ID: 1014674726

View in Genome Browser
Species Human (GRCh38)
Location 6:124349336-124349358
Sequence TCCCAGTGCACAGGCCGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 1, 2: 4, 3: 19, 4: 99}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014674706_1014674726 30 Left 1014674706 6:124349283-124349305 CCAGCCTGCTCCCCCCTACAAAG 0: 1
1: 0
2: 1
3: 20
4: 288
Right 1014674726 6:124349336-124349358 TCCCAGTGCACAGGCCGGTTGGG 0: 1
1: 1
2: 4
3: 19
4: 99
1014674718_1014674726 -4 Left 1014674718 6:124349317-124349339 CCGAGGCTCCACCCCATTCTCCC 0: 1
1: 22
2: 43
3: 127
4: 777
Right 1014674726 6:124349336-124349358 TCCCAGTGCACAGGCCGGTTGGG 0: 1
1: 1
2: 4
3: 19
4: 99
1014674713_1014674726 18 Left 1014674713 6:124349295-124349317 CCCCTACAAAGGCGGGAACTTCC 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1014674726 6:124349336-124349358 TCCCAGTGCACAGGCCGGTTGGG 0: 1
1: 1
2: 4
3: 19
4: 99
1014674712_1014674726 19 Left 1014674712 6:124349294-124349316 CCCCCTACAAAGGCGGGAACTTC 0: 1
1: 0
2: 0
3: 1
4: 70
Right 1014674726 6:124349336-124349358 TCCCAGTGCACAGGCCGGTTGGG 0: 1
1: 1
2: 4
3: 19
4: 99
1014674711_1014674726 20 Left 1014674711 6:124349293-124349315 CCCCCCTACAAAGGCGGGAACTT 0: 1
1: 0
2: 2
3: 11
4: 62
Right 1014674726 6:124349336-124349358 TCCCAGTGCACAGGCCGGTTGGG 0: 1
1: 1
2: 4
3: 19
4: 99
1014674717_1014674726 -3 Left 1014674717 6:124349316-124349338 CCCGAGGCTCCACCCCATTCTCC 0: 2
1: 27
2: 47
3: 147
4: 614
Right 1014674726 6:124349336-124349358 TCCCAGTGCACAGGCCGGTTGGG 0: 1
1: 1
2: 4
3: 19
4: 99
1014674714_1014674726 17 Left 1014674714 6:124349296-124349318 CCCTACAAAGGCGGGAACTTCCC 0: 1
1: 0
2: 0
3: 6
4: 65
Right 1014674726 6:124349336-124349358 TCCCAGTGCACAGGCCGGTTGGG 0: 1
1: 1
2: 4
3: 19
4: 99
1014674715_1014674726 16 Left 1014674715 6:124349297-124349319 CCTACAAAGGCGGGAACTTCCCG 0: 1
1: 0
2: 1
3: 4
4: 37
Right 1014674726 6:124349336-124349358 TCCCAGTGCACAGGCCGGTTGGG 0: 1
1: 1
2: 4
3: 19
4: 99
1014674708_1014674726 26 Left 1014674708 6:124349287-124349309 CCTGCTCCCCCCTACAAAGGCGG 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1014674726 6:124349336-124349358 TCCCAGTGCACAGGCCGGTTGGG 0: 1
1: 1
2: 4
3: 19
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014674726 Original CRISPR TCCCAGTGCACAGGCCGGTT GGG Intronic
900201126 1:1407098-1407120 GCCCAGTGCCCAGGCCGGGCAGG + Intronic
900424671 1:2570833-2570855 TGCCTGTGCACAGGCTGGTCTGG - Intergenic
900913206 1:5616835-5616857 TCCCAGGGAACAGGCCGACTTGG + Intergenic
900989912 1:6093700-6093722 TGCCAGGGGACAGGCGGGTTGGG + Intronic
901916063 1:12501556-12501578 TGCCAGTGCACAGGCAACTTTGG - Intronic
902776580 1:18678794-18678816 TCCCAGGGCACAAGTCGGTATGG + Intronic
