ID: 1014674729

View in Genome Browser
Species Human (GRCh38)
Location 6:124349347-124349369
Sequence AGGCCGGTTGGGTATTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 151}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014674714_1014674729 28 Left 1014674714 6:124349296-124349318 CCCTACAAAGGCGGGAACTTCCC 0: 1
1: 0
2: 0
3: 6
4: 65
Right 1014674729 6:124349347-124349369 AGGCCGGTTGGGTATTCTCCAGG 0: 1
1: 0
2: 3
3: 23
4: 151
1014674718_1014674729 7 Left 1014674718 6:124349317-124349339 CCGAGGCTCCACCCCATTCTCCC 0: 1
1: 22
2: 43
3: 127
4: 777
Right 1014674729 6:124349347-124349369 AGGCCGGTTGGGTATTCTCCAGG 0: 1
1: 0
2: 3
3: 23
4: 151
1014674723_1014674729 -6 Left 1014674723 6:124349330-124349352 CCATTCTCCCAGTGCACAGGCCG 0: 1
1: 12
2: 32
3: 85
4: 260
Right 1014674729 6:124349347-124349369 AGGCCGGTTGGGTATTCTCCAGG 0: 1
1: 0
2: 3
3: 23
4: 151
1014674713_1014674729 29 Left 1014674713 6:124349295-124349317 CCCCTACAAAGGCGGGAACTTCC 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1014674729 6:124349347-124349369 AGGCCGGTTGGGTATTCTCCAGG 0: 1
1: 0
2: 3
3: 23
4: 151
1014674722_1014674729 -5 Left 1014674722 6:124349329-124349351 CCCATTCTCCCAGTGCACAGGCC 0: 1
1: 22
2: 50
3: 96
4: 323
Right 1014674729 6:124349347-124349369 AGGCCGGTTGGGTATTCTCCAGG 0: 1
1: 0
2: 3
3: 23
4: 151
1014674712_1014674729 30 Left 1014674712 6:124349294-124349316 CCCCCTACAAAGGCGGGAACTTC 0: 1
1: 0
2: 0
3: 1
4: 70
Right 1014674729 6:124349347-124349369 AGGCCGGTTGGGTATTCTCCAGG 0: 1
1: 0
2: 3
3: 23
4: 151
1014674715_1014674729 27 Left 1014674715 6:124349297-124349319 CCTACAAAGGCGGGAACTTCCCG 0: 1
1: 0
2: 1
3: 4
4: 37
Right 1014674729 6:124349347-124349369 AGGCCGGTTGGGTATTCTCCAGG 0: 1
1: 0
2: 3
3: 23
4: 151
1014674717_1014674729 8 Left 1014674717 6:124349316-124349338 CCCGAGGCTCCACCCCATTCTCC 0: 2
1: 27
2: 47
3: 147
4: 614
Right 1014674729 6:124349347-124349369 AGGCCGGTTGGGTATTCTCCAGG 0: 1
1: 0
2: 3
3: 23
4: 151
1014674719_1014674729 -1 Left 1014674719 6:124349325-124349347 CCACCCCATTCTCCCAGTGCACA 0: 17
1: 37
2: 97
3: 174
4: 492
Right 1014674729 6:124349347-124349369 AGGCCGGTTGGGTATTCTCCAGG 0: 1
1: 0
2: 3
3: 23
4: 151
1014674721_1014674729 -4 Left 1014674721 6:124349328-124349350 CCCCATTCTCCCAGTGCACAGGC 0: 10
1: 23
2: 58
3: 128
4: 377
Right 1014674729 6:124349347-124349369 AGGCCGGTTGGGTATTCTCCAGG 0: 1
1: 0
2: 3
3: 23
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014674729 Original CRISPR AGGCCGGTTGGGTATTCTCC AGG Intronic
