ID: 1014674724

View in Genome Browser
Species Human (GRCh38)
Location 6:124349331-124349353
Sequence CATTCTCCCAGTGCACAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 538
Summary {0: 11, 1: 19, 2: 40, 3: 124, 4: 344}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014674713_1014674724 13 Left 1014674713 6:124349295-124349317 CCCCTACAAAGGCGGGAACTTCC 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1014674724 6:124349331-124349353 CATTCTCCCAGTGCACAGGCCGG 0: 11
1: 19
2: 40
3: 124
4: 344
1014674718_1014674724 -9 Left 1014674718 6:124349317-124349339 CCGAGGCTCCACCCCATTCTCCC 0: 1
1: 22
2: 43
3: 127
4: 777
Right 1014674724 6:124349331-124349353 CATTCTCCCAGTGCACAGGCCGG 0: 11
1: 19
2: 40
3: 124
4: 344
1014674715_1014674724 11 Left 1014674715 6:124349297-124349319 CCTACAAAGGCGGGAACTTCCCG 0: 1
1: 0
2: 1
3: 4
4: 37
Right 1014674724 6:124349331-124349353 CATTCTCCCAGTGCACAGGCCGG 0: 11
1: 19
2: 40
3: 124
4: 344
1014674712_1014674724 14 Left 1014674712 6:124349294-124349316 CCCCCTACAAAGGCGGGAACTTC 0: 1
1: 0
2: 0
3: 1
4: 70
Right 1014674724 6:124349331-124349353 CATTCTCCCAGTGCACAGGCCGG 0: 11
1: 19
2: 40
3: 124
4: 344
1014674711_1014674724 15 Left 1014674711 6:124349293-124349315 CCCCCCTACAAAGGCGGGAACTT 0: 1
1: 0
2: 2
3: 11
4: 62
Right 1014674724 6:124349331-124349353 CATTCTCCCAGTGCACAGGCCGG 0: 11
1: 19
2: 40
3: 124
4: 344
1014674717_1014674724 -8 Left 1014674717 6:124349316-124349338 CCCGAGGCTCCACCCCATTCTCC 0: 2
1: 27
2: 47
3: 147
4: 614
Right 1014674724 6:124349331-124349353 CATTCTCCCAGTGCACAGGCCGG 0: 11
1: 19
2: 40
3: 124
4: 344
1014674706_1014674724 25 Left 1014674706 6:124349283-124349305 CCAGCCTGCTCCCCCCTACAAAG 0: 1
1: 0
2: 1
3: 20
4: 288
Right 1014674724 6:124349331-124349353 CATTCTCCCAGTGCACAGGCCGG 0: 11
1: 19
2: 40
3: 124
4: 344
1014674714_1014674724 12 Left 1014674714 6:124349296-124349318 CCCTACAAAGGCGGGAACTTCCC 0: 1
1: 0
2: 0
3: 6
4: 65
Right 1014674724 6:124349331-124349353 CATTCTCCCAGTGCACAGGCCGG 0: 11
1: 19
2: 40
3: 124
4: 344
1014674708_1014674724 21 Left 1014674708 6:124349287-124349309 CCTGCTCCCCCCTACAAAGGCGG 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1014674724 6:124349331-124349353 CATTCTCCCAGTGCACAGGCCGG 0: 11
1: 19
2: 40
3: 124
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014674724 Original CRISPR CATTCTCCCAGTGCACAGGC CGG Intronic
900228491 1:1543937-1543959 CATTGACCACGTGCACAGGCTGG + Exonic
901205115 1:7490165-7490187 GATTCACCCAGAGGACAGGCTGG - Intronic
901659216 1:10788315-10788337 TCCTCTCCCAGTGCAGAGGCAGG + Intronic
902176987 1:14657752-14657774 CATCCCCCCAGAGCACAGCCTGG + Intronic
902878536 1:19355607-19355629 AATTCTCACAGTGGACAGTCAGG + Intronic
903558176 1:24208297-24208319 CTTCCTCCCAGTGCGCAGGAAGG - Intergenic
903848022 1:26290005-26290027 GATCCTGCCAGTCCACAGGCTGG - Intronic
903955408 1:27022049-27022071 CATCTTCCCAGTGGACAGGGTGG - Intergenic
905405386 1:37728960-37728982 CATTCCCCATGAGCACAGGCTGG + Intronic
905663141 1:39743939-39743961 CCTGCTTCCAGAGCACAGGCCGG + Intronic
906249654 1:44301303-44301325 CAGGCTCCCAGTGCACAGTGGGG - Intronic
906680744 1:47724071-47724093 CATTCTCTTAGCGCACAGGTGGG + Intergenic
907517318 1:55000823-55000845 CCTTCTCCCAGTGAGGAGGCTGG + Intronic
909199364 1:72669978-72670000 CATTCTCCAAGTACACAGGCTGG + Intergenic
910190065 1:84585934-84585956 CACTCTTCCAGTGCACAGGTGGG + Intergenic
911265100 1:95733920-95733942 AGTTCTCCCAGTGCACAAGCTGG + Intergenic
911376853 1:97061807-97061829 TATTCTCCCAGTGTGCATGCAGG - Intergenic
911734885 1:101326070-101326092 CGTCCTCCCAGTGCGCAGGTGGG + Intergenic
911768488 1:101708778-101708800 CAATCTCCCAGTCCCCAGGGTGG - Intergenic
912493173 1:110073635-110073657 CATTTTCCCAGTGGGAAGGCTGG + Intronic
913030395 1:114897050-114897072 TGTCCTCCCAGTGCACAGGCTGG + Intronic
913103618 1:115592722-115592744 CATCCTCCTACTGCACAGGTGGG - Intergenic
916407863 1:164515301-164515323 CATTCTCCTGGAGCACAGGCTGG - Intergenic
916638737 1:166703110-166703132 CATTCTCCCAGTGTGCAGGTGGG - Intergenic
916731806 1:167573309-167573331 CATTCTTCCAGTGCACATGTGGG - Intergenic
917209400 1:172616220-172616242 TGTTCTCTCAGTGCACAGGCTGG - Intergenic
917210055 1:172622043-172622065 CATTCTCCCAGTGCACAGGCTGG - Intergenic
917267370 1:173235435-173235457 CATTGTCCCAGTGCACAGGTGGG + Intergenic
917514942 1:175699487-175699509 CACTCTCCCATTGCACTGGCTGG - Intronic
919823315 1:201486413-201486435 GACACTCCCAGTGCCCAGGCTGG + Intronic
921116697 1:212098777-212098799 CATGCCTCCAGTGCACAGGGTGG + Intronic
921598272 1:217078849-217078871 CTGTCTCCCAATGCAGAGGCTGG + Intronic
921901735 1:220458163-220458185 CATTCTCCCAGTGTGCAGGCAGG - Intergenic
923087765 1:230714180-230714202 CAGGCTGCCTGTGCACAGGCTGG + Exonic
923287811 1:232513926-232513948 CTTTCTCCCTGTGAATAGGCTGG + Exonic
923398330 1:233589901-233589923 CCTTCTCCAAGAGCACAGGCAGG + Intergenic
923900403 1:238320191-238320213 CATTCCCCCAGTGCACATACAGG - Intergenic
923973918 1:239238087-239238109 ATTCCTCCCAGTGCCCAGGCCGG - Intergenic
