ID: 1014674725

View in Genome Browser
Species Human (GRCh38)
Location 6:124349335-124349357
Sequence CTCCCAGTGCACAGGCCGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 4, 1: 25, 2: 73, 3: 121, 4: 212}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014674714_1014674725 16 Left 1014674714 6:124349296-124349318 CCCTACAAAGGCGGGAACTTCCC 0: 1
1: 0
2: 0
3: 6
4: 65
Right 1014674725 6:124349335-124349357 CTCCCAGTGCACAGGCCGGTTGG 0: 4
1: 25
2: 73
3: 121
4: 212
1014674711_1014674725 19 Left 1014674711 6:124349293-124349315 CCCCCCTACAAAGGCGGGAACTT 0: 1
1: 0
2: 2
3: 11
4: 62
Right 1014674725 6:124349335-124349357 CTCCCAGTGCACAGGCCGGTTGG 0: 4
1: 25
2: 73
3: 121
4: 212
1014674712_1014674725 18 Left 1014674712 6:124349294-124349316 CCCCCTACAAAGGCGGGAACTTC 0: 1
1: 0
2: 0
3: 1
4: 70
Right 1014674725 6:124349335-124349357 CTCCCAGTGCACAGGCCGGTTGG 0: 4
1: 25
2: 73
3: 121
4: 212
1014674718_1014674725 -5 Left 1014674718 6:124349317-124349339 CCGAGGCTCCACCCCATTCTCCC 0: 1
1: 22
2: 43
3: 127
4: 777
Right 1014674725 6:124349335-124349357 CTCCCAGTGCACAGGCCGGTTGG 0: 4
1: 25
2: 73
3: 121
4: 212
1014674708_1014674725 25 Left 1014674708 6:124349287-124349309 CCTGCTCCCCCCTACAAAGGCGG 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1014674725 6:124349335-124349357 CTCCCAGTGCACAGGCCGGTTGG 0: 4
1: 25
2: 73
3: 121
4: 212
1014674717_1014674725 -4 Left 1014674717 6:124349316-124349338 CCCGAGGCTCCACCCCATTCTCC 0: 2
1: 27
2: 47
3: 147
4: 614
Right 1014674725 6:124349335-124349357 CTCCCAGTGCACAGGCCGGTTGG 0: 4
1: 25
2: 73
3: 121
4: 212
1014674715_1014674725 15 Left 1014674715 6:124349297-124349319 CCTACAAAGGCGGGAACTTCCCG 0: 1
1: 0
2: 1
3: 4
4: 37
Right 1014674725 6:124349335-124349357 CTCCCAGTGCACAGGCCGGTTGG 0: 4
1: 25
2: 73
3: 121
4: 212
1014674713_1014674725 17 Left 1014674713 6:124349295-124349317 CCCCTACAAAGGCGGGAACTTCC 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1014674725 6:124349335-124349357 CTCCCAGTGCACAGGCCGGTTGG 0: 4
1: 25
2: 73
3: 121
4: 212
1014674706_1014674725 29 Left 1014674706 6:124349283-124349305 CCAGCCTGCTCCCCCCTACAAAG 0: 1
1: 0
2: 1
3: 20
4: 288
Right 1014674725 6:124349335-124349357 CTCCCAGTGCACAGGCCGGTTGG 0: 4
1: 25
2: 73
3: 121
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014674725 Original CRISPR CTCCCAGTGCACAGGCCGGT TGG Intronic
900727631 1:4228213-4228235 CTCCCAGTGTGCAGGCCCGTGGG - Intergenic
901659218 1:10788319-10788341 CTCCCAGTGCAGAGGCAGGCAGG + Intronic
901870775 1:12138162-12138184 CTCCCAGTTCAGAGACTGGTGGG + Intronic
902803427 1:18845744-18845766 ATCCCAGTGCACCTGCGGGTGGG + Intronic
903171849 1:21559173-21559195 CTCCCACTGCACAGAACGGGAGG - Intronic
903407303 1:23108564-23108586 CTCCCATTGCCCAGGCTGGAGGG - Intronic
903955406 1:27022045-27022067 TTCCCAGTGGACAGGGTGGTGGG - Intergenic
904246764 1:29193652-29193674 CTGGCAGTGCAAAGGCCAGTAGG - Intronic
905351420 1:37349202-37349224 CTCACAGTGCAATGGCCAGTCGG + Intergenic
906750042 1:48250737-48250759 CTCTCAGTGCATAGGCCAGTTGG - Intergenic
909199365 1:72669982-72670004 CTCCAAGTACACAGGCTGGTTGG + Intergenic
909601306 1:77464343-77464365 ACCCCAGTGCGCAGGCCGGTTGG + Intronic
911265101 1:95733924-95733946 CTCCCAGTGCACAAGCTGGTTGG + Intergenic
912080855 1:105933967-105933989 CTCCCAGTGCACAGGCTTGTTGG - Intergenic
913025360 1:114832858-114832880 CTCCCAGTGCACAGGCCAGTTGG + Intergenic
913030397 1:114897054-114897076 CTCCCAGTGCACAGGCTGGTCGG + Intronic
914240640 1:145850465-145850487 CTCCCAGTGGGAAGGCAGGTGGG + Exonic
915555878 1:156660456-156660478 CTCCCAGTGCACAGAATTGTTGG + Intergenic
917185851 1:172354449-172354471 CTCTCAGTGCTCAGGCTGGTGGG + Intronic
917210054 1:172622039-172622061 CTCCCAGTGCACAGGCTGGTTGG - Intergenic
918704247 1:187641163-187641185 ACCCCAGTGCACTGGCCGGTTGG - Intergenic
919280854 1:195486246-195486268 TTCCCAGTGCGCAGGCCCGTTGG + Intergenic
922002572 1:221494862-221494884 CTCCCAGTGAGCAGGCTGGTTGG + Intergenic
922549777 1:226485454-226485476 CTCCCAGTGCACAGGCCAGTTGG - Intergenic
922858532 1:228795759-228795781 CACCCAGCGCACTGGCCAGTTGG - Intergenic