900891233 1:5451183-5451205 AGGCTGGTTGGAGGTTCTCCGGG - Intergenic
910190087 1:84586042-84586064 AGGTGGGTTGGAGATTCTCCAGG + Intergenic
911265104 1:95733936-95733958 AAGCTGGTTGGAAATTCTCCAGG + Intergenic
912980447 1:114366353-114366375 AGTTTGGTTGGGTTTTCTCCTGG + Intergenic
918878689 1:190084832-190084854 AGGCTGATTGGAGATTCTCCAGG - Intergenic
923412667 1:233725469-233725491 AGGCCGGTGGGAGATTCTCTGGG + Intergenic
923908484 1:238412988-238413010 AGGCTGGTTGGAGTTTCTCCAGG - Intergenic
1064519560 10:16187008-16187030 AGGCAGGAGTGGTATTCTCCAGG - Intergenic
1069175307 10:65282856-65282878 AATCTGTTTGGGTATTCTCCTGG + Intergenic
1069197387 10:65570412-65570434 AGGCTGGTTGGAGATTCTCCAGG - Intergenic
1070360244 10:75681457-75681479 AGGCCGGGTGGCTCTGCTCCAGG + Intronic
1080941271 11:36921403-36921425 AGGCTGGTTGGAGTTTCTCCAGG + Intergenic
1081100634 11:38997286-38997308 AGGCTGGCTGGAGATTCTCCGGG + Intergenic
1082944064 11:58739860-58739882 GGGCAGGTTGGAGATTCTCCAGG - Intergenic
1082944505 11:58743309-58743331 GGGCAGGTTGGAGATTCTCCAGG - Intergenic
1084925520 11:72508270-72508292 AGGCTGGTTGGAGTTTCTCCAGG + Intergenic
1086296496 11:85373533-85373555 AGGCTGGTTGGAGTTTCTCCAGG - Intronic
1087462809 11:98466790-98466812 AGGCCAGTGGGAGATTCTCCAGG - Intergenic
1087486671 11:98765312-98765334 AGGCTGGTTGGAGTTTCTCCAGG - Intergenic
1090706118 11:129338642-129338664 AGGCCGGTTAGAGATTCTCCAGG - Intergenic
1091591873 12:1847155-1847177 AGGTCCGTTGGGACTTCTCCTGG - Intronic
1093921984 12:24869253-24869275 AGGCCGGTTGGAGTTTCTCTGGG - Intronic
1096684634 12:53279863-53279885 AGGCTGGTTGGGCACTCACCTGG - Exonic
1097419563 12:59357896-59357918 AGGTGGGTTGGAGATTCTCCAGG - Intergenic
1098806001 12:75020598-75020620 AGGCTGGTTGGAGTTTCTCCAGG + Intergenic
1099979434 12:89581657-89581679 AGGCCAGTTGGGTATGCTATGGG + Intergenic
1105266640 13:18824800-18824822 GGGCTGGTTGGAGATTCTCCAGG - Intergenic
1107256019 13:38427564-38427586 AGGCTGGTTGGAGTTTCTCCAGG + Intergenic
1109012488 13:56969870-56969892 AGGCTGGTTGGAGTTTCTCCAGG - Intergenic
1109463005 13:62687996-62688018 AGGCTGGTTGGAGTTTCTCCAGG + Intergenic
1109845244 13:67980781-67980803 AGGCAGGTTGATTATTATCCTGG + Intergenic
1109865834 13:68261425-68261447 AGGCTGGTTGGAGATTCTCTGGG - Intergenic
1110257207 13:73445311-73445333 AGGCTGGTTGGAGTTTCTCCAGG - Intergenic
1112260717 13:97875470-97875492 AGGCCAGTTGGAGATTCTCCGGG + Intergenic
1112286151 13:98106141-98106163 AGGCAGGTTGGAGATTCTCCAGG + Intergenic
