ID: 1014678499

View in Genome Browser
Species Human (GRCh38)
Location 6:124398471-124398493
Sequence TGAAAGGTATGATGGAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 1, 2: 2, 3: 20, 4: 343}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014678499 Original CRISPR TGAAAGGTATGATGGAAAAT AGG Intronic
902828150 1:18991627-18991649 GGAAGGGTATGATGGCAGATAGG - Intergenic
904626135 1:31804393-31804415 TGAAAGGTATTTTGGTGAATGGG - Intronic
904978796 1:34479416-34479438 TGAAAGGTCTTAGGGTAAATGGG + Intergenic
905340769 1:37275815-37275837 TGGAGGGTAGGATGGGAAATGGG - Intergenic
907119615 1:51996825-51996847 TGAGAGGAGTGATGGAAGATCGG + Intergenic
910054010 1:83009836-83009858 GGAAAGGAAGGATGGAAAGTAGG - Intergenic
910078547 1:83310460-83310482 TGAAAGGGAGGATGGAATAAGGG + Intergenic
911651890 1:100398364-100398386 TGAAAAATATGATGGACAAGAGG - Intronic
911674683 1:100646464-100646486 TGAATGTTATAATGTAAAATTGG + Intergenic
911934800 1:103956051-103956073 TGAAAGAGATTATAGAAAATTGG + Intergenic
912113755 1:106377074-106377096 TGAAAGAGATTATGGAGAATTGG + Intergenic
917112868 1:171569127-171569149 AGAGAGGTATGATGGAAATTTGG + Intronic
917195771 1:172464124-172464146 TGAAAAGAATGAAGGAAAAAAGG + Intronic
917226037 1:172783829-172783851 TGAAAGAAATAAAGGAAAATTGG - Intergenic
917404720 1:174693052-174693074 TGAGAGGAATGATTGAATATAGG + Intronic
917574553 1:176307292-176307314 TGAAAGGTTTTATGTAAGATTGG + Intergenic
918688786 1:187453709-187453731 GGATAGGGATGATGGAAGATTGG - Intergenic
921072296 1:211671414-211671436 TGAAATTTATAATGGAAAAAAGG + Intronic
921305097 1:213788450-213788472 AGAAACGCATGATAGAAAATAGG - Intergenic
921827813 1:219693457-219693479 TGAAGGGAAGGATGGAAAATAGG + Intronic
922072053 1:222204307-222204329 AGAAAGGCATAATGGAAACTGGG + Intergenic
923278263 1:232417281-232417303 TGGTAGGTAGCATGGAAAATTGG - Intronic
923918536 1:238536841-238536863 TGAGAGGTAGAATGGAAAAGAGG - Intergenic
924361674 1:243247866-243247888 TGAAAGGTATAATTGCAGATAGG - Intronic
1063860724 10:10305028-10305050 TGAAGGGTCTGAGAGAAAATCGG - Intergenic
1064188597 10:13185661-13185683 TGAAGGAAAGGATGGAAAATGGG + Intronic
1064581915 10:16802513-16802535 TGAAAGGTATTGTAGAGAATTGG - Intronic
1065720355 10:28623151-28623173 TGAAAATTATGACGTAAAATTGG + Intergenic
1065908936 10:30284685-30284707 TGAAATGGATAATGTAAAATTGG + Intergenic
1066377698 10:34872436-34872458 TAAAAGGACTGATGGTAAATAGG - Intergenic
1068658109 10:59594946-59594968 TTAAAGGTATTATGGGAGATAGG + Intergenic
1068818351 10:61344053-61344075 AGAAAGGTAAGATGATAAATTGG + Intergenic
1071102642 10:82057122-82057144 TATAAGGGGTGATGGAAAATAGG - Intronic
1071116107 10:82222360-82222382 TGTAAGGTATGTTGGAAACAAGG + Intronic
1071235109 10:83636490-83636512 TGAAAAGTGTTATGGAATATAGG + Intergenic
1072572090 10:96667187-96667209 TGAAAGCTCAGTTGGAAAATGGG - Intronic
1072826556 10:98612623-98612645 TGAAAGGAATAAAGGAAAAAAGG + Intronic
1072846711 10:98839354-98839376 TGAAATGTAAGATGGAGATTAGG + Intronic
1073735462 10:106340636-106340658 TGCAAGACATGATGGAGAATTGG - Intergenic
1074267644 10:111920821-111920843 TGAATGGGATGAAGGAACATAGG + Intergenic
1074598782 10:114892206-114892228 TGATAAGTATGTTGGAAAAATGG - Intronic
1074760219 10:116661925-116661947 TAAATGATATGATGGAAAAATGG - Intergenic
1078737219 11:14031352-14031374 TGAAAGTTAGGCTGGAAGATGGG + Intronic
1080007612 11:27426362-27426384 TGGGAGGAATGATGTAAAATTGG + Intronic
1080487384 11:32724190-32724212 AGAAAAGTATGAGGGAAAACTGG - Intronic
