ID: 1014674730

View in Genome Browser
Species Human (GRCh38)
Location 6:124349348-124349370
Sequence GGCCGGTTGGGTATTCTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014674718_1014674730 8 Left 1014674718 6:124349317-124349339 CCGAGGCTCCACCCCATTCTCCC 0: 1
1: 22
2: 43
3: 127
4: 777
Right 1014674730 6:124349348-124349370 GGCCGGTTGGGTATTCTCCAGGG No data
1014674717_1014674730 9 Left 1014674717 6:124349316-124349338 CCCGAGGCTCCACCCCATTCTCC 0: 2
1: 27
2: 47
3: 147
4: 614
Right 1014674730 6:124349348-124349370 GGCCGGTTGGGTATTCTCCAGGG No data
1014674715_1014674730 28 Left 1014674715 6:124349297-124349319 CCTACAAAGGCGGGAACTTCCCG 0: 1
1: 0
2: 1
3: 4
4: 37
Right 1014674730 6:124349348-124349370 GGCCGGTTGGGTATTCTCCAGGG No data
1014674723_1014674730 -5 Left 1014674723 6:124349330-124349352 CCATTCTCCCAGTGCACAGGCCG 0: 1
1: 12
2: 32
3: 85
4: 260
Right 1014674730 6:124349348-124349370 GGCCGGTTGGGTATTCTCCAGGG No data
1014674721_1014674730 -3 Left 1014674721 6:124349328-124349350 CCCCATTCTCCCAGTGCACAGGC 0: 10
1: 23
2: 58
3: 128
4: 377
Right 1014674730 6:124349348-124349370 GGCCGGTTGGGTATTCTCCAGGG No data
1014674719_1014674730 0 Left 1014674719 6:124349325-124349347 CCACCCCATTCTCCCAGTGCACA 0: 17
1: 37
2: 97
3: 174
4: 492
Right 1014674730 6:124349348-124349370 GGCCGGTTGGGTATTCTCCAGGG No data
1014674713_1014674730 30 Left 1014674713 6:124349295-124349317 CCCCTACAAAGGCGGGAACTTCC 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1014674730 6:124349348-124349370 GGCCGGTTGGGTATTCTCCAGGG No data
1014674722_1014674730 -4 Left 1014674722 6:124349329-124349351 CCCATTCTCCCAGTGCACAGGCC 0: 1
1: 22
2: 50
3: 96
4: 323
Right 1014674730 6:124349348-124349370 GGCCGGTTGGGTATTCTCCAGGG No data
1014674714_1014674730 29 Left 1014674714 6:124349296-124349318 CCCTACAAAGGCGGGAACTTCCC 0: 1
1: 0
2: 0
3: 6
4: 65
Right 1014674730 6:124349348-124349370 GGCCGGTTGGGTATTCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014674730 Original CRISPR GGCCGGTTGGGTATTCTCCA GGG Intronic
No off target data available for this crispr