1112774663 13:102830930-102830952 AGGCCAGCTGGAGATTCTCCAGG + Intronic
1113338686 13:109401413-109401435 AGGCCGGTTGGGGTTTCCCCAGG - Intergenic
1114440977 14:22747402-22747424 AGGCTGGTTGGAGTTTCTCCAGG + Intergenic
1116594170 14:46819267-46819289 AGGCCGGTGGAGGATTCCCCAGG - Intergenic
1116599590 14:46902959-46902981 AGGCCGGTGGGAGATTCTCTGGG - Intronic
1118378031 14:65193598-65193620 AGGCTGGTTGGAGGTTCTCCGGG + Intergenic
1118550593 14:66945363-66945385 AGGCCAGTTGGAGATTCTCCAGG + Intronic
1120314405 14:82872805-82872827 AGGCCGGTTGGAGTTTTTCCAGG - Intergenic
1125852789 15:42920592-42920614 CGGCCGGCTGGGTAGTCCCCTGG + Intronic
1128964114 15:72040336-72040358 AGGTCAGTTGGAGATTCTCCTGG - Intronic
1133728789 16:8560535-8560557 AGGCGGGTTGTTTATTCTCAAGG + Intergenic
1137354313 16:47744710-47744732 AGGCGGGTGGGAGATTCTCCAGG + Intergenic
1139449427 16:67017774-67017796 AGGCAGGTTAGGATTTCTCCTGG - Intergenic
1144677969 17:17173979-17174001 GGGCCAGATGGGCATTCTCCAGG - Exonic
1149094506 17:52824747-52824769 AGGGCGGTTGGGGTTTTTCCAGG + Intergenic
1151444136 17:74152280-74152302 AGTCCTGGTTGGTATTCTCCCGG - Intergenic
1152589847 17:81206248-81206270 AGACCGTGTGGTTATTCTCCAGG - Intronic
1153127153 18:1808435-1808457 AGACCAGTTGGAGATTCTCCAGG - Intergenic
1153704741 18:7733923-7733945 GGGCAGGTTGGAGATTCTCCGGG + Intronic
1154310792 18:13264874-13264896 AGGCCAGTTGCGAATCCTCCAGG - Intronic
1154421772 18:14236671-14236693 GGGCTGGTTGGAGATTCTCCAGG + Intergenic
1155593468 18:27454506-27454528 AGGCTGGTTGGAGTTTCTCCAGG + Intergenic
1155606822 18:27615866-27615888 AGGCCGGTCGGAAGTTCTCCAGG - Intergenic
1156559779 18:38110574-38110596 GGGCCAACTGGGTATTCTCCTGG + Intergenic
1156698401 18:39795441-39795463 AGGCTGGTTGGAGTTTCTCCAGG + Intergenic
1156718588 18:40042269-40042291 AGGCAGCTTGGCTATTCCCCAGG + Intergenic
1160761798 19:789212-789234 AGGCCGGGAGGGTACTCGCCTGG - Intergenic
1202640800 1_KI270706v1_random:84464-84486 GGGCTGGTTGGAGATTCTCCAGG - Intergenic
928182970 2:29082686-29082708 AGGCTGGTTGGAGTTTCTCCAGG + Intergenic
929238026 2:39626891-39626913 AGGCCTGTCGGAGATTCTCCAGG + Intergenic
934496359 2:94804445-94804467 GGGCTGGTTGGGGATTCTCTGGG - Intergenic
934524848 2:95045430-95045452 TGGCTGGATGGGTCTTCTCCTGG + Intronic
937727865 2:125188013-125188035 AGGCTGGTTGGAGTTTCTCCAGG + Intergenic
938850892 2:135258319-135258341 AGGCAGGTTGGAGATTCTCCAGG - Intronic
940624061 2:156150310-156150332 AGGCTGGTTGGAGTTTCTCCAGG + Intergenic
940728047 2:157357790-157357812 AGGCAGCTGGGGTATTCTCTGGG + Intergenic