924317849 1:242817113-242817135 CATCTTCCCAGTGCACATGCAGG + Intergenic
1063281352 10:4632891-4632913 CGTTCTCCCCATGCGCAGGCTGG - Intergenic
1063306692 10:4909281-4909303 TATTCTCCCAGTGCACAGGCGGG - Intergenic
1064002402 10:11674575-11674597 CATTCTTCCAGTGGGCAGGTGGG - Intergenic
1064257732 10:13758568-13758590 CCTTCTCCTAGTGCACATGTGGG - Intronic
1066241383 10:33539261-33539283 CATTCTCTCAGTGTGCAGGCGGG - Intergenic
1067121401 10:43475033-43475055 CATTCTCCCAGTGTGCAGGTGGG + Intronic
1067721733 10:48732434-48732456 CCTTCTCCCACTGCACTGGCTGG + Intronic
1068417709 10:56745660-56745682 CACTCTCCCAGTTCACAGGCGGG - Intergenic
1068428402 10:56898356-56898378 CATTCTCCCAGTGCACAGGCGGG + Intergenic
1070406302 10:76100467-76100489 CTTTCTCCCAGTGTGCAGGCAGG + Intronic
1070785722 10:79161130-79161152 CACACTCCCAGTGCACCCGCAGG + Intronic
1071040811 10:81307539-81307561 CATTTTCCCAGTGCACGTGCAGG - Intergenic
1071050652 10:81444422-81444444 CATTCTCCCAGTGCACAGGCAGG - Intergenic
1071326065 10:84519443-84519465 AGTTCTCCCAGTGCACAAGCTGG + Intergenic
1072034415 10:91551343-91551365 CATTTTCCCTTTCCACAGGCAGG - Intergenic
1072067069 10:91881493-91881515 CCTTCTCCAAGCACACAGGCAGG - Intergenic
1073664093 10:105510295-105510317 CATTCCCCCAGTGCTCATGTGGG + Intergenic
1073953481 10:108839075-108839097 CATTCTCCCAGTGTGCAGGTGGG + Intergenic
1074493510 10:113959360-113959382 CATACCCCCAGCACACAGGCAGG + Intergenic
1074544045 10:114388617-114388639 CATTGTCTCAGTGCAGAGGTAGG - Intronic
1074792625 10:116906002-116906024 CAGTCACTCAGTTCACAGGCAGG + Intronic
1075270330 10:121043797-121043819 CACTTTTCCAGTGCACCGGCAGG + Intergenic
1075680496 10:124327598-124327620 CTTTCGCCCATTGCCCAGGCTGG - Intergenic
1076796070 10:132799085-132799107 CACTGTCCCACAGCACAGGCGGG + Intergenic
1076865912 10:133166193-133166215 CCCTCCCCCAGTGCACAGGGCGG - Intronic
1077217893 11:1402659-1402681 CCCTCTGCCAGTGCCCAGGCAGG - Intronic
1077227600 11:1445172-1445194 CACTCTCCCTGTGCCCAGCCCGG - Intronic
1077230000 11:1454467-1454489 CTGTCTCCCACTGCCCAGGCTGG + Exonic
1077789640 11:5424516-5424538 CATCCTCCCAGTACACAGGTAGG + Intronic
1078391291 11:10937615-10937637 CAGTCTCCCAGGGCAAAAGCAGG + Intergenic
1078535829 11:12172829-12172851 CATCCTCCCAGTGCACAGGCAGG + Intronic
1078680972 11:13475325-13475347 ATTCCTCTCAGTGCACAGGCTGG + Intergenic
1078737015 11:14029652-14029674 CATTCTCCCAGTGCTCAGGTGGG + Intronic
1080873442 11:36256925-36256947 CAAGCACCCAGTGCACAGCCTGG - Intergenic
1081011673 11:37820734-37820756 CACTCCCCCAGTGTGCAGGCTGG + Intergenic
1081100628 11:38997270-38997292 CATCCTCCCAGTGCTCAGGCTGG + Intergenic
1081544717 11:44062649-44062671 TGTTCTCCCAGTGCACAGATGGG - Intergenic
1082587059 11:54953646-54953668 CATTCTGCCAGTGGACATGTGGG - Intergenic
1083840081 11:65299337-65299359 CCTTCTGCCAGGGCAGAGGCAGG - Intronic
1084038323 11:66526886-66526908 TCTCCTCCCAGTGCACAGGGAGG - Intronic
1084117193 11:67049302-67049324 CATCCTGCCATTGCTCAGGCTGG - Exonic
1084198311 11:67539005-67539027 CATTGTCCCAGAGCACCAGCCGG - Intergenic
1084707072 11:70821781-70821803 CAGTCTCCGAGTCCACTGGCTGG + Intronic
1085257391 11:75183007-75183029 CACTCTCCCAGAGCTCAGACGGG + Intronic
1085566586 11:77520030-77520052 CATTCCCCCAGTGCACATGTGGG + Intronic
1085987514 11:81805017-81805039 CATTCCCACAGAGCACAGGCAGG - Intergenic
1086974483 11:93116692-93116714 ACTCCTCCCAGTGCATAGGCTGG - Intergenic
1087470023 11:98561499-98561521 CATTATCCCAGTGAGCAGGCGGG - Intergenic
1087840097 11:102911730-102911752 CGTTCTCCCAGTGCGCAGGCTGG - Intergenic
1088559380 11:111097344-111097366 CGTTCTCCCAGTGCAAAGGTGGG + Intergenic
1088698738 11:112392681-112392703 CATTCACCAATTTCACAGGCTGG + Intergenic
1090619622 11:128549338-128549360 CATTCACCCAGTGCCGCGGCCGG + Intronic
1090706121 11:129338658-129338680 TGTTCTCCCAGTACACAGGCCGG - Intergenic
1090873371 11:130767442-130767464 CATTCCTCCAGTGCACATGTGGG - Intergenic
1091670576 12:2449438-2449460 ACTCCTCCCAGTGCGCAGGCTGG + Intronic
1091842221 12:3629429-3629451 CTGTCTCCCAGAGCACAGACCGG - Intronic
1092035624 12:5332261-5332283 AATTCTCCCAGTGCACTGGGTGG - Intergenic
1092286639 12:7132466-7132488 CACTCTCCCAGAACACAGGATGG - Intronic
1092563050 12:9636855-9636877 CATCCTCCCAGTGCACAGGACGG + Intergenic
1092585539 12:9897699-9897721 CATTCTCCCAATGTGCAAGCAGG + Intergenic
1092720532 12:11436108-11436130 ACTCCTCCCAGTGCAAAGGCGGG + Intronic
1093655036 12:21684864-21684886 CTGTTTCCCAGTGCCCAGGCTGG + Intronic
1093932707 12:24970194-24970216 CATCCTCCTAATGCACATGCAGG + Intergenic
1094315373 12:29133693-29133715 CATTCCCCCAGTGCGCATGTGGG + Intergenic
1094443623 12:30506555-30506577 CATCCTCCCAGTGCACAGGCTGG - Intergenic
1094493455 12:30975563-30975585 CATGCTACCCCTGCACAGGCTGG - Intronic
1095345287 12:41142540-41142562 CATTTTTCCAGTGTACAGGTGGG + Intergenic
1095765304 12:45887779-45887801 CGTCCTTCCAGTGCAGAGGCTGG + Intronic
1096928181 12:55172885-55172907 CATTCTCCCAGTGCCCAGGCAGG - Intergenic
1097601619 12:61699650-61699672 CATTCTTCCAGTGGGCATGCGGG - Intergenic
