenic
984512773 4:180698977-180698999 ACCCCATTCTCCCAGTGCACAGG - Intergenic
984757983 4:183342008-183342030 AGCCCATTGTGCCACTGCACTGG - Intergenic
985224929 4:187750181-187750203 ACCCCAGCCTCCCAGAGTACTGG + Intergenic
986778102 5:11038143-11038165 ACACCATCCTCCCAGGACACTGG + Intronic
988304583 5:29478710-29478732 ACGCCCTTCTCCCACTGCACAGG - Intergenic
989438144 5:41438447-41438469 ACCCCATTCTCCCAGCGTGCAGG - Intronic
989520727 5:42397021-42397043 ACCTCATTCTCCCTGGACACAGG + Intergenic
989715106 5:44453956-44453978 ACCCTCTTCCCCCAGTGCACAGG + Intergenic
990249070 5:53894345-53894367 AACCCAGTCTTCCAATGCACGGG + Intronic
990444902 5:55885540-55885562 ACCCCATTCTCCCAGTGCACAGG + Intronic
990639191 5:57762452-57762474 ACCTCATTCTTCCTGGGCACAGG + Intergenic
990777099 5:59314946-59314968 ACCCCATCGTCGCAGTGCACAGG - Intronic
990843904 5:60115128-60115150 ACCACATTCTGTCAGTACACTGG - Intronic
990878823 5:60517788-60517810 ACCTCATTCTTCCAGGACACAGG + Intronic
991259522 5:64651705-64651727 ACCTCATTCTCCCAAAGCACTGG + Intergenic
992426494 5:76663052-76663074 ACCCCATTCTCCCATAGCTGGGG - Intronic
993067554 5:83118414-83118436 ACCTCAGTCTCCCAAAGCACTGG + Intronic
993094500 5:83465742-83465764 AGCCCAGTCTGCCTGTGCACAGG + Intergenic
993728690 5:91397296-91397318 ACTCCATCCTCCCAATGCACAGG + Intergenic
994063607 5:95509499-95509521 ACCCGGTTCTCCCAACGCACAGG + Intronic
994913151 5:105939199-105939221 ACCCCATTCTCACAGTGAGCAGG + Intergenic
995384636 5:111575328-111575350 AACACATTTTCCCAGTGCTCTGG + Intergenic
995470907 5:112501173-112501195 ACTCTGTCCTCCCAGTGCACAGG - Intergenic
996278167 5:121693991-121694013 ACCCTGTTCTCCCATTGCACAGG + Intergenic
996677020 5:126188057-126188079 ACCCCAACCTCCCAGAGCGCAGG - Intergenic
996709028 5:126525734-126525756 ACCCCATCCTCCCAGTGTGCAGG - Intergenic
996955422 5:129177618-129177640 ACCTCATTCTCCCAGTATGCAGG + Intergenic
997826582 5:137112038-137112060 ACCCCTTCCTTCCACTGCACTGG + Intronic
998641171 5:144013032-144013054 ACCCTGTTCTCCCAGGACACAGG + Intergenic
1000241807 5:159415711-159415733 ACCCCGTTCTCCCAGTGAGCAGG - Intergenic
1001822125 5:174718637-174718659 ACCCCCTTCTCCCAGTTGCCTGG - Intergenic
1002691681 5:181054310-181054332 AGCCCCTCCTCCCACTGCACAGG - Intronic
1003689467 6:8338356-8338378 AAACCATTCTCCCTTTGCACAGG + Intergenic
1003913536 6:10764491-10764513 AGCCCATTCCCTCAGTGCATGGG - Exonic
1003963271 6:11229132-11229154 ACCCCATTCAACCAGAACACAGG + Intronic
1004009040 6:11663745-11663767 ATCCCATTCTTTCAGTGCTCAGG + Intergenic
1005042068 6:21608857-21608879 ACCCCGTTCTCCCACTGGGCAGG - Intergenic