942109205 2:172663605-172663627 AGGCTGGTTGGAGTTTCTCCAGG - Intergenic
942605218 2:177683485-177683507 AGGCGGGTTGGAGATTCTCCGGG - Intronic
1169780744 20:9307163-9307185 AGGCTGGTTGGAGTTTCTCCAGG + Intronic
1170947023 20:20900586-20900608 GGGCAGGTTGGAAATTCTCCAGG + Intergenic
1171115260 20:22519867-22519889 AGGGAGGTTGGGCCTTCTCCTGG + Intergenic
1173690043 20:44953597-44953619 AGGACGGTTGGGTATTTACATGG - Intronic
1176886419 21:14261316-14261338 AGGCCGATTGGAGATTCTCTGGG - Intergenic
1180153151 21:45962755-45962777 AGGCAGATTGGAGATTCTCCGGG + Intergenic
1180361153 22:11897398-11897420 GGGCTGGTTGGAGATTCTCCAGG + Intergenic
1182676268 22:32042273-32042295 AGGGCTGTGGGGTATTCTCAGGG - Intergenic
1184186831 22:42870328-42870350 TGGCCGGCTGGGTCTCCTCCCGG - Exonic
1185364534 22:50431328-50431350 CGGCCGGCTGGGGAGTCTCCAGG - Exonic
949998849 3:9641016-9641038 AGGCCTGTTGAGCTTTCTCCAGG + Intergenic
951193809 3:19802369-19802391 AGGCTGGTTGGAGTTTCTCCAGG + Intergenic
951346076 3:21547961-21547983 AGGCTGGTTGGAGTTTCTCCAGG - Intronic
952485340 3:33804326-33804348 AGGCTGGTTGGAATTTCTCCAGG + Intronic
953626767 3:44578520-44578542 GGGCCAGATGGGCATTCTCCAGG + Intronic
956651014 3:71504822-71504844 AGGACTTTTGGATATTCTCCTGG + Intronic
957275190 3:78081805-78081827 AGGTAAGTTGGGTACTCTCCTGG + Intergenic
959623431 3:108423232-108423254 AGGCTGGTTGGAGTTTCTCCAGG + Intronic
960768530 3:121165824-121165846 AGGCCGGTTGGAGATTCTCCGGG + Intronic
964304437 3:155325564-155325586 ATGCCGGTTGGAGTTTCTCCAGG - Intergenic
964361989 3:155908221-155908243 AGGCTGGTGGGAGATTCTCCAGG - Intronic
965003215 3:162985000-162985022 AGGCCAGTGGGAGATTCTCCAGG + Intergenic
965076686 3:163988535-163988557 AGACCAGTTGGAGATTCTCCAGG - Intergenic
965240216 3:166187421-166187443 AGGCCAGTTGGAAATTCTCTGGG + Intergenic
966523100 3:180894495-180894517 AGGCTGGTTGGAGTTTCTCCAGG - Intronic
971616400 4:28795467-28795489 AGGCTGGTTGGAGTTTCTCCAGG - Intergenic
971792178 4:31183859-31183881 AGGCTGGTTGGAGTTTCTCCAGG + Intergenic
973384315 4:49494996-49495018 GGGCTGGTTGGAGATTCTCCGGG - Intergenic
976826205 4:89263371-89263393 AGGCTGGATGGAGATTCTCCGGG - Intronic
978227513 4:106355356-106355378 AGGCCAGTTGGAGATTCTCCAGG - Intergenic
978328522 4:107586506-107586528 AGGCCAGTTGGGGATTCCCCAGG + Intergenic
979609422 4:122673510-122673532 AGGCTGGTTGGAGATTCTCTGGG + Intergenic
980726604 4:136769845-136769867 AGGCTGGTTTGAGATTCTCCAGG - Intergenic
981255423 4:142656050-142656072 AGGCTGGTTGGTGTTTCTCCAGG - Intronic