923914428 1:238486087-238486109 ACCCCAGTGTGCAGGCCGGTTGG + Intergenic
1062955582 10:1538351-1538373 CTTCCAGAGCACAAGCCGGAGGG + Intronic
1063281351 10:4632887-4632909 CTCCCCATGCGCAGGCTGGTCGG - Intergenic
1064949879 10:20836585-20836607 TTCCCAGTGCACAGGCCAGTTGG - Intronic
1065852120 10:29799316-29799338 TTCCCAGTGCCCAGTCCAGTGGG + Intergenic
1066783661 10:38979246-38979268 CTCTCAGTGTGCAGGCCAGTGGG - Intergenic
1066979187 10:42396047-42396069 CTCCCAGTGTGCAGGCCGGTGGG + Intergenic
1067270275 10:44785672-44785694 ATCCCAGTGCACAGGCAGGCAGG - Intergenic
1067721734 10:48732438-48732460 CTCCCACTGCACTGGCTGGAAGG + Intronic
1068428403 10:56898360-56898382 CTCCCAGTGCACAGGCGGGCCGG + Intergenic
1068878390 10:62022391-62022413 CTCCCAGTGCACAGGTCAGTGGG - Intronic
1069075230 10:64032071-64032093 CTCCCAGTGCGCAGGCCAGTTGG + Intergenic
1069197390 10:65570424-65570446 TTCCCAGTGCGCAGGCTGGTTGG - Intergenic
1069590307 10:69637342-69637364 CCCCAAGTGCCCAGGCAGGTGGG + Intergenic
1069614190 10:69796423-69796445 CTACCTGTGCAAAGGCCTGTAGG - Intergenic
1070406303 10:76100471-76100493 CTCCCAGTGTGCAGGCAGGTCGG + Intronic
1071044813 10:81361112-81361134 CTCCCAGTGTGCAGGCCAGTTGG - Intergenic
1071137770 10:82471323-82471345 CTCCCAGTGTGCAGGCCTGTTGG + Intronic
1071326066 10:84519447-84519469 CTCCCAGTGCACAAGCTGGTTGG + Intergenic
1072287901 10:93934315-93934337 CTCCCAGTGCGGAGGCCAGTTGG - Intronic
1077329941 11:1979774-1979796 CCACCCGTGCACAGGCCTGTGGG + Intronic
1077493649 11:2874389-2874411 CCCCCAGAGCACTGGGCGGTGGG + Intergenic
1078680974 11:13475329-13475351 CTCTCAGTGCACAGGCTGGTTGG + Intergenic
1079884045 11:25964022-25964044 TTCCCAGTGCCCAGGTCGGCTGG - Intergenic
1080938154 11:36884371-36884393 CTACCAGTGCACAGGACTCTTGG - Intergenic
1081011675 11:37820738-37820760 CCCCCAGTGTGCAGGCTGGTTGG + Intergenic
1081100630 11:38997274-38997296 CTCCCAGTGCTCAGGCTGGCTGG + Intergenic
1081544716 11:44062645-44062667 CTCCCAGTGCACAGATGGGTTGG - Intergenic
1082026801 11:47578630-47578652 CTCCCAGTGCCCCGGCCTGGGGG - Intronic
1082659780 11:55895556-55895578 CACGCAGTACATAGGCCGGTTGG - Intergenic
1082938031 11:58674797-58674819 CTCCCAGTGCGCAGGCCAGTCGG - Intronic
1084038321 11:66526882-66526904 CTCCCAGTGCACAGGGAGGCTGG - Intronic
1084546440 11:69817362-69817384 TTCCCAGTGCGCAGGCTGGGCGG + Intronic
1085519248 11:77128504-77128526 CTCCCAATGCCCAGGACAGTGGG - Intronic
1086974481 11:93116688-93116710 CTCCCAGTGCATAGGCTGGTTGG - Intergenic
1087462814 11:98466802-98466824 CTCCCACTTCCCAGGCCAGTGGG - Intergenic
1087716833 11:101617950-101617972 CTCCCAGCGCGCAGGCCAGTAGG + Intronic
1087840096 11:102911726-102911748 CTCCCAGTGCGCAGGCTGGTTGG - Intergenic
1088010465 11:104994974-104994996 TTCCCAGTGCACAGTCTGGTGGG - Intronic
1089079647 11:115765093-115765115 CTCCCAGTGAACAGGGAGGAGGG - Intergenic
1089514949 11:119026497-119026519 GTCCCAGGGCACAGGCAGGTTGG - Intronic
1089977913 11:122748436-122748458 CTCCGAGTGCACAGGGAGCTGGG - Intronic
1090487596 11:127127836-127127858 ACCCCAGTGCACGGGCCGGTTGG + Intergenic
1202812919 11_KI270721v1_random:34953-34975 CCACCCGTGCACAGGCCTGTGGG + Intergenic
1091670578 12:2449442-2449464 CTCCCAGTGCGCAGGCTGGCTGG + Intronic
1092035622 12:5332257-5332279 CTCCCAGTGCACTGGGTGGTGGG - Intergenic
1092720534 12:11436112-11436134 CTCCCAGTGCAAAGGCGGGCTGG + Intronic
1092737066 12:11592692-11592714 CTCCCAGTGCGCAGACAGGTCGG + Intergenic
1093157597 12:15706209-15706231 ACCCCAGTGCACAGGCCGGCAGG - Intronic
1093715313 12:22375622-22375644 CTCCCACTGTGCAGGCTGGTGGG - Intronic
1093921988 12:24869265-24869287 CTCCCAGTGTGCAGGCCGGTTGG - Intronic
1094472563 12:30817227-30817249 CTCCCAGTGCACAGGCCAGTCGG - Intergenic
1095157748 12:38879148-38879170 TTCCCAGTGCACAGGCTGGTTGG - Intronic
1095260950 12:40098911-40098933 CTCCCAGTGCAGCGGCAGGGTGG + Intronic
1097180638 12:57169808-57169830 CTCCCAGTGCCCTGGCCTCTGGG + Intronic
1097350004 12:58538243-58538265 CTCCCAGTGGAAAGGTGGGTTGG - Intergenic
1099150699 12:79109197-79109219 CTCCCAATGTTCAGGCCAGTTGG + Intronic
1100271537 12:93029889-93029911 CTCCCGGGGAGCAGGCCGGTTGG - Intergenic