1097646989 12:62248220-62248242 CATTGTCCCAGTGCAGGGGTGGG + Intronic
1097844510 12:64352549-64352571 TACTCTCCCAGTGCACATGTGGG - Intronic
1099812163 12:87597068-87597090 ATTCCTCCCAGTGCACAGGTTGG - Intergenic
1100233549 12:92634401-92634423 CACTCTCCCAGTGTGCAGGCGGG + Intergenic
1100321237 12:93494973-93494995 CATTTTCCCAGTGCACAAGCTGG - Intronic
1100766813 12:97875244-97875266 CATTCTTCCAGTGCGCATGCGGG + Intergenic
1103666916 12:122575229-122575251 CATGTTCCCATTGCCCAGGCTGG - Intronic
1105766014 13:23560282-23560304 AACTCCCCCAGTTCACAGGCCGG - Intergenic
1106250213 13:27977181-27977203 CTTTCCCCCAGTGGACAGTCTGG + Intergenic
1106287396 13:28329567-28329589 CCGTCTCCCCCTGCACAGGCTGG - Intronic
1107676290 13:42800932-42800954 TATTCTCACAGTGCACATGAGGG + Intergenic
1108167604 13:47709542-47709564 CATTCCCCCAGTGCTCAGGCAGG - Intergenic
1108940415 13:55946777-55946799 CACTCTCCCAGTGCATAGGCAGG - Intergenic
1109203182 13:59453394-59453416 CTGTCTCCCAGGGCACATGCTGG - Intergenic
1109638939 13:65161445-65161467 CATTCTTCCAGTGCACATGCGGG + Intergenic
1109831188 13:67791166-67791188 CATCCTTCCAGTGCACATGCGGG + Intergenic
1109863640 13:68232951-68232973 CATCCTCCCAGTGCACAGGTGGG + Intergenic
1109924010 13:69110086-69110108 CATTCTCCCAGCGCTCATGCAGG - Intergenic
1110413294 13:75226309-75226331 ATTCCTCCCAGTGCGCAGGCGGG - Intergenic
1111079244 13:83280071-83280093 CATTCTTCCAGTGCACATGTGGG - Intergenic
1111147490 13:84203134-84203156 CTCTCTCCCATTGCCCAGGCTGG - Intergenic
1111357668 13:87129962-87129984 CACACTCCCAGTCCAAAGGCAGG + Intergenic
1112013058 13:95308184-95308206 CATTCCCCCAGTGCACATGTGGG - Intergenic
1112015344 13:95326860-95326882 CATTCTCCCAGTGTACCGGCTGG - Intergenic
1112286147 13:98106125-98106147 TATTGTCCCAGCACACAGGCAGG + Intergenic
1112440752 13:99423091-99423113 CGTTCACCCAGTGCACACACTGG - Intergenic
1112722862 13:102264895-102264917 CAGTCTCCCAGGGCACAGCACGG + Intronic
1113219646 13:108085216-108085238 CATTCCCCCAGTGTACATGTGGG - Intergenic
1113338692 13:109401429-109401451 CATTCTCCCAGGGCGCAGGCCGG - Intergenic
1113424630 13:110197876-110197898 CACACTCCCATTGCACAGGTTGG + Intronic
1113486187 13:110654008-110654030 CAATCTCCCAGAGCCCAGGCCGG + Intronic
1114348160 14:21819850-21819872 CAGTCTCACTGTGCCCAGGCTGG + Intergenic
1114556422 14:23564935-23564957 TATTGCCCCAGTGCCCAGGCTGG - Intronic
1116103485 14:40470305-40470327 CGTTCTCCCAGTGCACATGTAGG - Intergenic
1116366102 14:44066082-44066104 CATTCTCCCATTCCATAGGTTGG - Intergenic
1116594175 14:46819283-46819305 GGTTCACCCAGTGCACAGGCCGG - Intergenic
1117565839 14:56992474-56992496 ACTCCTCCCAGTGCGCAGGCTGG - Intergenic
1118225376 14:63894231-63894253 CATTGTTCCTGTGCCCAGGCTGG + Intronic
1118352152 14:64979967-64979989 AATGATCCCAGTGCACAGCCAGG + Intronic
1118378025 14:65193582-65193604 CGTTCTCCCAGTGCACAGGCTGG + Intergenic
1118474552 14:66104676-66104698 CATTCCCCCAGTGCGCATGTGGG - Intergenic
1118486971 14:66223557-66223579 CATCCTCCCAGTGTGCAGGTGGG + Intergenic
1118952539 14:70447370-70447392 CATTCTCCCAGTGAACATACAGG + Intergenic
1118999940 14:70872639-70872661 CAGTCCCCCAGTGCACACGTAGG + Intergenic
1120520724 14:85525329-85525351 CATTCTCCAACTGCACTGGGAGG - Intergenic
1121301463 14:92875098-92875120 CACTCTCCCAGTGCAAGAGCGGG - Intergenic
1121536660 14:94695628-94695650 CATCCTCCCACCCCACAGGCTGG - Intergenic
1124021884 15:25932957-25932979 GATTGTCCCGGTGCACAGCCGGG + Intergenic
1125440571 15:39698789-39698811 AATTCTCCCAGTGCACCAGGAGG + Intronic
1127241774 15:57124008-57124030 CAGTCTCACATTGCCCAGGCTGG + Intronic
1128101767 15:65007055-65007077 CATTCTTCCAGTGCTCATGCGGG - Intronic
1128114478 15:65096678-65096700 CAGTTTCCCAGTTCACAGGGTGG - Intronic
1128619389 15:69136034-69136056 CAGTCTCCTAGTGCATAGACTGG - Intergenic
1128920191 15:71603409-71603431 CGTTCTCCCAGTGCAGAGGTGGG + Intronic
1130064018 15:80590125-80590147 CATTAACGCAGTGCCCAGGCTGG + Intronic
1130149864 15:81303287-81303309 CATTCACCCTGTCCACAGCCGGG - Intronic
1131249342 15:90820333-90820355 CCTTCAACCAGGGCACAGGCAGG + Intergenic
1132102612 15:99035365-99035387 GAGTTTCCCAGTGCCCAGGCTGG - Intergenic
1132393750 15:101457449-101457471 CAGCCTCCCAGGGCGCAGGCTGG + Intronic
1132504946 16:303222-303244 GCTCCTCCCAGTGCGCAGGCCGG - Intronic
1132613194 16:827945-827967 CATTCTCCCAGGACACAGTGGGG - Intergenic
1133678128 16:8095189-8095211 CAATTTCCCAGTTCAAAGGCAGG + Intergenic
1134044825 16:11093442-11093464 CAGGCTTCCAGTGTACAGGCCGG + Intronic
1135594496 16:23731253-23731275 ATTTCTCCCAGTTCACAGGTGGG + Intergenic
1135754002 16:25081274-25081296 CTTGCTCCCATTACACAGGCTGG + Intergenic
1135788090 16:25368386-25368408 CATTCTCCCAGTGTGCAGGCCGG - Intergenic
1135822757 16:25698895-25698917 CCTTCAGCCAGAGCACAGGCAGG - Intronic
1136493453 16:30626051-30626073 CTCACTCCCATTGCACAGGCTGG - Intergenic
1136733380 16:32440711-32440733 CGTAATCCCAGTGCACAGGTGGG - Intergenic
1138221721 16:55257195-55257217 CATCTTCCCTATGCACAGGCAGG - Intergenic
1138787998 16:59869186-59869208 CATTCTCCCAGTGTGCAGGTGGG + Intergenic