981456863 4:144962615-144962637 AGGTGGGTTGGAGATTCTCCAGG - Intergenic
983040613 4:162921293-162921315 AGGCCAGTTGGGGATTCTCCAGG - Intergenic
1202768165 4_GL000008v2_random:170319-170341 GGGCTGGTTGGAGATTCTCCGGG - Intergenic
988899547 5:35717772-35717794 AGGCTGGTTGGAGTTTCTCCAGG + Intronic
990310704 5:54535379-54535401 AGCCCTGTTGGGAATTTTCCAGG + Intronic
994453900 5:99981173-99981195 GGGCAGGTTGGAGATTCTCCAGG - Intergenic
995635467 5:114185400-114185422 AGGCTGGTTGGAGTTTCTCCAGG - Intergenic
995829893 5:116344115-116344137 AGGCTGGTTGGACTTTCTCCAGG + Intronic
995830452 5:116348824-116348846 AGCCTGGTTGGGGTTTCTCCAGG + Intronic
996553823 5:124757696-124757718 AGGCTGGTTGGAGTTTCTCCAGG - Intergenic
996574029 5:124962861-124962883 AGGCTGGTTGGAGTTTCTCCAGG - Intergenic
996575492 5:124973024-124973046 AGGCTGGTTGGAGTTTCTCCAGG - Intergenic
997817907 5:137035779-137035801 AGGCAAGTTGAGTAGTCTCCTGG - Intronic
999008310 5:148006353-148006375 AGGCTGGTTGGAGTTTCTCCAGG - Intergenic
999897613 5:156052222-156052244 AGGCTGGTTGGAGTTTCTCCAGG + Intronic
1000022797 5:157333178-157333200 AGGCTGGTTGGAGTTTCTCCAGG + Intronic
1000241799 5:159415691-159415713 AGGCCAGTCGGAGATTCTCCGGG - Intergenic
1005787870 6:29264711-29264733 AGGCTGGTTGGAGTTTCTCCAGG - Intergenic
1006017172 6:31091166-31091188 AGGCTGGTTGGCATTTCTCCAGG - Intergenic
1008243027 6:49135658-49135680 AGGCCAGTTGGAGATTCTCTGGG + Intergenic
1010670758 6:78683153-78683175 AGGCTGGTTGGAGCTTCTCCAGG + Intergenic
1014674729 6:124349347-124349369 AGGCCGGTTGGGTATTCTCCAGG + Intronic
1014747668 6:125219063-125219085 AGGCCGGTGGGAGTTTCTCCAGG + Intronic
1014953896 6:127593127-127593149 AGGACGATTGGAGATTCTCCGGG + Intergenic
1014988298 6:128040397-128040419 AGCCCAGTTGGGTTTTCACCTGG + Intronic
1015858614 6:137652435-137652457 AGGCCAGTTGGAATTTCTCCGGG - Intergenic
1016233213 6:141831135-141831157 AGGCCAGTTGGACATTCTCCAGG + Intergenic
1018239615 6:161760465-161760487 AGGCTGGTTGGAGTTTCTCCAGG - Intronic
1021054946 7:16035931-16035953 AGGCTGGTTGGAGTTTCTCCAGG - Intergenic
1022679056 7:32526960-32526982 AGGCCAGTTGGATATTCCCCGGG + Intronic
1023280096 7:38560410-38560432 GGGCCAGGTGGGAATTCTCCTGG - Intronic
1024490963 7:49985724-49985746 GGGCGGGTTGGGGATTCTCCAGG - Intronic
1024655441 7:51447944-51447966 AGGCTGGTTGGAGTTTCTCCAGG - Intergenic
1024897735 7:54280003-54280025 TGGCGGGTTGGAGATTCTCCAGG - Intergenic
1026001129 7:66559303-66559325 AGGCCGGTTGGAGTTTTTCCGGG + Intergenic