1005048358 6:21663341-21663363 ACCCCACTTTGCCAGTGCAGAGG - Intergenic
1005055215 6:21722703-21722725 ACCCTATCCTCCCAGTGCACAGG + Intergenic
1005564651 6:27078804-27078826 ACCCCCTTTTCCCAGTGCACAGG - Intergenic
1005766136 6:29014091-29014113 AACCCATTCTTCCAGTGGGCTGG - Intergenic
1005981581 6:30840855-30840877 ACCCCATTTTCCCAGTATGCAGG + Intergenic
1006365560 6:33613181-33613203 ACCTCATTCTCCCAGAGTGCTGG + Intergenic
1006483253 6:34316111-34316133 ACCTCAGTCTCCCAAAGCACTGG + Intronic
1007076048 6:39066806-39066828 CCCCCCTTCTCCAAGTGCAGAGG - Intronic
1007350832 6:41272368-41272390 ACCCCAGTCTCCCTGTGAAATGG + Intronic
1009632345 6:66214870-66214892 ACCCCACTCTCCCAGTGTGCAGG - Intergenic
1010541248 6:77094758-77094780 ACCCCCTCCTCCTAGTGTACAGG - Intergenic
1011882379 6:92045773-92045795 ACCCCATTCTCCCAGTGCACAGG - Intergenic
1012570885 6:100726921-100726943 ATGCCATTTTCCCAGTGGACAGG - Intronic
1012583068 6:100892254-100892276 ACCCCATCCTCCCCATGCCCAGG - Intergenic
1012595457 6:101032753-101032775 ACCCCACTCTCCCAGTGTGAAGG - Intergenic
1012795199 6:103750760-103750782 ACCCCATTCTCCCAGTGCACAGG - Intergenic
1013258834 6:108416986-108417008 ACCTCAGTCTCCCAAAGCACTGG - Intronic
1014674720 6:124349327-124349349 ACCCCATTCTCCCAGTGCACAGG + Intronic
1014747661 6:125219043-125219065 AACCTGTTCTCCCAGTGCTCAGG + Intronic
1015009287 6:128324661-128324683 GCCACATTCTCCGAGTGCTCTGG + Intronic
1015167810 6:130218333-130218355 ACCCCATTCTCTCAGTGCGCAGG + Intronic
1015987100 6:138895448-138895470 AACCAGGTCTCCCAGTGCACAGG + Intronic
1016233206 6:141831115-141831137 CTCCCATCCTCCCAGTGCACAGG + Intergenic
1016618364 6:146079108-146079130 ACCCTGTCTTCCCAGTGCACAGG + Intronic
1017837221 6:158189433-158189455 ACCCTGTTCTCCCAGTTCCCTGG + Intronic
1018260851 6:161969378-161969400 ATCCCTTTCTCCCAGTGCACAGG - Intronic
1019190813 6:170249580-170249602 ACCCCCTTCTCACTGCGCACTGG + Intergenic
1019726223 7:2604235-2604257 ACCCCAGCCTCCCAAAGCACTGG + Intronic
1020627433 7:10599468-10599490 ACCCCATTCTCCCAGTGTGCAGG - Intergenic
1021550862 7:21869637-21869659 ACCACATTCTCCCAATGCACAGG + Intronic
1021745989 7:23741959-23741981 GCCCCAGTATCCCAGGGCACAGG - Intronic
1021873934 7:25031096-25031118 CCTCTATGCTCCCAGTGCACCGG - Intergenic
1022084506 7:27053394-27053416 ACCCCATTCTCTGGGTGCACAGG + Intergenic
1022322098 7:29297273-29297295 CCCCCATTCTCCTAGTGTTCTGG + Intronic
1022679048 7:32526940-32526962 ATCCCATCCTCCCAGTGTGCAGG + Intronic
1023975642 7:45027924-45027946 ACCCCATCCTCCCAAAGCAGGGG - Intronic
1024398444 7:48895023-48895045 ACCCCATCCTCCCAGAGCATGGG - Intergenic