1080593891 11:33750707-33750729 TAAAAGATACGATGCAAAATAGG + Intronic
1084458184 11:69280937-69280959 AGAAATGTGTGATTGAAAATGGG - Intergenic
1084744635 11:71161091-71161113 TTCAAGGTATGATGGGAAGTGGG + Intronic
1085348068 11:75780883-75780905 TGAAAGGTATGATGCACAAGAGG - Intronic
1085506359 11:77063034-77063056 GAACAGGTATGATGGAAATTGGG - Intergenic
1086529855 11:87772105-87772127 TGAAATGCATGATGGAAAGGGGG + Intergenic
1087771484 11:102215119-102215141 TTAAAGCTGTGTTGGAAAATAGG + Intronic
1088040228 11:105373002-105373024 TGATAGGTAAGATGTAAAAGGGG - Intergenic
1088509985 11:110564474-110564496 TGAAAGGTATGTTAAAAATTGGG - Intergenic
1090739809 11:129648317-129648339 TGAAAGAGATTGTGGAAAATTGG - Intergenic
1090775814 11:129964587-129964609 TGAAAGGTATGATATTACATGGG - Intronic
1091397351 12:162128-162150 GGAAAGGTAAGAAGGAGAATGGG - Intronic
1092592162 12:9962417-9962439 TGAAAGTTATAACGGAAAAAAGG - Intronic
1092667266 12:10816391-10816413 TGCAATGTAAGATGTAAAATAGG + Intergenic
1092943827 12:13435096-13435118 TGAAATGTAAGATGTAAAATTGG + Intergenic
1093947469 12:25126140-25126162 TGAAAGGCATGAAGCAAAACAGG + Intronic
1094044262 12:26149994-26150016 TGAAAGGTAGGAAGAAACATGGG + Intronic
1094648467 12:32350749-32350771 TGAAAGGTATGAGAGGAAAAAGG + Intronic
1095284434 12:40391309-40391331 AGAAAGGGATGATGGGAAAGAGG + Intergenic
1095288097 12:40440261-40440283 TGGAAGGCAGGATGCAAAATGGG - Intronic
1096280587 12:50249551-50249573 TGAAAGGGATGTTGGAAAATAGG - Intronic
1096745538 12:53724621-53724643 TACAAGGGAAGATGGAAAATTGG - Intronic
1096938776 12:55316926-55316948 TGAAAGCTGTGAGGGAACATAGG - Intergenic
1097241396 12:57577985-57578007 TGGAAAGAATGATGAAAAATTGG - Intronic
1098673688 12:73263191-73263213 TGAAGGGTAAGAAGGAAAAGAGG + Intergenic
1100595379 12:96067195-96067217 TGAAAAGTATGAGAGAAAACAGG - Intergenic
1100705492 12:97196134-97196156 GGAAATGTCTGATGGAAATTTGG - Intergenic
1101144544 12:101828990-101829012 TGTAAGGCATAATGGAAAAGAGG - Intronic
1102648881 12:114422595-114422617 TAGAAGGTAGCATGGAAAATTGG - Intergenic
1102648887 12:114422640-114422662 TAGAAGGTAGCATGGAAAATGGG - Intergenic
1103989416 12:124788483-124788505 TGAAAGGGAGGAGGGAAAAAAGG - Intronic
1104348613 12:128025324-128025346 TGATAGGAGTGATGGAAAAGAGG + Intergenic
1105497709 13:20945269-20945291 TCAAAGGTATGATGGAGAAGTGG - Intergenic
1105848818 13:24316509-24316531 TGACAGGTATGATGGATTTTTGG + Intronic
1105882127 13:24614473-24614495 TGAGAGGTGTGATGGAAGATGGG - Intergenic
1106575913 13:30974822-30974844 TGAAAAGTATGAAGAAAAACAGG - Intronic
1107379954 13:39845902-39845924 AGAAAAGTATGATGTTAAATGGG - Intergenic
1108937784 13:55906369-55906391 TGAAAGGAGAAATGGAAAATTGG - Intergenic
1108945031 13:56011600-56011622 TGAAAGGGATGATGGACAGATGG - Intergenic
1108986177 13:56590926-56590948 TGAAAGGGATGATAGAAGAACGG + Intergenic
1109157407 13:58927923-58927945 TGAAAGGAAGGAAGGAAAAATGG + Intergenic
1109455912 13:62589021-62589043 TGAAAGTGATGATGGTATATTGG - Intergenic
1110194487 13:72771338-72771360 GGAAAGCTATGAAGGAAAACTGG + Intronic
1110478888 13:75950637-75950659 TGGAAGGAGTGATGAAAAATGGG - Intergenic
1110859225 13:80329076-80329098 TAAAAGGTATTATGGTAGATAGG - Intergenic
1110872673 13:80470569-80470591 TGAAAGGAAGGATGGAAAGAAGG - Intergenic
1110882148 13:80585215-80585237 GGGAAGGTATGTTGGAAACTTGG - Intergenic
1111093653 13:83480118-83480140 AGAAAGGTAATAAGGAAAATTGG - Intergenic