1139193975 16:64896963-64896985 GATTTTCCCAGAGCACAGGAAGG + Intergenic
1141330734 16:83108571-83108593 CATCCTCCCAGTGCACAGGTGGG + Intronic
1203019703 16_KI270728v1_random:388891-388913 CGTAATCCCAGTGCACAGGTGGG + Intergenic
1203038038 16_KI270728v1_random:662049-662071 CGTAATCCCAGTGCACAGGTGGG + Intergenic
1144228523 17:13175428-13175450 CATTCTCCCAGTGCACAGGTGGG - Intergenic
1144829681 17:18124262-18124284 CATACCCTCAGTGCCCAGGCAGG - Intronic
1145013121 17:19381121-19381143 CTGTCTCCCAGGGCACAGGCTGG - Exonic
1145098428 17:20052564-20052586 GATTCTCCTAGACCACAGGCTGG + Intronic
1145103434 17:20095679-20095701 CACTCTCACAGTGCACAGGGTGG - Intronic
1146266141 17:31454095-31454117 CATTCTCCCAGGGCAGAGACTGG + Intronic
1148974715 17:51517032-51517054 CATTGTCCAAGGTCACAGGCTGG - Intergenic
1149102360 17:52922032-52922054 CATCCCCCCAATGCACAGGTGGG + Intergenic
1150597065 17:66615623-66615645 CACCCTCCCAGGGCACACGCAGG - Intronic
1150847507 17:68674729-68674751 CATTCCTTCAGTGCACATGCAGG + Intergenic
1151757449 17:76082907-76082929 CTGTCTCCCAGCCCACAGGCAGG + Exonic
1152534673 17:80943574-80943596 CGTTGTCCCAGTGTGCAGGCTGG + Intronic
1153246065 18:3073728-3073750 CATTCCCCCAATGCACATGTGGG - Intronic
1153799839 18:8659372-8659394 CATTGTCCCAATTCACAGTCAGG - Intergenic
1154092886 18:11381384-11381406 CATTCTCACACTGAACTGGCTGG + Intergenic
1154244005 18:12679270-12679292 ACTCCTCCCAGTGCACAGGCTGG - Intronic
1156819611 18:41356631-41356653 CATTCCACCAGTACACAGCCTGG - Intergenic
1156972289 18:43170919-43170941 CATTCTCCCAGTGCTCAGGCTGG - Intergenic
1158335049 18:56406929-56406951 CATCCCCCCAGTGCACATGCAGG + Intergenic
1158613030 18:58960539-58960561 CTTTTGCCCAGTGCTCAGGCAGG - Intronic
1158639242 18:59189217-59189239 CATTACCCCAGTGCACATGTGGG + Intergenic
1159357025 18:67349504-67349526 CGTCCTCCCAGTGCACAGGTGGG + Intergenic
1161083497 19:2323086-2323108 CATTCCCCCAGTGCCCGGGCCGG + Intronic
1161278626 19:3433381-3433403 CATTCCCCCACAGCACAGGATGG + Intronic
1161907986 19:7171698-7171720 CATCCTCCAAGGGTACAGGCTGG - Intronic
1162832429 19:13294383-13294405 CATTCTCTAAATGCTCAGGCTGG + Intronic
1163402927 19:17105223-17105245 CATAATCCCAGTGCACTGGGAGG + Intronic
1163624822 19:18383111-18383133 CCTTCTCCTAATGCTCAGGCAGG - Intronic
1164203090 19:23034450-23034472 CATCCTCCCAGTGCATAGGCCGG + Intergenic
1164406774 19:27955636-27955658 CATTCTCCCAGTGCACAGGCAGG - Intergenic
1164465255 19:28482341-28482363 CATTCTCCTAGAACACAGGTGGG - Intergenic
1164533461 19:29065561-29065583 CAATCTCCTGGTGCACAGGCAGG + Intergenic
1164810858 19:31154726-31154748 CATCCTCCCAGTGTGCAGGTGGG + Intergenic
1166251278 19:41572705-41572727 TATGCTCACAGTGCACATGCTGG - Intronic
1166504840 19:43364706-43364728 CATTCTCTCAGTGGGCTGGCAGG + Intergenic
1166505700 19:43370208-43370230 CATTCTCTCAGTGGGCTGGCAGG - Intergenic
1167522033 19:49960888-49960910 CAGTCTTCAAGTGCAGAGGCAGG - Exonic
1167523349 19:49969837-49969859 CAGTCTTCAAGTGCAGAGGCAGG + Intergenic
925160078 2:1677539-1677561 CATTCTCCCCTTGCCCAGGGTGG - Intronic
925160630 2:1681138-1681160 ACCCCTCCCAGTGCACAGGCCGG - Intronic
925341759 2:3142800-3142822 CATTCTCCCTGCTCCCAGGCAGG + Intergenic
926311495 2:11679043-11679065 CATCTTCCCAGTGGACAGGTGGG + Intronic
926344459 2:11932511-11932533 CTCCATCCCAGTGCACAGGCCGG + Intergenic
926888961 2:17622891-17622913 GGTCCTCCCAGTGCACAGGAGGG + Intronic
927045294 2:19272248-19272270 ACTCCTCCCAGTGCAAAGGCTGG - Intergenic
927485003 2:23482442-23482464 GACACTCCCAGAGCACAGGCTGG - Intronic
928446816 2:31340075-31340097 CTTTCTCCCAGAGGACAGGCAGG - Intronic
928833490 2:35517314-35517336 CACTCTCCCAGTGCATAGGTGGG + Intergenic
929115712 2:38442230-38442252 TGTTCTCCCAGTGCACAGGTTGG - Intergenic
931008648 2:57881778-57881800 CCTTCTCCCAGTGGACAAGCAGG + Intergenic
931435638 2:62243747-62243769 CCTTCCCCCAGAGCACAGGGTGG - Intergenic
931938742 2:67228713-67228735 ACTCCTCCCAGTGCATAGGCAGG + Intergenic
932046777 2:68357805-68357827 CATCCTCCCAGTGCACAGGCCGG + Intergenic
932268997 2:70392477-70392499 CCTTCCCCCACTGCACAGGTGGG - Intergenic
933310301 2:80652253-80652275 CATCCTCCCAGTGTGCAGGTGGG + Intergenic
933495545 2:83046176-83046198 ATTTCTCCCAGTGTGCAGGCTGG + Intergenic
933541410 2:83647701-83647723 CATTCTCCCAGTGCGCAGGCGGG - Intergenic
933784681 2:85829054-85829076 AATTTTCCCAGTGCATGGGCGGG + Intergenic
935099023 2:99974797-99974819 CCTTCTCCCAGTGCACCCACTGG + Intronic
935264217 2:101380963-101380985 AAGTTTTCCAGTGCACAGGCTGG + Intronic
935568542 2:104635134-104635156 CACTCTGCCTGTGCACATGCTGG + Intergenic
936258234 2:110935283-110935305 CTTTCTCGCAGTTCACAGGTGGG + Intronic
936733251 2:115408299-115408321 CAATCTCCCAGTGCGCAGGCGGG + Intronic
936834347 2:116689210-116689232 CGTTCTTCCAGTGCAAATGCAGG + Intergenic
937412286 2:121687056-121687078 CATTCTTCCAGTGTGCATGCTGG - Intergenic
937441209 2:121917704-121917726 CATGCTCCCACTCCACAGTCAGG - Intergenic
937649034 2:124299234-124299256 ATTCCTCCCAGTGCACAGGCTGG + Intronic