902982688 1:20137306-20137328 TCCCACTGGACATGCTGGTTGGG - Intergenic
903877468 1:26485285-26485307 GCACAGTGTACAGGCCGCTTGGG + Intergenic
907201209 1:52728138-52728160 TCCAAGTGCCCAGGCCAGCTAGG + Intronic
912689581 1:111794403-111794425 GACCAGGGCACTGGCCGGTTAGG + Intronic
915952579 1:160199257-160199279 TCCCAGAGCAGAGGCTGGATGGG + Intronic
916655881 1:166875334-166875356 ACCTAGTGCACAGTCAGGTTAGG - Intronic
922369475 1:224895221-224895243 TCCCAATGTACAGCCAGGTTTGG - Intergenic
1063389450 10:5639828-5639850 TCTCAGTGCAAAGGCCTGTTTGG - Exonic
1068428404 10:56898361-56898383 TCCCAGTGCACAGGCGGGCCGGG + Intergenic
1069316302 10:67107768-67107790 TCCCAGTGTGCAGACCTGTTTGG - Intronic
1069738983 10:70675458-70675480 CCCCAGTGCACTGCCCAGTTAGG - Intronic
1070619132 10:77993542-77993564 TCCCACTGCACAGGCTAGTAAGG - Intronic
1070769059 10:79071638-79071660 CCCCAGTGCAGGGGCCGGGTGGG + Intronic
1074976156 10:118583437-118583459 TTCCAATGCACAGCCAGGTTTGG + Intergenic
1077333654 11:1994145-1994167 TCCCAGTGCACAGAGCTGTCAGG - Intergenic
1080938153 11:36884370-36884392 TACCAGTGCACAGGACTCTTGGG - Intergenic
1083253003 11:61480577-61480599 GCCCAGTTCACAGGGTGGTTTGG + Intronic
1084038320 11:66526881-66526903 TCCCAGTGCACAGGGAGGCTGGG - Intronic
1084585977 11:70062711-70062733 GCCCAGAGGACAGGCAGGTTTGG - Intergenic
1085397562 11:76214488-76214510 TCCTATGGCACAGGCTGGTTTGG - Intergenic
1087381533 11:97409669-97409691 CCTCAGTGCAGGGGCCGGTTTGG - Intergenic
1202816635 11_KI270721v1_random:49327-49349 TCCCAGTGCACAGAGCTGTCAGG - Intergenic
1095765306 12:45887784-45887806 TTCCAGTGCAGAGGCTGGTCAGG + Intronic
1097049111 12:56210309-56210331 TCACAGGTCACAGGCCGCTTCGG + Exonic
1097350003 12:58538242-58538264 TCCCAGTGGAAAGGTGGGTTGGG - Intergenic
1103523807 12:121553763-121553785 TCCCAGTGAACAGACTGCTTAGG + Intronic
1104519817 12:129463407-129463429 TCCCAGGACACAGGCTGTTTTGG - Intronic
1104918531 12:132278724-132278746 TCCCACGGCACACGCCGCTTGGG + Intronic
1108871175 13:54988179-54988201 TCCCAGTGTGCAGGCCAGATTGG + Intergenic
1113217863 13:108063320-108063342 CCTCAGTGCACAGGCCAGTTGGG + Intergenic
1113338690 13:109401424-109401446 TCCCAGGGCGCAGGCCGGTTGGG - Intergenic
1114218267 14:20673959-20673981 TCCCAGTGCGCAGGCTGGTCGGG + Intergenic
1117057345 14:51926588-51926610 GCCCAGTGCGCAGGCCGGTAGGG - Intronic
1117162608 14:53004031-53004053 TCCCAGGACACAGGCCATTTTGG - Intergenic
1117670357 14:58100044-58100066 GTCCAGTGCACAGGCTGGTTTGG + Intronic
1121408215 14:93732312-93732334 TGCAAGTGCACAGGCCTGTGGGG + Intronic
1121970134 14:98348400-98348422 TCAAAATCCACAGGCCGGTTTGG + Intergenic
1122031661 14:98916663-98916685 ACCCAGTGCACAGGGAAGTTGGG - Intergenic
1122133320 14:99618733-99618755 TCCCAATGCCTAGGCCGGTGTGG + Intergenic