1024490989 7:49985836-49985858 ACCCCATTTTCCCAGTGTGCAGG - Intronic
1025157377 7:56620560-56620582 ACCTCCTTTTCCCAGTGCACAGG - Intergenic
1026165445 7:67905064-67905086 ACCCCACTTTCCCAGTCAACGGG - Intergenic
1027527957 7:79294495-79294517 GCCCCATCCTCTCAGTGCACAGG + Intronic
1027679309 7:81199707-81199729 ATCCCTTTAACCCAGTGCACAGG - Intergenic
1027805122 7:82809874-82809896 ACCCCAATCTCCCAAAACACTGG + Intronic
1028728029 7:94111179-94111201 ACCCCAGTCTCCAAGTGGGCTGG + Intergenic
1028849734 7:95524808-95524830 ATCCCATTCTCCCAGTGCACAGG - Intronic
1029015484 7:97311580-97311602 ACCCCATGCTCCCTCTGCCCAGG - Intergenic
1030041338 7:105453076-105453098 ATCCTGTTCTCCCAGTGCTCAGG - Intronic
1030133030 7:106219296-106219318 TCCCCAGTCTATCAGTGCACAGG + Intergenic
1030239323 7:107303688-107303710 ACCTCAGTCTCCCAAAGCACTGG + Intronic
1030514001 7:110519022-110519044 ACCTCATTCTTCCTGGGCACAGG - Intergenic
1031042488 7:116853026-116853048 ACCTCAGTCTCCCAAAGCACTGG + Intronic
1031172059 7:118304333-118304355 ACCCCATTCTCCCAGTGTGCTGG + Intergenic
1032250886 7:130256329-130256351 ACCCCATTCTCCCAGTGCACAGG - Intergenic
1032251602 7:130262335-130262357 ACCCCATCCTCCCAGTGCACAGG - Intergenic
1032329257 7:130962495-130962517 ATCCCCTCCTCCCAGTGCACAGG + Intergenic
1032431999 7:131869980-131870002 ACCCCATTCTCACAGGGCTTAGG - Intergenic
1032580087 7:133096301-133096323 ACCCCATCCTCCCAGTGTGCAGG + Intergenic
1033967361 7:146992611-146992633 ACCCCATTCTCCCTGTACACAGG + Intronic
1035047522 7:155978486-155978508 TTCCCAAACTCCCAGTGCACAGG - Intergenic
1035218776 7:157391850-157391872 ACCTCAGCCTCCCAGAGCACTGG - Intronic
1035811712 8:2497219-2497241 GCCCCTTTCTCCCAGCACACTGG - Intergenic
1036155589 8:6339203-6339225 ACCCCATTCTCCCAGTGCACAGG - Intergenic
1036413955 8:8529415-8529437 ACCTCAGGCTCCCAGTGCATTGG + Intergenic
1037103584 8:15078013-15078035 ATCCCAGTCCCCCAGTGCATGGG - Intronic
1037481209 8:19307642-19307664 ACCTCAGCCTCCCAGAGCACTGG - Intergenic
1038117192 8:24570678-24570700 ACCCCATGCTGCCTGTTCACGGG + Intergenic
1038370264 8:26981925-26981947 GCCCCATCCTCCCAGTGCGGAGG - Intergenic
1039125521 8:34197193-34197215 ACCCCATTCTCCCAGTGCCCAGG + Intergenic
1039802419 8:40970843-40970865 ACCCCGTCCTCCCAGTGCTCAGG + Intergenic
1039977980 8:42383388-42383410 AGCCCAATCTCCCAGAACACTGG - Intergenic
1040090189 8:43390685-43390707 ACCCCAGCCTCCCAAAGCACTGG + Intergenic
1040374509 8:46810873-46810895 ACCTCCTTTTCCCAGTGCACAGG + Intergenic
1040853443 8:51925259-51925281 ACCCCATACTCCCAGTGTGCAGG + Intergenic
1040919299 8:52599112-52599134 AACCCATTCTTTCAGTGCACAGG - Intergenic