1100321236 12:93494969-93494991 TTCCCAGTGCACAAGCTGGTCGG - Intronic
1102162683 12:110782328-110782350 CTCCCAGTGGGCAGGCTAGTTGG + Intergenic
1103872114 12:124099542-124099564 CTCCAAGGACACAGGCAGGTTGG + Intronic
1104336253 12:127898775-127898797 CTCCCAATGAGCAGGCCGGACGG - Intergenic
1105980904 13:25515199-25515221 GTTCCAGTCCAAAGGCCGGTGGG - Intronic
1106100334 13:26689849-26689871 CTCCCAGAGCTCAGTCTGGTGGG - Intergenic
1107852841 13:44588282-44588304 CTCCCAGTGTGCAGGCCAGTTGG - Intergenic
1108000351 13:45900449-45900471 CTCCCAGTGTGCAGGCCAGTTGG + Intergenic
1109463004 13:62687984-62688006 CACTCAGTGGACAGGCTGGTTGG + Intergenic
1109865837 13:68261437-68261459 ATTCCAGTGCGCAGGCTGGTTGG - Intergenic
1110413292 13:75226305-75226327 CTCCCAGTGCGCAGGCGGGTTGG - Intergenic
1110508179 13:76314742-76314764 CTCCCAGTGCATAAGCCGGTTGG + Intergenic
1111357669 13:87129966-87129988 CTCCCAGTCCAAAGGCAGGCAGG + Intergenic
1112015342 13:95326856-95326878 CTCCCAGTGTACCGGCTGGGCGG - Intergenic
1112065053 13:95783994-95784016 CTCCCAGCGTGCAGGCCAGTTGG + Intronic
1112260713 13:97875458-97875480 CTCCCAGTGCGCAGGCCAGTTGG + Intergenic
1112286148 13:98106129-98106151 GTCCCAGCACACAGGCAGGTTGG + Intergenic
1112549899 13:100409573-100409595 ACCCCAGTGCACAGGCCAGTTGG + Intronic
1112605789 13:100904509-100904531 CTCCCAGTGCACAGGCCTGTGGG + Intergenic
1113217861 13:108063319-108063341 ACCTCAGTGCACAGGCCAGTTGG + Intergenic
1113338691 13:109401425-109401447 CTCCCAGGGCGCAGGCCGGTTGG - Intergenic
1114007025 14:18325009-18325031 CTGCCAGTGTGCAAGCCGGTCGG - Intergenic
1114218266 14:20673958-20673980 GTCCCAGTGCGCAGGCTGGTCGG + Intergenic
1114387179 14:22267490-22267512 ACCCCAGTGCACAGGCTGCTTGG + Intergenic
1116256423 14:42562277-42562299 CTACCAGTGCACTGGTCAGTCGG + Intergenic
1116384873 14:44317595-44317617 CTCCCAGTGTGCAGGTTGGTTGG + Intergenic
1117057346 14:51926589-51926611 TGCCCAGTGCGCAGGCCGGTAGG - Intronic
1118378026 14:65193586-65193608 CTCCCAGTGCACAGGCTGGTTGG + Intergenic
1118395841 14:65335788-65335810 CTCCCAGTGCGCAGGCCAGTCGG + Intergenic
1118550590 14:66945351-66945373 CTCCCAGTGTGCAGGCCAGTTGG + Intronic
1120185758 14:81392236-81392258 ACCCCAGTGCACAGGCCAGTTGG - Intronic
1120314409 14:82872817-82872839 ACCCCAGTGTGCAGGCCGGTTGG - Intergenic
1120477078 14:85001965-85001987 ACCCCAGTGCGCAGGCAGGTTGG + Intergenic
1121265855 14:92602239-92602261 TGCCCAGTGCCCAGGCCAGTGGG + Intronic
1121408214 14:93732311-93732333 CTGCAAGTGCACAGGCCTGTGGG + Intronic
1122745019 14:103892376-103892398 CTCCCAGTGCCCAGGGCTGGGGG + Intergenic
1124800574 15:32828880-32828902 CTCCCAGTGAACAGGGAGATAGG + Intronic
1125933211 15:43614462-43614484 ATCCCACAGCACAGGCTGGTGGG + Exonic
1125946309 15:43713924-43713946 ATCCCACAGCACAGGCTGGTGGG + Intergenic
1126570647 15:50146926-50146948 TTCCCAGTGCACAAGCCAGTTGG + Intronic
1128088980 15:64906126-64906148 GTCCCAGTGGACTGGCCGGGTGG + Intronic
1128451394 15:67807718-67807740 CTCCCAGTGCCCAAGCCATTTGG + Intergenic
1129182639 15:73886858-73886880 CTCCCACTGCACAGGCCATAGGG - Intronic
1129335717 15:74851034-74851056 CTCAGAGTTCACAGGCCTGTGGG + Intronic
1129921442 15:79322523-79322545 CTCCAAGTGCCCAGGCCTCTTGG + Exonic
1131046416 15:89319282-89319304 CTCCCAGTGGACAGGACTGAGGG - Exonic
1131157402 15:90083771-90083793 CACTCAGGGCACAGGCCTGTGGG - Exonic
1131526569 15:93157542-93157564 CTCAAAGGGCACAGGCCGGGTGG + Intergenic
1132301465 15:100778903-100778925 TTCCCAGGGGCCAGGCCGGTCGG + Intergenic
1132504944 16:303218-303240 CTCCCAGTGCGCAGGCCGGCTGG - Intronic
1132783555 16:1641933-1641955 TTCCCAGTGCACAGCCTGGTGGG + Intronic
1135077640 16:19407798-19407820 CTCCCAGTGTGCAGGCCAGTTGG + Intergenic
1137330786 16:47493135-47493157 CTCCCAGTGTGCAGGCCAGTTGG + Intronic
1137354312 16:47744698-47744720 CTCTTAGTGCTCAGGCGGGTGGG + Intergenic
1138174502 16:54884455-54884477 CTCCCAGTGTGCAGGCTGGTGGG - Intergenic
1138730104 16:59184955-59184977 CACACAGTGCACAGGCCAGAGGG - Intergenic
1140442498 16:74998876-74998898 CGCCCAGGTCACAGGCCGGCCGG + Intronic
1140740581 16:77937677-77937699 CTCCCAGTGAATAGGCCAGTTGG + Intronic
1141421242 16:83917933-83917955 TTCCCGCTGCACAGGCCGCTGGG + Exonic