1026110454 7:67455151-67455173 GGGCCGGTTGCCTCTTCTCCTGG + Intergenic
1027207084 7:76109183-76109205 AGGCCGGTTGGAGTTTTTCCGGG + Intergenic
1027207096 7:76109225-76109247 AGGCCGGTTGGAGTTTTTCCGGG + Intergenic
1027660414 7:80981634-80981656 AGGCTGGTTGGAGTTTCTCCAGG + Intergenic
1030139669 7:106291886-106291908 AGGCTGGTTGGAGTTTCTCCAGG - Intergenic
1030245915 7:107384345-107384367 AGGCAGGTTGGAGTTTCTCCAGG - Intronic
1031835179 7:126673034-126673056 AGGCCGCTTGGAGTTTCTCCAGG - Intronic
1032580095 7:133096321-133096343 AGGCCAGTTGGAAATTTTCCAGG + Intergenic
1033464379 7:141577724-141577746 AGGCCGGTTGGGGTTTCTCGGGG + Intronic
1034047929 7:147949574-147949596 AGGCTAGTTGGTTGTTCTCCCGG + Intronic
1038370255 8:26981905-26981927 AGGTTGGTTGGAGATTCTCCAGG - Intergenic
1039802430 8:40970863-40970885 AGGCTGGTGGGAGATTCTCCGGG + Intergenic
1040990858 8:53347880-53347902 AGGCTGGTTGGAGTTTCTCCAGG - Intergenic
1042555000 8:70026814-70026836 AGGCCAGTTGGAGATTCTCTGGG + Intergenic
1043365503 8:79528198-79528220 AGCCTAGTTGGTTATTCTCCTGG - Intergenic
1045303515 8:100936060-100936082 TGGCAGGTTGGCTATTCTTCAGG - Intronic
1048176171 8:132154591-132154613 AGGCTGGTTGGGGATTCTCCAGG - Intronic
1048451358 8:134536574-134536596 AGGCCAGCAGGGAATTCTCCTGG + Intronic
1048843374 8:138584160-138584182 AGGGAGGTGGGGCATTCTCCAGG + Intergenic
1051434535 9:17016892-17016914 AGGCCGGTTGGAGGTTCTCCAGG + Intergenic
1052795325 9:32918760-32918782 AGGTGGGTTGGAGATTCTCCAGG - Intergenic
1053660781 9:40276002-40276024 AGGCTTGTTGGGGATTCTCCGGG + Intronic
1053911159 9:42905347-42905369 AGGCTTGTTGGGGATTCTCCAGG + Intergenic
1054372903 9:64422218-64422240 AGGCTTGTTGGGGATTCTCCGGG + Intergenic
1054523829 9:66100282-66100304 AGGCTTGTTGGGGATTCTCCGGG - Intergenic
1054680533 9:67911995-67912017 AGGCTTGTTGGGGATTCTCCGGG + Intergenic
1054771266 9:69086438-69086460 AGGCTGGTTGGAGTTTCTCCAGG - Intronic
1057457924 9:95231360-95231382 AGGCTGGTTGGAGTTTCTCCAGG - Intronic
1058282487 9:103132449-103132471 AGGCCAGTTGGAGATTCTCCAGG + Intergenic
1189152874 X:38725961-38725983 AGGCCGGTTGGAGTTTCTCCAGG - Intergenic
1190712422 X:53080271-53080293 AGGCTGGCTGGGTAGACTCCTGG - Exonic
1194066275 X:89266376-89266398 AGGCTGGTTGGAGTTTCTCCAGG + Intergenic
1195245604 X:102992527-102992549 AGGCCGGTTGGAATTTCTCCAGG - Intergenic
1197300806 X:124778184-124778206 AGGCCAGTTGCAGATTCTCCAGG - Intronic
1198498663 X:137220406-137220428 AGGCTGGTTGGTGTTTCTCCAGG - Intergenic
1200720445 Y:6600495-6600517 AGGCTGGTTGGAGTTTCTCCAGG + Intergenic