938250570 2:129812792-129812814 CATTGTCCCAGTGGGAAGGCGGG + Intergenic
938850897 2:135258335-135258357 CATCCTCCCAATGCACAGGCAGG - Intronic
939840392 2:147181069-147181091 ACTCCTCCCAGAGCACAGGCTGG + Intergenic
940348876 2:152659092-152659114 CATTCTTCTAGTGCAGAGTCTGG - Exonic
941177563 2:162217386-162217408 CATTCTCCTACTGCACACTCAGG + Intronic
941200006 2:162496390-162496412 CATCCCCCCAGTGCGCATGCGGG - Intronic
941617191 2:167734076-167734098 CACTTTCCCTGTGCACAGGCAGG + Intergenic
941791314 2:169554951-169554973 CATTCTGCCAGTGCCCATGCTGG - Intronic
942585710 2:177474503-177474525 CACTCTTCCAGTGCACAGGCGGG + Intronic
942605224 2:177683501-177683523 CATCCTCCCAATGCGCAGGCGGG - Intronic
943149783 2:184097703-184097725 CATTCTCCCCATGCCCAGGCAGG - Intergenic
943246284 2:185455651-185455673 CATTCTCCCAGTGTGCATGTGGG - Intergenic
943927160 2:193799699-193799721 CATCCCCCCAGTGCACATGTGGG + Intergenic
945217239 2:207446824-207446846 GCTTCTCCCAGTGCGCAGGCTGG - Intergenic
945468631 2:210201084-210201106 CGTCCTCCCAGTGCACAGGTGGG - Intronic
946756662 2:222954005-222954027 CATTTCCCCAGTGCAGAGGTAGG - Intergenic
946880204 2:224170015-224170037 CAGCCTTCCATTGCACAGGCTGG - Intergenic
946885373 2:224217341-224217363 ATTCCTCCCAGTGCACAGGCTGG - Intergenic
948650794 2:239442416-239442438 CACTCTCCCTGTGCACAGAGGGG - Intergenic
948694919 2:239728390-239728412 CCTGCTCCCTGTGCACAGGCAGG + Intergenic
1169053164 20:2597515-2597537 CTCTCTCCCATTGCCCAGGCTGG + Intronic
1169325374 20:4671278-4671300 GATGCTCCGAGTGCACAGGTGGG - Intergenic
1169574307 20:6941330-6941352 CATTCTCCCAGTAGAAAGCCTGG + Intergenic
1169699697 20:8432335-8432357 AATCCTCCCAGTGTGCAGGCTGG + Intronic
1170168493 20:13385419-13385441 CATTCTCCGAGTGATAAGGCTGG - Intergenic
1172122437 20:32606370-32606392 CATTCTCCCCTGGCCCAGGCCGG + Intronic
1172365193 20:34343712-34343734 TGTTCTTCCAGTGTACAGGCAGG - Intergenic
1172777722 20:37417165-37417187 CATTCACCCAGTCCCCAGGGAGG + Intergenic
1174435997 20:50507457-50507479 CTTTCTCCCGTCGCACAGGCTGG + Intergenic
1174544133 20:51312588-51312610 CATCCTCCCAGTGCTCAGGCAGG + Intergenic
1175334615 20:58187194-58187216 CACTCTCCCAGAGCCCAGGTTGG - Intergenic
1175347717 20:58293681-58293703 CATGCTGCAAGTGCACAGCCTGG + Intergenic
1175506915 20:59492499-59492521 TATTATCCCAGTCCACAGCCAGG - Intergenic
1176907493 21:14520719-14520741 CCTTCCCCCAGTGCACAGGTGGG - Intronic
1177414399 21:20775868-20775890 CACTCTCCCAGTGCACAGGTGGG + Intergenic
1177414826 21:20780122-20780144 CATTCTCCCAGTGTGCAGGTGGG + Intergenic
1179068659 21:38051287-38051309 CATTCTCCCCATCCACATGCAGG - Intronic
1179447274 21:41441070-41441092 CATTCTCACCGAGCACAGGCGGG - Intronic
1179447282 21:41441099-41441121 CATTCTCACCGAGCACAGGTGGG - Intronic
1179447290 21:41441128-41441150 CATTCTCACCGAGCACAGGCGGG - Intronic
1179956183 21:44740434-44740456 CATTCTCCCAGTGCACAGGGGGG - Intergenic
1180843119 22:18968416-18968438 CCTGCTCCCACTGCACAGACAGG + Intergenic
1182398561 22:30055935-30055957 CTCGCTCCCATTGCACAGGCTGG - Intergenic
1182642310 22:31778088-31778110 TATTCTTTCAGAGCACAGGCTGG + Exonic
1182723398 22:32422899-32422921 TATTTTCCCAGTCCACAGCCTGG - Intronic
1184704832 22:46203778-46203800 CATTCTCCCAATGCCCAGGTGGG + Intronic
949709319 3:6856169-6856191 TCTTCTCTCAGTACACAGGCAGG - Intronic
949993137 3:9595997-9596019 ACTCCTCCCAGTGCACAGGCTGG - Intergenic
950461155 3:13122915-13122937 CACGCTCCCAGGACACAGGCTGG + Intergenic
952192887 3:31042719-31042741 CTCTCTCCCAGTGTGCAGGCTGG - Intergenic
953378947 3:42452113-42452135 ACTCCTCCCAGTGAACAGGCTGG + Intergenic
953437036 3:42885812-42885834 CAGTCTCCCAGTGCACAGGTGGG + Intronic
953441122 3:42918445-42918467 CGTTCTCCCAGTGTGCAGGCAGG + Intronic
953647463 3:44768515-44768537 CATTCTCCCAGGGCGCATGTGGG + Intronic
953648123 3:44774027-44774049 CATTCTCCCAGTGTGCATGTGGG + Intronic
954968677 3:54633657-54633679 ATTCCTCCCAGTGTACAGGCTGG + Intronic
955733405 3:62011132-62011154 CATCCTTCCAGTGCGCATGCAGG + Intronic
955774550 3:62419362-62419384 CATTTTCTCAGTGCACAGGGAGG - Intronic
957320107 3:78619574-78619596 CATTCTCCTAGGGCTAAGGCAGG - Intronic
957991856 3:87636374-87636396 CATTCTTCCAGTGCACACGTGGG - Intergenic
958047935 3:88307824-88307846 CGTCCTCCCAGTGCGCAGGTGGG - Intergenic
958536692 3:95412656-95412678 CCTTCTCCCAGTGTGCAGGTGGG - Intergenic
959685398 3:109140452-109140474 CCTTCTCCCAGTGACCAGGCTGG + Intergenic
959820536 3:110730041-110730063 GTTCCTCCCAGTGCACAGGTTGG - Intergenic
960259191 3:115546246-115546268 CTTACTCCCATTGCCCAGGCTGG + Intergenic
962126707 3:132627133-132627155 CATTCCCCCAGTGTGCAGGCAGG - Intronic
963171366 3:142254673-142254695 CATTCTCCCAGTGCACAGATGGG - Intergenic
963433965 3:145244488-145244510 CATTCTCCCAGTGTGCACGTGGG + Intergenic
963435472 3:145260036-145260058 CATTCTCCCAGTGTGCAGGTGGG + Intergenic
964314286 3:155426879-155426901 CATCCTTCCAGTGCACATGTGGG + Intronic
966466506 3:180235649-180235671 CATTTTCCTGGTGCACAGGCAGG - Intergenic
967531035 3:190549250-190549272 CATTCTCCCAGTGCGCAGGCTGG + Intronic