1141646416 16:85370304-85370326 CGCCCAGTGCACTGGAAGGTGGG - Intergenic
1147980013 17:44268421-44268443 CTCCCAGTGCCCTGGCAGGAAGG + Intergenic
1148322233 17:46764459-46764481 CTCCCCGTCCACAGGCGAGTTGG + Exonic
1148972101 17:51492565-51492587 CTGCCAGTGCAAAGGCCCTTAGG + Intergenic
1149094500 17:52824735-52824757 ACCCCAGTGCATAGGGCGGTTGG + Intergenic
1150143914 17:62752322-62752344 CTCCCAGAGCACTTGCTGGTAGG - Intronic
1150649005 17:66997781-66997803 CTCCCATTGCCCAGGCTGGAGGG - Intronic
1151997549 17:77619496-77619518 CTCCCAGTACGCAGGCCGGCTGG - Intergenic
1152423227 17:80205127-80205149 CTCCTCGTGCCCAGGGCGGTTGG + Exonic
1152534675 17:80943578-80943600 GTCCCAGTGTGCAGGCTGGTGGG + Intronic
1154040226 18:10847477-10847499 CACGCAGTGCAAAGGCCCGTGGG + Intronic
1154244003 18:12679266-12679288 CTCCCAGTGCACAGGCTGGTTGG - Intronic
1155479713 18:26272137-26272159 CTCCCAGTGGGCAGGCGCGTGGG + Intronic
1155606827 18:27615878-27615900 TTCCCAGCGCCCAGGCCGGTCGG - Intergenic
1155797651 18:30060030-30060052 CTCCCAGTGTGCAGGCTGGTTGG + Intergenic
1158151785 18:54382365-54382387 CTCTCAGTGCACAGGCCAGTTGG + Intronic
1158152451 18:54387864-54387886 ATCCCAGTGCACAGGCCTGTTGG + Intergenic
1158968241 18:62642534-62642556 CTCCCAGTGCGCAGGCCAGTGGG + Intergenic
1160264000 18:77322883-77322905 CTCCGAGTGCACACTCAGGTTGG + Intergenic
1168161875 19:54515869-54515891 CTCCAAGGGCACAGACCTGTGGG - Intergenic
925160626 2:1681134-1681156 CTCCCAGTGCACAGGCCGGCTGG - Intronic
926344462 2:11932515-11932537 ATCCCAGTGCACAGGCCGGGTGG + Intergenic
926829112 2:16941166-16941188 CTCCCAGTGTGCAGGCTGATCGG - Intergenic
926838860 2:17056356-17056378 CTCCCAGTGCTCAGGCCCATTGG - Intergenic
929093268 2:38240475-38240497 CTCCCACTGCACAGACCCCTGGG - Intergenic
929115711 2:38442226-38442248 CTCCCAGTGCACAGGTTGGTCGG - Intergenic
929238023 2:39626879-39626901 CTCCCTGTGCACAGGCCTGTCGG + Intergenic
931833412 2:66075198-66075220 CTCCAAGTGCACAGGTCAGCAGG - Intergenic
931938744 2:67228717-67228739 CTCCCAGTGCATAGGCAGGTTGG + Intergenic
932284071 2:70518100-70518122 CACACAGTGCACAGGCCTGGTGG + Intronic
933130816 2:78672715-78672737 CTCCCAATGCGCAGACTGGTTGG + Intergenic
933495098 2:83040620-83040642 CTCCCAGTGAGCAGGCTGGCTGG + Intergenic
933541409 2:83647697-83647719 CTCCCAGTGCGCAGGCGGGATGG - Intergenic
933849993 2:86358340-86358362 CTGCCAGTGCTCAGGGGGGTGGG - Intergenic
934158022 2:89221340-89221362 CTGACAGTGCAGAGGCAGGTGGG - Intergenic
934209243 2:89961084-89961106 CTGACAGTGCAGAGGCAGGTGGG + Intergenic
934860125 2:97757788-97757810 ATTGCAGTGCACAGGCCGATGGG - Intronic
934931524 2:98429641-98429663 CTCCCAGTGCACAGGCCAGCGGG - Intergenic
934932373 2:98436932-98436954 CTCCCAGTGTGCAGGCCCATGGG - Intergenic
935264218 2:101380967-101380989 TTTCCAGTGCACAGGCTGGAAGG + Intronic
936578598 2:113676025-113676047 CTCCCAGTGCGCAGGCCATTTGG - Intergenic
937649036 2:124299238-124299260 CTCCCAGTGCACAGGCTGGTTGG + Intronic
938705086 2:133916819-133916841 CTCCCAGTGTGCAGGCTGGTTGG - Intergenic
938850895 2:135258331-135258353 CTCCCAATGCACAGGCAGGTTGG - Intronic
939840394 2:147181073-147181095 CTCCCAGAGCACAGGCTGGTTGG + Intergenic
940391090 2:153133325-153133347 CTCCCAGTGCATAGGCCCCTTGG - Intergenic
940612782 2:156011346-156011368 CTCCCAGTGCACAGGCCAGCTGG - Intergenic
941249330 2:163143559-163143581 CTCCCAGTACACAGGCTAGTTGG - Intergenic
941625203 2:167823712-167823734 TTCCAAGTACACAGGCCAGTGGG + Intergenic
942457986 2:176150971-176150993 CTACCAGTGCCCAGGCCCGGGGG - Intergenic
942605222 2:177683497-177683519 CTCCCAATGCGCAGGCGGGTTGG - Intronic
942943320 2:181645447-181645469 CTCCCAGTGAACAGGGCAGGTGG - Intronic
943258558 2:185629132-185629154 CTCCTAGTGCGCAGGCTGGTTGG + Intergenic
944073082 2:195695117-195695139 CTCTCAGTGCTCAAGCCAGTTGG + Intronic
944907475 2:204276914-204276936 CTACCAGTGCACATTCCAGTTGG - Intergenic
944964390 2:204914064-204914086 CTCCCAGCGTGCAGGCCAGTTGG - Intronic
945051786 2:205830939-205830961 CTCCCAGTGCACAGGCCAGTTGG - Intergenic
945217238 2:207446820-207446842 CTCCCAGTGCGCAGGCTGGTTGG - Intergenic
945631889 2:212288455-212288477 CTCCCAGTGCTCAGGCCTGTGGG - Intronic