1040919937 8:52604976-52604998 AACCCATTCTTCCAGTGCACAGG - Intergenic
1041687715 8:60659527-60659549 ACCTCAGTCTCCCAGAGTACTGG - Intergenic
1043690861 8:83149905-83149927 ACCCCGTCCTTCCAGTGCGCAGG - Intergenic
1043751686 8:83943722-83943744 TCCCCAGGCTCCCAGTGGACTGG + Intergenic
1043889703 8:85642581-85642603 ACCCCCGACTCCCAGTGCCCCGG - Intergenic
1044517544 8:93156676-93156698 ACCCTATTCTCCCAGTGTGTAGG - Intronic
1044996993 8:97846574-97846596 ACCTCAGTCTCCCAGAGTACTGG + Intronic
1046132912 8:109990396-109990418 ACCCCATCCTCCCAGTGCATAGG + Intergenic
1046412120 8:113859240-113859262 ACCCTACTCTCCCAGTGCCCAGG - Intergenic
1047128252 8:121987491-121987513 ACCCTGTCCTCCCAGTGAACAGG + Intergenic
1047214600 8:122866060-122866082 ACCCCTTTTTCCCAGTGAATGGG + Intronic
1047909358 8:129510566-129510588 ACCTCAGCCTGCCAGTGCACTGG + Intergenic
1048175542 8:132149227-132149249 ACCCTGTCCTCCCAGTGCACAGG - Intronic
1048176181 8:132154611-132154633 ACCCCATCATCCCATTGCACAGG - Intronic
1048513760 8:135086336-135086358 ACCCCATGGCCCCAGAGCACAGG - Intergenic
1048934584 8:139344316-139344338 ACCTCATTCCCCCAATGCAGGGG - Intergenic
1050785246 9:9392931-9392953 ACCCCATTCTCCCAGTGTGCAGG - Intronic
1050929829 9:11308788-11308810 ACCCCATTTTGCCAGTGTGCAGG - Intergenic
1051179241 9:14393231-14393253 TGCACATCCTCCCAGTGCACTGG + Intronic
1052059264 9:23941209-23941231 ACCCCATTCTCCCAGTGCACAGG + Intergenic
1052509068 9:29390986-29391008 ACCCCCTGCTCCCAGTGCGCAGG + Intergenic
1052520749 9:29545962-29545984 ACCCCATTCTTCCAGTTCTCAGG + Intergenic
1052795335 9:32918780-32918802 ACCCCGTCCTCCCAGTGCACAGG - Intergenic
1052885934 9:33647998-33648020 ACCCAATTCTTCCAGGACACTGG + Intergenic
1054986648 9:71269552-71269574 AGCCCACTCTCCCAGCTCACTGG - Intronic
1055202536 9:73684375-73684397 ACCCCATTCTCCCAGTGTGTAGG + Intergenic
1056914458 9:90733425-90733447 ACCCCATTCTCCCAGTCTGTGGG + Intergenic
1058128442 9:101223061-101223083 ACCTCAGTCTCCCACAGCACAGG - Intronic
1058147154 9:101424897-101424919 ACCCCAGGCAGCCAGTGCACTGG + Exonic
1058379320 9:104361378-104361400 ACCCTGTTCTCCCAGTTCCCAGG - Intergenic
1059141296 9:111855812-111855834 ACCTAATTTTCCCAGTACACTGG + Intergenic
1059811085 9:117856377-117856399 ACCCCATTCTCCCAGTGCGCAGG + Intergenic
1059874862 9:118623252-118623274 ACCCCATTCTCACCCTACACAGG + Intergenic
1060968504 9:127724706-127724728 ACCCCCAACTCCCAGTGCCCGGG - Intronic
1061948097 9:133920041-133920063 ACCCCATCCTCCAGCTGCACGGG + Intronic
1062038698 9:134394418-134394440 ACCTCAAACTCCCAGGGCACAGG - Intronic
1062373174 9:136250748-136250770 TCCCCATTCACCATGTGCACAGG - Intergenic