967555360 3:190850462-190850484 CATCTTCCCAGTGCACAGGTGGG - Intergenic
967657114 3:192063742-192063764 ACTCCTCCCAGTGCACCGGCGGG - Intergenic
968380902 4:95023-95045 CATTCCCCCAGTGCACTGGTGGG - Intergenic
969355038 4:6620300-6620322 CTGTCACCCAGGGCACAGGCAGG - Intronic
969717019 4:8872663-8872685 CCTTCGCCCAGGGCAGAGGCTGG - Intergenic
969993928 4:11292489-11292511 CATTTTTCAAGTGCCCAGGCTGG + Intergenic
970721302 4:18992539-18992561 ACTCCTCCCAGTGCACAGGCCGG - Intergenic
970729893 4:19090364-19090386 CATTCTCGCAGTGCGCAGGCGGG - Intergenic
971572406 4:28230191-28230213 CATTCTCCCAGTGCCCAGGAGGG - Intergenic
974256336 4:59459576-59459598 GGTACTCCCAGTGCACAGGTGGG + Intergenic
974428868 4:61771113-61771135 CATCCTTCCAGTGCACATGTGGG + Intronic
975182326 4:71361089-71361111 ACTCCTCCCAGTGCACAGGCCGG + Intronic
976344888 4:83989474-83989496 ATTCCTCCCAGTGCACACGCTGG - Intergenic
976345418 4:83994098-83994120 ATTTCTCCCAGTGCACAGGCTGG - Intergenic
976724526 4:88202659-88202681 CGTTCTCCCAGTGTACAGGCTGG + Intronic
976726996 4:88224406-88224428 CTTACTCCCATTGCCCAGGCTGG - Intronic
977823421 4:101502576-101502598 CAGTCTCCCAGGGCTCAGGTGGG - Intronic
977891833 4:102321361-102321383 TATTCTCCCACTGCTCAGGCAGG - Intronic
977944526 4:102896574-102896596 CGTAATCCCAGTGCACAGGTGGG + Intronic
979053704 4:115969951-115969973 CATTCTCCCAGTGCACATTCAGG + Intergenic
979609417 4:122673494-122673516 CATCCTCCAAGTACACAGGCTGG + Intergenic
979914660 4:126415213-126415235 CATTCTCCCAGTTCAAATGAAGG - Intergenic
980795513 4:137677241-137677263 CATCATCCCAGTGCACAGGCAGG + Intergenic
981189955 4:141851165-141851187 CGTCCTCCCAGTGCACAGGTGGG - Intergenic
981455968 4:144953781-144953803 TGTTCTCCCAGTGCACAGGCCGG - Intergenic
981456867 4:144962631-144962653 CATTCTCCCAGTGCACAGGTGGG - Intergenic
981770046 4:148298946-148298968 CATTCTCCCACTGCACAGGTGGG - Intronic
981770751 4:148304758-148304780 CATTCTCCCAGTGCTCAGGCAGG - Intronic
982477541 4:155872180-155872202 CATCCTCCCAGTGCACAGGTGGG + Intronic
982478209 4:155878164-155878186 CATTCTTCCAGTGCACAGCTGGG + Intronic
982526633 4:156487314-156487336 CATTCTCCCAGTGCACAGGCAGG - Intergenic
983060243 4:163152515-163152537 CATTCTTCCAGTACATAGGTTGG - Intronic
984158153 4:176217691-176217713 CTTTATCCCAGTGCAAAGCCTGG + Intronic
985937083 5:3105819-3105841 CAATGTCCCAGTGGAGAGGCGGG + Intergenic
986120860 5:4835009-4835031 ATCTCTCCCAGTGCAGAGGCAGG + Intergenic
986209748 5:5659921-5659943 AATTCTCCCAGTGCATAGGAAGG - Intergenic
987521277 5:18986886-18986908 CATTCTCCCAGTTCGCAGAAGGG + Intergenic
987661522 5:20884289-20884311 CTTGCTCTCATTGCACAGGCTGG - Intergenic
988211369 5:28209197-28209219 CATTCTCCCAGTGTGCAAGCCGG - Intergenic
988304579 5:29478706-29478728 CCTTCTCCCACTGCACAGGTGGG - Intergenic
988585976 5:32507869-32507891 GATCCTCCCAGTGCACAAGCAGG + Intergenic
989438139 5:41438443-41438465 CATTCTCCCAGCGTGCAGGTGGG - Intronic
989584496 5:43064080-43064102 CATTGCCCCAGTGCATATGCGGG - Intergenic
989715110 5:44453960-44453982 TCTTCCCCCAGTGCACAGGTGGG + Intergenic
989987852 5:50723039-50723061 CATTCACCAAGTGAAAAGGCTGG - Intronic
990303383 5:54471759-54471781 CATCCTCCTAGTGCACACGGGGG - Intergenic
990444907 5:55885544-55885566 CATTCTCCCAGTGCACAGGCGGG + Intronic
990777094 5:59314942-59314964 CATCGTCGCAGTGCACAGGCGGG - Intronic
991202288 5:64008474-64008496 CATCCTCCCAGTGCACAAACTGG - Intergenic
992952885 5:81878079-81878101 CATTCAGCCATTGCCCAGGCTGG - Intergenic
994086494 5:95765408-95765430 CTTTCTCCCCGTGCAGAGGAGGG - Intronic
996278170 5:121693995-121694017 TGTTCTCCCATTGCACAGGCTGG + Intergenic
996677016 5:126188053-126188075 CAACCTCCCAGAGCGCAGGCTGG - Intergenic
996709024 5:126525730-126525752 CATCCTCCCAGTGTGCAGGCTGG - Intergenic
996955425 5:129177622-129177644 CATTCTCCCAGTATGCAGGTGGG + Intergenic
997950542 5:138239340-138239362 CCTTGTCCCAGGGCACAGGTGGG + Intergenic
998075405 5:139232248-139232270 CATCCTCCGAGTGCACATGTGGG + Intronic
999748676 5:154610520-154610542 CATTCTCCCACTGGACCAGCAGG - Intergenic
1001000026 5:167996766-167996788 CATTGTCCAGGTGCCCAGGCTGG + Intronic
1001051695 5:168419172-168419194 CTTTCTCCCAGGCCCCAGGCTGG + Intronic
1001416702 5:171549897-171549919 CTTTCACCCAGTGCAGAAGCAGG - Intergenic
1001644886 5:173272965-173272987 CTTTCTCCCATCACACAGGCTGG - Intergenic
1001819952 5:174702785-174702807 CTCACTCCCATTGCACAGGCTGG + Intergenic
1001973545 5:175977698-175977720 CTCTCTCCCATTGCCCAGGCTGG - Intronic
1002997328 6:2299034-2299056 CATTCCTCCAGTGCACATGTGGG + Intergenic
1004277619 6:14252522-14252544 CCTTCTCCCAGTCCCCAGACAGG - Intergenic
1004434629 6:15578336-15578358 CATTCTCCTAGTGCGCAGAGGGG + Intronic
1005055218 6:21722707-21722729 TATCCTCCCAGTGCACAGGCAGG + Intergenic
1005564645 6:27078800-27078822 CCTTTTCCCAGTGCACAGGTGGG - Intergenic
1005981585 6:30840859-30840881 CATTTTCCCAGTATGCAGGCAGG + Intergenic
1006056704 6:31390578-31390600 CATCCTCCTAGTGCCCATGCAGG + Intergenic
1006069424 6:31487493-31487515 CATCCTCCTAGTGCCCATGCAGG + Intergenic