946875414 2:224125214-224125236 CTCACAGTTTACAGGCTGGTAGG + Intergenic
946885371 2:224217337-224217359 CTCCCAGTGCACAGGCTGGTTGG - Intergenic
947136273 2:226979493-226979515 CTCCCATTGCACAGGTCAGTTGG + Intronic
947227901 2:227857770-227857792 CTCCCAGTGTTCAGGCCGGTTGG + Intergenic
947819382 2:233059776-233059798 CTCCCAGCACCCAGGCCGCTGGG + Intergenic
948930023 2:241126139-241126161 CTCCCAGAGCACAGTGCAGTGGG - Intronic
1169699699 20:8432339-8432361 CTCCCAGTGTGCAGGCTGGTTGG + Intronic
1169967800 20:11236813-11236835 ACCCTAGTGCACAGGCTGGTTGG + Intergenic
1170335673 20:15267742-15267764 CTCCCAGTGCTCAGGTCAGTCGG - Intronic
1171933341 20:31248382-31248404 CTCCCAGTGCACCGGCCTGTTGG + Intergenic
1172776364 20:37409512-37409534 CAGCCTGTGCACAGGCAGGTGGG - Intergenic
1173428696 20:42966588-42966610 CACCCAGTGAACAAGACGGTGGG + Intronic
1175220041 20:57411643-57411665 CGGCCAGTGCACAGGCAGGCAGG + Intergenic
1175232703 20:57483966-57483988 CTCCCAGTGCACATGCCCCAAGG - Intergenic
1176886423 21:14261328-14261350 CTCCCAGTGCACAGGCCGATTGG - Intergenic
1176972344 21:15281172-15281194 CTCCCAGCGCACTGGCCAGTCGG + Intergenic
1177405511 21:20662694-20662716 CTCCCAGTGCTCAGGCCAGTTGG - Intergenic
1178044281 21:28676575-28676597 CTCCCAGTGTGCAGGCCAGTTGG - Intergenic
1179286787 21:39984456-39984478 CACGCAGTCCACAGGCCGATGGG - Intergenic
1179982496 21:44903606-44903628 GTGCCAGTGCACAGCCCGCTCGG - Intronic
1180153147 21:45962743-45962765 CTCCCAGTGCACAGGCAGATTGG + Intergenic
1180431533 22:15255819-15255841 CTGCCAGTGTGCAAGCCGGTCGG - Intergenic
1180843121 22:18968420-18968442 CTCCCACTGCACAGACAGGTGGG + Intergenic
1180965242 22:19784738-19784760 GTCCCACTCCACTGGCCGGTGGG - Exonic
1181409856 22:22711218-22711240 CTCCCAGAGCAAAGGCAGGGAGG - Intergenic
1181514891 22:23404767-23404789 CTCCCACTGCACAGACCTGTGGG - Intergenic
1182516999 22:30864676-30864698 CTGGCAGGGGACAGGCCGGTGGG - Intronic
1182723396 22:32422895-32422917 TTCCCAGTCCACAGCCTGGTGGG - Intronic
949363047 3:3252107-3252129 CTCCCAGTGCGTGGGCTGGTGGG + Intergenic
949805317 3:7949301-7949323 CTCCAAGTGTGCAGGCCGGCTGG - Intergenic
952192886 3:31042715-31042737 CTCCCAGTGTGCAGGCTGGCTGG - Intergenic
953117861 3:40010456-40010478 CTCTCATTTCACAGGCCTGTAGG - Intronic
953378949 3:42452117-42452139 CTCCCAGTGAACAGGCTGGTTGG + Intergenic
954598311 3:51846277-51846299 CTCCCAGTGTGCAGGTTGGTTGG + Intergenic
954968679 3:54633661-54633683 CTCCCAGTGTACAGGCTGGTTGG + Intronic
955037477 3:55283144-55283166 CTCCCAGTGTGCAGGCCAGTTGG - Intergenic
955612748 3:60775336-60775358 ACCCCGGTGCACAGGCCAGTTGG - Intronic
956156491 3:66303848-66303870 TTCCAAATGCACAGGGCGGTTGG + Intronic
957288714 3:78249465-78249487 TTCCCACAGCACAGGCCGGCTGG - Intergenic
957986787 3:87582316-87582338 CTCCCAGAGCGCAGGGTGGTTGG - Intergenic
958536183 3:95407777-95407799 CTTCCAGTGCACAGGTATGTTGG - Intergenic
958536691 3:95412652-95412674 CTCCCAGTGTGCAGGTGGGTTGG - Intergenic
958974690 3:100654148-100654170 CTCCCAGTGCGCGGGTCAGTTGG + Intronic
959572941 3:107904911-107904933 CTCCCAGTGTGCAGGCCAGTAGG + Intergenic
959574015 3:107914737-107914759 CTCCCAGAGCACAGGCCAATAGG - Intergenic
959685399 3:109140456-109140478 CTCCCAGTGACCAGGCTGGTCGG + Intergenic
959820534 3:110730037-110730059 CTCCCAGTGCACAGGTTGGTTGG - Intergenic
960768526 3:121165812-121165834 CTCCCAGTGGGCAGGCCGGTTGG + Intronic
964073115 3:152659208-152659230 CTCCCAGCACACAGGCCAGTTGG + Intergenic
964304439 3:155325576-155325598 CTCCTAGTGTGCATGCCGGTTGG - Intergenic
964361992 3:155908233-155908255 CTCCCAGTAGGCAGGCTGGTGGG - Intronic
965076689 3:163988547-163988569 CTCCCAGTGCACAGACCAGTTGG - Intergenic
965224894 3:165975432-165975454 CTACCAGTGCGCAGGCTGGTTGG + Intergenic
965240212 3:166187409-166187431 CTCCCAGTGTGCAGGCCAGTTGG + Intergenic
967054930 3:185823733-185823755 CCCCCACTCCACACGCCGGTGGG + Intronic
968648421 4:1751061-1751083 CTCCCATGGAACATGCCGGTTGG + Intergenic
969190670 4:5516215-5516237 TTCCCAGTGCACAGGCCAGTTGG - Intergenic
969442417 4:7225283-7225305 CTCACAGTTCACAGTCCAGTGGG - Intronic