1129666890 15:77584388-77584410 TCCCAGTGCATAGGGCAGCTCGG + Intergenic
1129921443 15:79322524-79322546 TCCAAGTGCCCAGGCCTCTTGGG + Exonic
1131526570 15:93157543-93157565 TCAAAGGGCACAGGCCGGGTGGG + Intergenic
1132102610 15:99035360-99035382 TCCCAGTGCCCAGGCTGGGTCGG - Intergenic
1132783556 16:1641934-1641956 TCCCAGTGCACAGCCTGGTGGGG + Intronic
1133757841 16:8776070-8776092 TCCCAGTGCATGGGACGATTTGG + Intronic
1134062090 16:11205452-11205474 TCCCAGTGCTCCGGCCGCGTTGG - Intergenic
1135089728 16:19503731-19503753 TCACAGTGCAGAGGCCAGTTAGG - Intronic
1135191440 16:20357910-20357932 TCCCAGTTCACAGTAGGGTTTGG + Intergenic
1138580486 16:57937790-57937812 TTCCAATGCACAGCCCAGTTGGG - Intronic
1143367307 17:6416437-6416459 TCCCAGTGCTCAGGCTGGGGCGG + Intronic
1143514630 17:7413653-7413675 ACCCAGGGCTCAGGCCAGTTTGG + Intronic
1145013120 17:19381116-19381138 TCCCAGGGCACAGGCTGGCGTGG - Exonic
1146658231 17:34647885-34647907 TCCCAGTGCACAGCCCCTTCAGG - Intergenic
1147621626 17:41871908-41871930 ACCCAGTGCTCAGGGCCGTTCGG - Intronic
1148322234 17:46764460-46764482 TCCCCGTCCACAGGCGAGTTGGG + Exonic
1149094502 17:52824736-52824758 CCCCAGTGCATAGGGCGGTTGGG + Intergenic
1149664993 17:58358960-58358982 TCCCAGAGCACAGGCAGCTTAGG - Intronic
1150595728 17:66602801-66602823 TCCCAGTGCACAGGCCAGGTTGG - Intronic
1152423228 17:80205128-80205150 TCCTCGTGCCCAGGGCGGTTGGG + Exonic
1153769863 18:8406979-8407001 TCCCAGTGCACAGGCGGTGGAGG + Intergenic
1156266866 18:35497226-35497248 TCCCAATCCAAAGGCAGGTTTGG - Intronic
1167402782 19:49284003-49284025 TGTCAGTGCACAGGACTGTTGGG - Intergenic
1168581475 19:57559194-57559216 TCTCAGTGCACAGCACGGTCCGG - Intronic
932183767 2:69673823-69673845 TCCCAGCCCACAGTCCTGTTTGG - Intronic
933282558 2:80347883-80347905 TCCCAATGCACAGCCATGTTTGG - Intronic
941625204 2:167823713-167823735 TCCAAGTACACAGGCCAGTGGGG + Intergenic
942047576 2:172108722-172108744 TCCCAGCGCACAGGCCCCATAGG + Intergenic
1175457220 20:59124552-59124574 CCCCACTGCACAGGCTGCTTAGG - Intergenic
1179883227 21:44302039-44302061 GCCCTGTGGACAGGCCGGCTGGG + Intronic
1179982495 21:44903605-44903627 TGCCAGTGCACAGCCCGCTCGGG - Intronic
1179996034 21:44974857-44974879 CCCCAGTGCACAGCCTGGTCCGG + Intronic
1180843122 22:18968421-18968443 TCCCACTGCACAGACAGGTGGGG + Intergenic
1181514890 22:23404766-23404788 TCCCACTGCACAGACCTGTGGGG - Intergenic
1181972130 22:26698875-26698897 TCCCAGTGCACATGCAGTTGAGG - Intergenic
1182417770 22:30232555-30232577 ACCCCGTGCACAGGCAGGTTCGG - Intergenic
1182834849 22:33333511-33333533 TACCAGAGCACAGGCATGTTGGG - Intronic
1184426565 22:44412241-44412263 TCCCAGTCCGCAGCCCTGTTGGG - Intergenic
1185239568 22:49735348-49735370 TCTCACTGCAAAGGCCGGGTAGG + Intergenic
953309916 3:41866637-41866659 TCCTGGTCCACAGCCCGGTTTGG + Intronic