1006245898 6:32735555-32735577 ACTCCTCCCAGTGCTCAGGCTGG - Intergenic
1007122681 6:39396419-39396441 CAGTTTCCCAGTGCACCTGCTGG - Intronic
1007459845 6:42010080-42010102 CATTCTCCTAGAGGACAAGCAGG + Intronic
1009632340 6:66214866-66214888 CACTCTCCCAGTGTGCAGGTGGG - Intergenic
1010368120 6:75076246-75076268 ACTCCTCCCAGTGCGCAGGCCGG + Intergenic
1010872289 6:81058459-81058481 CGTCCTCTCAGTGCACAGGTAGG + Intergenic
1010991371 6:82484276-82484298 CATTCTTCCAGTGCACATGAGGG - Intergenic
1011215341 6:84999701-84999723 ACTTCTCCCAGTGCGCCGGCCGG - Intergenic
1011882374 6:92045769-92045791 CATTCTCCCAGTGCACAGGTGGG - Intergenic
1012143292 6:95650371-95650393 CATTCTTCCAGTGTGCATGCAGG - Intergenic
1012520795 6:100118774-100118796 ACTCCTCCCAGTGCACAGGCTGG + Intergenic
1012742801 6:103041137-103041159 CATTCTCCCAGTGTGCAAGCGGG + Intergenic
1012795195 6:103750756-103750778 CATTCTCCCAGTGCACAGGCTGG - Intergenic
1013437357 6:110124111-110124133 CATTTCCCTAGTGCACATGCAGG - Intronic
1013455486 6:110325901-110325923 ATTCCTCCCAGTGCACAGGCTGG + Intronic
1014674724 6:124349331-124349353 CATTCTCCCAGTGCACAGGCCGG + Intronic
1014747663 6:125219047-125219069 TGTTCTCCCAGTGCTCAGGCCGG + Intronic
1014809209 6:125866568-125866590 CAGTCTCCCAGTGCACAAAATGG - Intronic
1014956308 6:127621298-127621320 TATTCTCCCAGTGCATATGCGGG - Intergenic
1015813116 6:137180736-137180758 CATTCTCCCAGTGCACATGCAGG + Intergenic
1017507443 6:155081578-155081600 CATTCACACAGAGCCCAGGCAGG + Intronic
1017560017 6:155616375-155616397 CATTCTTCCAGTGCACGTGCCGG + Intergenic
1017780494 6:157711762-157711784 CACTTTCCCACTGCCCAGGCTGG + Intronic
1017962373 6:159233399-159233421 CATTCTCCCAAAGCACAGCCAGG + Exonic
1018260848 6:161969374-161969396 CTTTCTCCCAGTGCACAGGCTGG - Intronic
1018778869 6:167044517-167044539 CATTCACCCGGTGCACACCCAGG - Exonic
1019106462 6:169671600-169671622 CATGCTCCAAGCACACAGGCAGG + Intronic
1019258524 7:66824-66846 GATTCCCCGAGTGCACAGGCAGG - Intergenic
1019338876 7:498818-498840 CATTCTCCCATTGTACAGATGGG + Intronic
1019706021 7:2497750-2497772 CCTGCTCCCAGTACACAGGAGGG + Intergenic
1020899794 7:13990406-13990428 CCTTTTCCCAGTGCACACGTAGG - Intronic
1021456541 7:20835383-20835405 ACTCCTCCCAGTGCACTGGCCGG + Intergenic
1021550864 7:21869641-21869663 CATTCTCCCAATGCACAGGCAGG + Intronic
1021580368 7:22146017-22146039 CATTCTTCCACTGCATAAGCAGG + Intronic
1021597901 7:22336614-22336636 ACTCCTCTCAGTGCACAGGCTGG - Intronic
1022315506 7:29241460-29241482 ATTCCTCCCAGTGCACAGGCTGG + Intronic
1023005723 7:35864868-35864890 GATCATCCCAGTGCACAGGATGG + Intronic
1023818816 7:43969081-43969103 CAGTCCCCCAGTGCTAAGGCCGG - Intergenic
1023970996 7:44990887-44990909 CATTTCCCCAGTGCACATGTAGG + Intergenic
1024438101 7:49382376-49382398 AGTCCTCCCAGTGCACAGCCTGG - Intergenic
1024490985 7:49985832-49985854 CATTTTCCCAGTGTGCAGGCAGG - Intronic
1024510171 7:50197653-50197675 CTATCTCCCAGTTCCCAGGCTGG - Intergenic
1024698290 7:51879100-51879122 CTGTCTCCCAGTGCAAATGCTGG - Intergenic
1024888262 7:54169591-54169613 CATCCTCCTAATGCACATGCAGG - Intergenic
1025157373 7:56620556-56620578 CCTTTTCCCAGTGCACAGGTGGG - Intergenic
1025217782 7:57073319-57073341 GATCATCCCAGTGCACAGGATGG - Intergenic
1025580016 7:62701147-62701169 CATTCTGCCAGTGGACATGTGGG - Intergenic
1025628696 7:63246957-63246979 GATCATCCCAGTGCACAGGATGG - Intergenic
1025653569 7:63497143-63497165 GATCATCCCAGTGCACAGGATGG + Intergenic
1025758385 7:64367547-64367569 TCTTTTCCCAGTGCACAGGTGGG + Intergenic
1025943227 7:66088449-66088471 CTCGCTCCCAATGCACAGGCTGG - Intronic
1026854265 7:73742840-73742862 CACTCAGCCAGTGCACAGCCCGG + Intergenic
1026866008 7:73824442-73824464 CATTCCCCCACTTCACAGGGAGG - Intronic
1027268961 7:76510124-76510146 CATCCTCCCAGTTCGCAGCCTGG - Intergenic
1028849731 7:95524804-95524826 CATTCTCCCAGTGCACAGGCTGG - Intronic
1029505189 7:100959416-100959438 CATTCTCACAGTGGACATGGTGG - Exonic
1029608755 7:101615400-101615422 CATGCTCCCAGGGCAGACGCAGG + Intronic
1029743864 7:102506047-102506069 CAGTCCCCCAGTGCTAAGGCCGG - Intronic
1029761853 7:102605210-102605232 CAGTCCCCCAGTGCTAAGGCCGG - Intronic
1030041336 7:105453072-105453094 TGTTCTCCCAGTGCTCAGGCCGG - Intronic
1030114352 7:106051751-106051773 CATCCTTCTAGTGCACATGCGGG + Intergenic
1030129751 7:106188967-106188989 TATTCTCCGATTGCCCAGGCTGG + Intergenic
1030533150 7:110735192-110735214 CATATTCCTAGTGCACATGCAGG - Intronic
1031020964 7:116627009-116627031 ACTCCTCCCAGTGCACAGACCGG - Intergenic
1031172064 7:118304337-118304359 CATTCTCCCAGTGTGCTGGTGGG + Intergenic
1032208726 7:129892279-129892301 CTTGCTCCCATCGCACAGGCTGG + Intronic
1032250881 7:130256325-130256347 CATTCTCCCAGTGCACAGGTGGG - Intergenic
1032251598 7:130262331-130262353 CATCCTCCCAGTGCACAGGCAGG - Intergenic
1032329261 7:130962499-130962521 CCTCCTCCCAGTGCACAGGCTGG + Intergenic
1032625763 7:133590139-133590161 CATTTTCCCAGTGCACATGCAGG + Intronic
1033464370 7:141577708-141577730 ACTCCACCCAGTGCACAGGCCGG + Intronic
1034377328 7:150657574-150657596 CATCCTTCCAGTGCACATGTGGG + Intergenic