969571030 4:8008471-8008493 CTCCCCGTGCAGAGCCCTGTGGG - Intronic
970112228 4:12651264-12651286 TTCCCAGTGCACAGGCCAGCTGG - Intergenic
970721300 4:18992535-18992557 CTCCCAGTGCACAGGCCGGTTGG - Intergenic
970980366 4:22089166-22089188 CTCCCAGTGCACAGGATGATTGG + Intergenic
971364363 4:25965797-25965819 CTTCCAGTGCGCATGCTGGTTGG - Intergenic
971846477 4:31924884-31924906 CTCCCAGTGTGCAGGCCAGTTGG + Intergenic
972657273 4:41076510-41076532 TTCCCAGAGCACTGGCCAGTAGG + Intronic
973226448 4:47790281-47790303 CTCCCAGTGCGCAGGCCAGTCGG - Intronic
974159038 4:58113169-58113191 CTTCCAGTGCACAGGTCTGTTGG + Intergenic
974960735 4:68697066-68697088 CTCCCAGTGCACAGGCTCTCTGG - Intergenic
974963976 4:68737041-68737063 CTCCCAGTGCACAGGCTTGTTGG + Intergenic
976344886 4:83989470-83989492 CTCCCAGTGCACACGCTGGCTGG - Intergenic
976345417 4:83994094-83994116 CTCCCAGTGCACAGGCTGGCTGG - Intergenic
976690757 4:87864578-87864600 CTCCCAGTGGGCAGGCTGGTTGG + Intergenic
976826208 4:89263383-89263405 CCGCCAGTGCACAGGCTGGATGG - Intronic
978328517 4:107586494-107586516 CTCCCAGTGTGCAGGCCAGTTGG + Intergenic
979104189 4:116663893-116663915 CTCCCAGTGCGCAGGCCAATTGG - Intergenic
979609419 4:122673498-122673520 CTCCAAGTACACAGGCTGGTTGG + Intergenic
979624952 4:122834237-122834259 CTCCCAGTGTGCAGGCCATTTGG + Intronic
980723005 4:136721265-136721287 ACCCCAGTGCACAGGCTGGTTGG - Intergenic
981456866 4:144962627-144962649 CTCCCAGTGCACAGGTGGGTTGG - Intergenic
981491113 4:145340466-145340488 CTCCCAGTGCGCATGCTTGTCGG - Intergenic
982890052 4:160835944-160835966 CCCTCAGTGAGCAGGCCGGTTGG - Intergenic
983040618 4:162921305-162921327 CTCCCAGTGGGCAGGCCAGTTGG - Intergenic
984241837 4:177227780-177227802 CCCTCACTGCCCAGGCCGGTGGG + Intergenic
984414942 4:179446231-179446253 CTCCCAGTGCTCAGATTGGTTGG + Intergenic
984896949 4:184549265-184549287 ACCCCGGTGCACAGGCCGGTTGG + Intergenic
985551127 5:534165-534187 CTCCCTGTGGACCTGCCGGTGGG - Intergenic
986177849 5:5366965-5366987 CTCCCAGTGTGCAGGCCGGTAGG + Intergenic
986213286 5:5694519-5694541 CTTCCAGTGTGCAGGTCGGTTGG - Intergenic
986293087 5:6416018-6416040 CTCTCTGTGCACTGGCCGCTGGG - Intergenic
987526789 5:19061235-19061257 CTCCCAGCGCATAGGCCTGTTGG + Intergenic
987568589 5:19625754-19625776 ACCCCAGTGCACAGGCCAGTTGG - Intronic
988849316 5:35163021-35163043 CTCCCAGTGCGCAAGTCGGTTGG - Intronic
988968899 5:36446176-36446198 CTCCCAGTGCGCAGGCCTGTCGG + Intergenic
989188028 5:38643526-38643548 TTCCCAGTGCGCAGACCGATTGG + Intergenic
989692368 5:44159336-44159358 CTCCCAGTGCACATGCCAGTTGG - Intergenic
990777092 5:59314938-59314960 GTCGCAGTGCACAGGCGGGCGGG - Intronic
990850407 5:60196506-60196528 CTCCCACTGCCCAGGCAGGAAGG - Intronic
992042333 5:72848319-72848341 CTCCCGGTGCACAGGCCCAGAGG - Intronic
994877717 5:105447042-105447064 CTCCCAGGGCCCAGGCTGATTGG - Intergenic
995470904 5:112501165-112501187 CTCCCAGTGCACAGGTCAGTGGG - Intergenic
996677013 5:126188049-126188071 CTCCCAGAGCGCAGGCTGGTGGG - Intergenic
997082687 5:130759196-130759218 CTCTCAGTGTACAGGCAGGTTGG - Intergenic
998741267 5:145204916-145204938 TTCCCAGTGCACAGGCTGGTTGG - Intergenic
999534219 5:152499719-152499741 CTCCCAGTGTGCAGGCTGATCGG + Intergenic
1000241803 5:159415703-159415725 CTCCCAGTGAGCAGGCCAGTCGG - Intergenic
1000556475 5:162732528-162732550 CTCCCAGTGTGCACGCAGGTGGG + Intergenic
1001084949 5:168693696-168693718 CTCCCAGGGTATAGGCAGGTAGG + Intronic
1001879893 5:175234280-175234302 CCCCCATTGCACAGGGCTGTGGG + Intergenic
1005055221 6:21722711-21722733 CTCCCAGTGCACAGGCAGGTGGG + Intergenic
1005564644 6:27078796-27078818 TTCCCAGTGCACAGGTGGGTCGG - Intergenic
1006245896 6:32735551-32735573 CTCCCAGTGCTCAGGCTGGCTGG - Intergenic
1007809517 6:44476142-44476164 CTCCCAGGGCAAAGCCCGGCAGG - Intergenic
1008243023 6:49135646-49135668 CTCCCAGTGCACAGGCCAGTTGG + Intergenic
1009603780 6:65838690-65838712 TTCTCAGTGCGCAGGCTGGTTGG - Intergenic
1010368122 6:75076250-75076272 CTCCCAGTGCGCAGGCCGGCTGG + Intergenic
1011215340 6:84999697-84999719 CTCCCAGTGCGCCGGCCGGTTGG - Intergenic
1011591269 6:88972636-88972658 CTCCCAGTGCACAGGCCAGCTGG - Intergenic