964073116 3:152659209-152659231 TCCCAGCACACAGGCCAGTTGGG + Intergenic
965390385 3:168096074-168096096 TCCCAGTGCCGGGGCCGGCTAGG + Intergenic
973226447 4:47790280-47790302 TCCCAGTGCGCAGGCCAGTCGGG - Intronic
978328518 4:107586495-107586517 TCCCAGTGTGCAGGCCAGTTGGG + Intergenic
983040617 4:162921304-162921326 TCCCAGTGGGCAGGCCAGTTGGG - Intergenic
986264314 5:6179872-6179894 TTCCAATGCACAGACAGGTTTGG - Intergenic
997835158 5:137186323-137186345 TCCCTTTGCATAGGCCCGTTTGG + Intronic
998128161 5:139637937-139637959 TCCCAGCACACCGGCCGGCTGGG - Intergenic
1002784031 6:387745-387767 TCCCAGGGCACAGGGCGTTCAGG - Intergenic
1004285753 6:14318939-14318961 TCCCAGTGTACAGGCATGCTTGG + Intergenic
1012693761 6:102352804-102352826 TCCCAGTGCACAGGCAGTGGGGG + Intergenic
1012694204 6:102356337-102356359 TCCCAGTTTACAAGCTGGTTGGG + Intergenic
1014674726 6:124349336-124349358 TCCCAGTGCACAGGCCGGTTGGG + Intronic
1018722195 6:166581485-166581507 TCCAAGTGCTCAGGTGGGTTCGG + Intronic
1019706022 7:2497755-2497777 TCCCAGTACACAGGAGGGTCTGG + Intergenic
1024068365 7:45764456-45764478 TCCCAGTGCACAGGATAGTAGGG - Intergenic
1025613710 7:63100142-63100164 TCCCAGAGCACCTGCCAGTTTGG - Intergenic
1026001140 7:66559334-66559356 CCCCAGTGTACAGGCCGGTTGGG + Intergenic
1029451148 7:100642329-100642351 TCCCTGGGCACCGGCCCGTTTGG + Intronic
1029587576 7:101485274-101485296 TCCCAGGGCTCAGGCAGGTGAGG - Intronic
1031941469 7:127793817-127793839 TCACAGTGCACAGGACAGTCAGG - Intronic
1033464373 7:141577713-141577735 ACCCAGTGCACAGGCCGGTTGGG + Intronic
1035047515 7:155978477-155978499 TCCCAGTGCACAGGGGGCTTGGG - Intergenic
1035765057 8:2099012-2099034 TTCCAGCGCACAGGCTGGCTGGG + Intronic
1037766255 8:21774190-21774212 CCCCAGTGCCCAGGCAGGGTGGG + Intronic
1037845523 8:22278643-22278665 CCCCAGGCCACAGGCTGGTTGGG + Intronic
1038138156 8:24813268-24813290 TCCCAGTGGACAGGCAGGGCTGG - Intergenic
1048176175 8:132154602-132154624 TCCCATTGCACAGGCTGGTTGGG - Intronic
1049064830 8:140304871-140304893 TCCCAGAGGACAGGGCGGTGTGG - Intronic
1049606274 8:143530585-143530607 TCCCTCTGCACAGGCCGGCCAGG + Intronic
1055562625 9:77535768-77535790 ACCCGGTCCACAGGCTGGTTGGG + Intronic
1057717093 9:97503248-97503270 TCCCACTGCTCAGGCAGGTCCGG + Intronic
1062280321 9:135748990-135749012 CCCCAGGGCACGGGCCGTTTAGG + Intronic
1185522912 X:755129-755151 TAACAGTGGACAGGCCGGGTGGG + Intergenic
1199372738 X:147070283-147070305 TCCTAATGCACAGGCAGGTTTGG + Intergenic
1202279517 Y:23166408-23166430 TTCCACTGCACTGGCCTGTTGGG - Intronic
1202284915 Y:23230423-23230445 TTCCACTGCACTGGCCTGTTGGG + Intronic
1202432649 Y:24802480-24802502 TTCCACTGCACTGGCCTGTTGGG - Intronic
1202437318 Y:24855658-24855680 TTCCACTGCACTGGCCTGTTGGG + Intronic