1034383024 7:150715622-150715644 CATTCTCCCAGTAGACCGGCAGG - Intergenic
1034674765 7:152884466-152884488 CAAGCTCCAGGTGCACAGGCAGG - Intergenic
1036155584 8:6339199-6339221 CATTCTCCCAGTGCACAGGCGGG - Intergenic
1037289478 8:17335960-17335982 CATCCTCCCAGTACACAGATAGG - Intronic
1038370260 8:26981921-26981943 CATCCTCCCAGTGCGGAGGTTGG - Intergenic
1038692995 8:29780222-29780244 CATTCTCCCTGCTCACAGCCAGG - Intergenic
1039125526 8:34197197-34197219 CATTCTCCCAGTGCCCAGGTGGG + Intergenic
1039391654 8:37185724-37185746 ATTCCTCCCAGTGCACAGGCCGG - Intergenic
1039564012 8:38537027-38537049 CTTACTCCCATTGCCCAGGCTGG + Intergenic
1039785933 8:40834177-40834199 CAGTCTCACATGGCACAGGCTGG + Intronic
1039802423 8:40970847-40970869 CGTCCTCCCAGTGCTCAGGCTGG + Intergenic
1040027994 8:42799312-42799334 CTTACTCCCACTGCCCAGGCTGG + Intergenic
1040374513 8:46810877-46810899 CCTTTTCCCAGTGCACAGGTGGG + Intergenic
1040385941 8:46915201-46915223 CAATCACTAAGTGCACAGGCAGG + Intergenic
1040853447 8:51925263-51925285 CATACTCCCAGTGTGCAGGCAGG + Intergenic
1043680985 8:83023981-83024003 CATTCTTCCAGTGCATATGTGGG + Intergenic
1044716291 8:95102750-95102772 CATGCTCCCAGTGAACACACTGG + Intronic
1044850271 8:96420395-96420417 CATACTCCCAGTTCACCTGCAGG + Intergenic
1045751648 8:105491476-105491498 GTTTATCACAGTGCACAGGCTGG + Intronic
1046631682 8:116628114-116628136 CATTCTTCAGGTGCACAGACGGG + Intergenic
1047128255 8:121987495-121987517 TGTCCTCCCAGTGAACAGGCTGG + Intergenic
1048176177 8:132154607-132154629 CATCATCCCATTGCACAGGCTGG - Intronic
1048649050 8:136454025-136454047 ATTCCTCCCCGTGCACAGGCTGG - Intergenic
1049626245 8:143623131-143623153 CCGTCTCCCAGTGCACACACAGG - Intergenic
1050114082 9:2244990-2245012 CTTTCTCACAGTTCAGAGGCTGG - Intergenic
1050785242 9:9392927-9392949 CATTCTCCCAGTGTGCAGGTTGG - Intronic
1051014684 9:12460540-12460562 ATTTATCCCAGTGCACAGGCTGG + Intergenic
1052059268 9:23941213-23941235 CATTCTCCCAGTGCACAGGCAGG + Intergenic
1052795330 9:32918776-32918798 CGTCCTCCCAGTGCACAGGTGGG - Intergenic
1053380944 9:37649763-37649785 CGTGTTCCCAGTGCACTGGCAGG - Intronic
1054758780 9:68985671-68985693 CAATGTCCCAGGGCACATGCTGG - Intronic
1055202541 9:73684379-73684401 CATTCTCCCAGTGTGTAGGTGGG + Intergenic
1056350580 9:85744700-85744722 CATTCCCCCAGTGTGCACGCGGG + Intergenic
1056886933 9:90451866-90451888 CAATCTCCCAGTGCAAAGACAGG + Intergenic
1057128740 9:92638888-92638910 CACATTCCCAGGGCACAGGCAGG + Intronic
1057269058 9:93636878-93636900 CATGCTCCCATGGCCCAGGCAGG + Intronic
1059167531 9:112093341-112093363 CCTTGTACCTGTGCACAGGCGGG - Intronic
1059833070 9:118120191-118120213 TTTTCTCCCAGAGCACAGGCTGG - Intergenic
1060260356 9:122069246-122069268 GAGTCTCCCACTGCACAGGTAGG - Intronic
1061680082 9:132238699-132238721 CCCTCCCCCAGTGCACAGCCAGG + Intronic
1185579260 X:1197970-1197992 CATTCTCATGGTGCCCAGGCTGG - Intronic
1186832337 X:13403505-13403527 ACTTCTCCCAGTGCAAAGGCTGG - Intergenic
1187084684 X:16029684-16029706 GGCTCTCCCAGTGCACAGGCTGG - Intergenic
1187248672 X:17576924-17576946 TCTCCTCCCAGTGCACAGACAGG + Intronic
1188212256 X:27440525-27440547 CATTCCCCCAGTGCGCACGCAGG + Intergenic
1188212890 X:27444601-27444623 CATTCTCCCAGTGCGCATGTGGG + Intergenic
1188220597 X:27536792-27536814 CGTTCTCCTGGTGCACAGGCGGG + Intergenic
1188518129 X:31009477-31009499 CATTGCCCCAGTGCACATGTGGG - Intergenic
1189187619 X:39067676-39067698 CAGTCTCCTAGAGCCCAGGCTGG + Intergenic
1189649764 X:43176891-43176913 CATGCTTCCAGTGAGCAGGCCGG - Intergenic
1190796139 X:53744506-53744528 CATTCTCCTGGTGCACATGTTGG + Intergenic
1191189983 X:57656260-57656282 CATCCTCCCAGTGCACAGATTGG - Intergenic
1191638131 X:63400505-63400527 CATTCTCCCAGTGTGCAGGGAGG - Intergenic
1191638519 X:63404345-63404367 CATCCTCCCAGTGCATATGCAGG + Intergenic
1193487108 X:82099631-82099653 CATTTACCCAGTGCTCATGCAGG + Intergenic
1193698222 X:84735320-84735342 CATCCTTCCAGTGCACATGTGGG - Intergenic
1193945544 X:87728751-87728773 CACATTCCCATTGCACAGGCTGG + Intergenic
1194088908 X:89562320-89562342 TGTTCTCCCAGTGCACAGGCCGG + Intergenic
1194653044 X:96538404-96538426 TGTTCTTCCAGTGCGCAGGCCGG - Intergenic
1194809673 X:98375078-98375100 CATCCACCCAGTGCACAGGTGGG + Intergenic
1197061741 X:122190002-122190024 CACATTCCCAGTGCGCAGGCTGG - Intergenic
1197299419 X:124760049-124760071 CTTCCTCCCAGTGCACAGGTGGG - Intronic
1197509799 X:127356501-127356523 CATCCTTCCAGTGCACAAGCAGG - Intergenic
1199701573 X:150381293-150381315 CCTTCACCCAGTTCACAGCCAGG + Intronic
1200234193 X:154460288-154460310 CAGTCACCCGGTGCACAGCCAGG - Exonic
1200441584 Y:3218374-3218396 TGTTCTCCCAGTGCACAGGCCGG + Intergenic
1200898237 Y:8399701-8399723 TCTTTTCCCAGTGCACAGGTGGG - Intergenic
1201221328 Y:11773624-11773646 CATCTTTCCAGTGCACATGCAGG + Intergenic
1202244529 Y:22805337-22805359 CCTTTTCCCATTGCACAGGTAGG + Intergenic
1202397518 Y:24439083-24439105 CCTTTTCCCATTGCACAGGTAGG + Intergenic
1202473263 Y:25231004-25231026 CCTTTTCCCATTGCACAGGTAGG - Intergenic