1012520797 6:100118778-100118800 CTCCCAGTGCACAGGCTGGTTGG + Intergenic
1012583062 6:100892246-100892268 CTCCCCATGCCCAGGCCAGTGGG - Intergenic
1012693760 6:102352803-102352825 CTCCCAGTGCACAGGCAGTGGGG + Intergenic
1012694203 6:102356336-102356358 CTCCCAGTTTACAAGCTGGTTGG + Intergenic
1012872291 6:104686713-104686735 CTCCTGGTACACAGGCCAGTTGG + Intergenic
1014452376 6:121596281-121596303 CTCCCAGTGCAGGGCCCGGTTGG - Intergenic
1014674725 6:124349335-124349357 CTCCCAGTGCACAGGCCGGTTGG + Intronic
1014747665 6:125219051-125219073 CTCCCAGTGCTCAGGCCGGTGGG + Intronic
1015858616 6:137652447-137652469 CTCACAGTGCACAGGCCAGTTGG - Intergenic
1015859120 6:137656858-137656880 CTCCCAGTGTGCAGACCGGTTGG - Intergenic
1016233210 6:141831123-141831145 CTCCCAGTGCACAGGCCAGTTGG + Intergenic
1016618367 6:146079116-146079138 TTCCCAGTGCACAGGCCAGTTGG + Intronic
1016686079 6:146883964-146883986 CTCCCAGTGCACAGGTCAGTTGG - Intergenic
1018151700 6:160945747-160945769 CTCCCACTGCCCAGGCAGGGGGG + Intergenic
1018376800 6:163220329-163220351 CTCCCAGTACTCAGGCCTCTTGG + Intronic
1018786202 6:167109902-167109924 CTGCCAATGCACACGTCGGTTGG + Intergenic
1019989847 7:4683215-4683237 CTCCAGGAGCCCAGGCCGGTGGG - Intronic
1020749662 7:12124259-12124281 TTCCCAGTGCTCAGGTCGGGTGG + Intergenic
1021320984 7:19211189-19211211 CTCTGAATGAACAGGCCGGTCGG + Intergenic
1021456543 7:20835387-20835409 CTCCCAGTGCACTGGCCGGTTGG + Intergenic
1021597899 7:22336610-22336632 CTCTCAGTGCACAGGCTGGTTGG - Intronic
1022322397 7:29299190-29299212 CTCCCACTGCGTAGACCGGTCGG + Intronic
1022679052 7:32526948-32526970 CTCCCAGTGTGCAGGCCAGTTGG + Intronic
1023005725 7:35864872-35864894 ATCCCAGTGCACAGGATGGAGGG + Intronic
1024035302 7:45503059-45503081 CTCCCAGTGTGCAGGCTGGTTGG + Intergenic
1024068366 7:45764457-45764479 ATCCCAGTGCACAGGATAGTAGG - Intergenic
1024437454 7:49376367-49376389 CACCTAGTGCACAGGTTGGTTGG - Intergenic
1024510169 7:50197649-50197671 CTCCCAGTTCCCAGGCTGGGAGG - Intergenic
1025217781 7:57073315-57073337 ATCCCAGTGCACAGGATGGAAGG - Intergenic
1025628695 7:63246953-63246975 ATCCCAGTGCACAGGATGGAAGG - Intergenic
1025653570 7:63497147-63497169 ATCCCAGTGCACAGGATGGAAGG + Intergenic
1025983874 7:66430419-66430441 ACCCCAGTGCACAGGCCAGCTGG + Intergenic
1026001124 7:66559291-66559313 ACCCCAGTGCACAGGCCGGTTGG + Intergenic
1026001138 7:66559333-66559355 ACCCCAGTGTACAGGCCGGTTGG + Intergenic
1027207079 7:76109171-76109193 ACCCCAGTGCACAGGCCGGTTGG + Intergenic
1027207091 7:76109213-76109235 ACCCCACTGCACAGGCCGGTTGG + Intergenic
1028738308 7:94243445-94243467 ACCCCAGTGCCCAGGCTGGTTGG - Intergenic
1029288589 7:99484269-99484291 CTCCCACTTCACAGGGCAGTAGG - Intronic
1031020962 7:116627005-116627027 CTCCCAGTGCACAGACCGGTTGG - Intergenic
1032329264 7:130962503-130962525 CTCCCAGTGCACAGGCTGGTGGG + Intergenic
1032580092 7:133096309-133096331 CTCCCAGTGTGCAGGCCAGTTGG + Intergenic
1033464372 7:141577712-141577734 CACCCAGTGCACAGGCCGGTTGG + Intronic
1033865539 7:145686870-145686892 TTCCCAGTGCACAGGCCAGTTGG - Intergenic
1035047516 7:155978478-155978500 CTCCCAGTGCACAGGGGGCTTGG - Intergenic
1035953548 8:4051209-4051231 CTCCCAGGGACCAGGCCTGTGGG + Intronic
1037623789 8:20590276-20590298 CTCCCAGTGTGCAGGCTGGTTGG - Intergenic
1037845521 8:22278642-22278664 CCCCCAGGCCACAGGCTGGTTGG + Intronic
1037856657 8:22376203-22376225 CACTCAGTGCACAGGCTGGAGGG + Intronic
1038370258 8:26981917-26981939 CTCCCAGTGCGGAGGTTGGTTGG - Intergenic
1038433024 8:27515031-27515053 ACCCCAGTGCACAGGCTGTTTGG - Intronic
1038864930 8:31429600-31429622 CTCCCAGCGCACAGGTCTGTTGG - Intergenic
1039352562 8:36779181-36779203 CTCCTAGTGCGCAGGCTCGTTGG - Intergenic
1039757596 8:40540160-40540182 ACCCCAGTGCACAGGCTGGTTGG - Intronic
1039802426 8:40970851-40970873 CTCCCAGTGCTCAGGCTGGTGGG + Intergenic
1040664411 8:49615539-49615561 CTCCCAGTGCACAGGCCAGTCGG + Intergenic
1040757976 8:50804258-50804280 CTCCCAGTTCAGAGACCAGTTGG - Intergenic
1040949687 8:52925023-52925045 ACCCCAGTGCACAGGACGGTTGG - Intergenic
1042451652 8:68954654-68954676 CTCCCAATGCACAGGCCAGTTGG - Intergenic
1042554996 8:70026802-70026824 CTCCCAGTGTGCAGGCCAGTTGG + Intergenic