1186471688 X:9827009-9827031 ACTCCATTCCTCCAGTGCAGTGG + Intronic
1187490073 X:19743156-19743178 ACCCCAGCCTCCCAGAGCACTGG - Intronic
1187521597 X:20019276-20019298 ACCCCATTCTCCCAAAGCACTGG + Intronic
1188220592 X:27536788-27536810 ACCCCGTTCTCCTGGTGCACAGG + Intergenic
1189415573 X:40809851-40809873 ACCCTGTTCTCCCAGGGCACAGG - Intergenic
1189649768 X:43176895-43176917 ACCCCATGCTTCCAGTGAGCAGG - Intergenic
1190215966 X:48479605-48479627 ACCTCATCCTCCCAAAGCACTGG - Intronic
1190549472 X:51563872-51563894 ACCCCATTCTCCCAGTTCACAGG + Intergenic
1191189417 X:57650721-57650743 ACCCCATTGTCCCAGTGCACAGG - Intergenic
1191249430 X:58253427-58253449 ACCCCACTGGCCCAGTGCAGTGG + Intergenic
1191638136 X:63400509-63400531 ACCCCATTCTCCCAGTGTGCAGG - Intergenic
1193140504 X:78021937-78021959 ACCCCATCCTCCCAGTGCGTAGG - Intronic
1193692211 X:84659566-84659588 GCTTTATTCTCCCAGTGCACAGG + Intergenic
1194088905 X:89562316-89562338 ACCCTGTTCTCCCAGTGCACAGG + Intergenic
1194131678 X:90089259-90089281 ACCCCATTTTCCCAAAGCACAGG + Intergenic
1194641016 X:96404372-96404394 ACCATGTTCTCCCAGTGCCCAGG + Intergenic
1194653047 X:96538408-96538430 ACCCTGTTCTTCCAGTGCGCAGG - Intergenic
1194662542 X:96642895-96642917 ACCCCATCCTCCCAGTGCGCAGG + Intergenic
1194809669 X:98375074-98375096 ATCCCATCCACCCAGTGCACAGG + Intergenic
1196270785 X:113708290-113708312 ACCCCATCGTCTCAGTGCAATGG - Intergenic
1196652125 X:118178607-118178629 ACCCTATGCTCCCAGTGCGCAGG - Intergenic
1196669391 X:118349461-118349483 ACCTCAGTCTCCCAGGGCGCTGG + Intronic
1197038185 X:121903557-121903579 ACCCCATCCTCCTAGTGGGCAGG - Intergenic
1197299424 X:124760053-124760075 ACCCCTTCCTCCCAGTGCACAGG - Intronic
1197300811 X:124778204-124778226 ACCTCGTCCTCCCAGTGCGCAGG - Intronic
1198341186 X:135714348-135714370 ACCCCATTCCCCCGCAGCACCGG - Intronic
1199169871 X:144722654-144722676 ACCCCATTCTCTCAGTGTGAAGG - Intergenic
1199381250 X:147174812-147174834 ACCCCATCCTCCCAGTGAACAGG + Intergenic
1199897129 X:152136602-152136624 ACACCATTCTCCAAACGCACAGG - Intronic
1200034174 X:153317647-153317669 TCCCCAGTCTCCCAGAGCAGAGG + Intergenic
1200441581 Y:3218370-3218392 ACCCTGTTCTCCCAGTGCACAGG + Intergenic
1200898240 Y:8399705-8399727 ACCTTCTTTTCCCAGTGCACAGG - Intergenic
1201180290 Y:11336028-11336050 ACCCTGTAATCCCAGTGCACAGG + Intergenic
1201309882 Y:12587408-12587430 ACTCCATTCTCCCAGTGCACAGG - Intergenic
1202244526 Y:22805333-22805355 ACCTCCTTTTCCCATTGCACAGG + Intergenic
1202397515 Y:24439079-24439101 ACCTCCTTTTCCCATTGCACAGG + Intergenic
1202473266 Y:25231008-25231030 ACCTCCTTTTCCCATTGCACAGG - Intergenic