1046132918 8:109990404-109990426 CTCCCAGTGCATAGGCTATTGGG + Intergenic
1046337913 8:112813960-112813982 CTCCCAGTGCACAAGCCAGTTGG + Intronic
1047254848 8:123207196-123207218 CTCCAAGTTCACAGGCCAGGCGG + Exonic
1047492276 8:125384746-125384768 CTCCCAGGGAGCAGGCCGGTTGG + Intergenic
1047704583 8:127484697-127484719 CTCCCAGTATGCAGGCTGGTTGG + Intergenic
1048176176 8:132154603-132154625 ATCCCATTGCACAGGCTGGTTGG - Intronic
1048649048 8:136454021-136454043 CTCCCCGTGCACAGGCTGGTTGG - Intergenic
1048742751 8:137580227-137580249 CTTCCAGTGCGCAGGCCAGGTGG + Intergenic
1049539815 8:143203231-143203253 CTCCCAGGGCTCAGGGCTGTTGG - Intergenic
1051014685 9:12460544-12460566 ATCCCAGTGCACAGGCTGGTTGG + Intergenic
1051251342 9:15161899-15161921 TTCCCAGTGCCCAGGCTGGTTGG - Intergenic
1051434531 9:17016880-17016902 CTTCCCATGCACAGGCCGGTTGG + Intergenic
1051994682 9:23200863-23200885 GTTCCAGTGCAAAGGCCGGAAGG - Intergenic
1052059891 9:23946729-23946751 CTCCCAGTGTACATACAGGTGGG + Intergenic
1052616653 9:30851168-30851190 CTCCCAGTGTGCAGGCTGGTTGG - Intergenic
1052617159 9:30855490-30855512 CTCCCAGTGTGCAGGCTGGTTGG - Intergenic
1052693554 9:31848588-31848610 CCCTCAGTGCACAGGCCGGCTGG - Intergenic
1052795328 9:32918772-32918794 CTCCCAGTGCACAGGTGGGTTGG - Intergenic
1055562624 9:77535767-77535789 CACCCGGTCCACAGGCTGGTTGG + Intronic
1056520357 9:87395516-87395538 TTCCCAGTGCCCAGGCTGGTTGG - Intergenic
1058207299 9:102124693-102124715 CACCCAGTGTGCAGGCTGGTTGG + Intergenic
1058626255 9:106936259-106936281 CGCCTAGTGCACAGCCTGGTGGG - Intronic
1058731734 9:107856876-107856898 CTCCCAGTGTGCAGGCTGGCTGG + Intergenic
1060192275 9:121600430-121600452 CTTCCAGTGCTCAGCCTGGTGGG + Intronic
1060747755 9:126148945-126148967 CTCCCAGTGGCCAGCCTGGTGGG + Intergenic
1061210040 9:129186187-129186209 CGCCCATTTCACAGGCCGGGAGG + Intergenic
1062541332 9:137042994-137043016 CTCCTGGTGCACATGCCTGTGGG - Exonic
1186825957 X:13340281-13340303 CTTCCAGTGTGCAGGTCGGTCGG + Intergenic
1186832336 X:13403501-13403523 CTCCCAGTGCAAAGGCTGGCTGG - Intergenic
1187084683 X:16029680-16029702 CTCCCAGTGCACAGGCTGGTTGG - Intergenic
1189042116 X:37553720-37553742 CACCCAGTGTGCAGGCTGGTTGG + Intronic
1189054586 X:37685786-37685808 GTTCCAGAGCCCAGGCCGGTCGG + Exonic
1189118710 X:38370567-38370589 CTCCCAATGTTCAGGCCGGTTGG - Intronic
1189616419 X:42788982-42789004 CTCCCAGTGCATGGCCTGGTTGG + Intergenic
1190548816 X:51558047-51558069 CTCCCAGTGTGCAGGCCAGTTGG + Intergenic
1190549476 X:51563880-51563902 CTCCCAGTTCACAGGCCAGTTGG + Intergenic
1192595813 X:72407256-72407278 CTCCCAGTGCGCAGGCCAGCTGG - Intronic
1193254439 X:79330297-79330319 CTCCCAATGCACAGGCCAGCCGG + Intergenic
1193481225 X:82031925-82031947 CTCCCAGTGCACAGGCTCGTTGG - Intergenic
1193481816 X:82036263-82036285 CTCCCAGTGCGCAGGCTGATAGG - Intergenic
1194086922 X:89539294-89539316 CTCCCAGTGTGCAGGCCGGCTGG - Intergenic
1194088909 X:89562324-89562346 CTCCCAGTGCACAGGCCGGTAGG + Intergenic
1194131682 X:90089267-90089289 TTCCCAAAGCACAGGCCAGTCGG + Intergenic
1194653043 X:96538400-96538422 CTTCCAGTGCGCAGGCCGGTTGG - Intergenic
1194662548 X:96642903-96642925 CTCCCAGTGCGCAGGCCAGGCGG + Intergenic
1195918594 X:109959876-109959898 CTACCACTTCACAGGCCAGTTGG + Intergenic
1197061740 X:122189998-122190020 TTCCCAGTGCGCAGGCTGGTTGG - Intergenic
1197662918 X:129193507-129193529 CTCCCAGTGTGCAGGCCAGTTGG - Intergenic
1198499344 X:137227377-137227399 TTCCCAGCGCCCAGGCCAGTTGG + Intergenic
1198647303 X:138823277-138823299 CTCCTAGTGCGCAGGCGGGCTGG - Intronic
1199058946 X:143330339-143330361 CTCTCAGTGCACAGGCAGGTTGG - Intergenic
1199372974 X:147073245-147073267 CTCCCAGTGCACAGGCCAGTGGG + Intergenic
1200234191 X:154460284-154460306 CACCCGGTGCACAGCCAGGTGGG - Exonic
1200258297 X:154597569-154597591 CTCCCAGTGCCCTAGCCGGTTGG - Intergenic
1200439580 Y:3195163-3195185 CTCCCAGTGTGCAGTCCGGCTGG - Intergenic
1200441585 Y:3218378-3218400 CTCCCAGTGCACAGGCCGGTAGG + Intergenic
1201309880 Y:12587400-12587422 CTCCCAGTGCACAGGCTAGTTGG - Intergenic
1201526299 Y:14938313-14938335 CTCCCAGTGTACAGGTTGGTTGG - Intergenic