1111870591 13:93826712-93826734 TGAAAGGTAAGATGGCACACCGG - Intronic
1114029310 14:18562085-18562107 GGAAAGGTATTATAGAGAATAGG - Intergenic
1116400425 14:44499779-44499801 TGATAGGTATTATGCAGAATTGG - Intergenic
1116623230 14:47232852-47232874 AAAGAGGAATGATGGAAAATAGG + Intronic
1116963231 14:50988505-50988527 TGAAAGGAGTCAAGGAAAATTGG - Intronic
1117031356 14:51674255-51674277 TGAAAGTCATGAAGGAATATAGG + Intronic
1117638046 14:57768076-57768098 TGGAAGAGATTATGGAAAATTGG - Intronic
1120062739 14:80003126-80003148 GAAAAGGTGTGATGGAAAACTGG + Intergenic
1120540797 14:85747953-85747975 TGAAAGGTATAATGAAAACCGGG - Intergenic
1121970597 14:98352442-98352464 TGAAAGGCAGGAAGGAAGATGGG + Intergenic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1124855999 15:33389724-33389746 TGAAAGGTAACATGCAAAACAGG + Intronic
1125555353 15:40580198-40580220 TAAGAGGTGAGATGGAAAATGGG - Intergenic
1126517805 15:49555409-49555431 TGGAAGGTCTGCTGGTAAATTGG + Intronic
1127061739 15:55193587-55193609 TAAAAGGTATGACAGATAATAGG + Intronic
1129382157 15:75174715-75174737 TGAGAGGCATCATGGAAAAAAGG + Intergenic
1130167032 15:81472224-81472246 TGACAGAAATAATGGAAAATTGG + Intergenic
1133363037 16:5188964-5188986 TAAAAGGTCTGATGGTACATGGG + Intergenic
1133553568 16:6882884-6882906 TGGTAAGTATAATGGAAAATAGG - Intronic
1137422740 16:48349950-48349972 TCAAAACTATGAGGGAAAATGGG + Intronic
1137861708 16:51853482-51853504 TGAGAGGTAAGAAAGAAAATGGG + Intergenic
1140529740 16:75654519-75654541 GGAAAGGGAAAATGGAAAATGGG + Intronic
1140678323 16:77357262-77357284 TGGAAGGAATGCTGGAAAAATGG - Intronic
1140731361 16:77859517-77859539 TGAAAGCTGTGATGGACATTGGG + Intronic
1140914084 16:79479251-79479273 AGAAAGGTATGATGGTACAAAGG - Intergenic
1141924116 16:87156000-87156022 TGGGAGGGACGATGGAAAATGGG + Intronic
1147008480 17:37424048-37424070 TAAAACGTATAATGAAAAATTGG - Intronic
1147142560 17:38467529-38467551 TGAGAGGTAGGATGGAAGAAAGG - Intronic
1148236042 17:45969864-45969886 AGGAAGGAATGATGGATAATTGG - Intronic
1149003896 17:51784338-51784360 TGAAAGGTGTGAGGGAAACATGG + Intronic
1149259319 17:54861704-54861726 TGAATGAAATGAAGGAAAATGGG - Intergenic
1150384988 17:64751723-64751745 TTAAAAGTATGAGGGAAAAAAGG + Intergenic
1151088129 17:71404841-71404863 TGAATGCTTTGTTGGAAAATAGG - Intergenic
1152432111 17:80254231-80254253 GGAAAGGAAGGAAGGAAAATGGG - Intergenic
1153372275 18:4332797-4332819 TGAGAGGTCAGAAGGAAAATGGG - Intronic
1159090230 18:63839943-63839965 TGAAAGATATGATTAAAAACAGG - Intergenic
1160929760 19:1564885-1564907 TGAAAGGTATGCTTGAGAACGGG + Intronic
1162446155 19:10724101-10724123 CGATAAGTATGATGGAAAAAAGG + Intronic
1162696612 19:12481559-12481581 TGAAAGGTATGATGCAACTAAGG - Intronic
1164892818 19:31839575-31839597 TGAAAGGTATGATGTGAAGTGGG - Intergenic
1167840019 19:52108516-52108538 TGAAAGGAGTGATGACAAATGGG + Intergenic
925226386 2:2187003-2187025 AAAAAGGTATGATCGAAACTTGG + Intronic
926483781 2:13430951-13430973 GCAAAGGTATGCTGGAAAACAGG - Intergenic
926744834 2:16142664-16142686 TGAAGGGTATGAAGGAAAGCAGG + Intergenic
928382933 2:30836313-30836335 TGAAAGGTATTTAGGTAAATGGG + Intergenic
930959788 2:57247092-57247114 TGAAAGGGATTATAGAGAATTGG + Intergenic
931049166 2:58390675-58390697 AGGAAGGTAAGATGGAAAGTAGG - Intergenic
931112688 2:59129162-59129184 TGAAAGGTTTCATATAAAATTGG - Intergenic
931350199 2:61480910-61480932 TTAAATGTATAATGGAATATTGG - Intronic
932389898 2:71378212-71378234 TGAAATGTATAATCAAAAATTGG + Intronic
932944025 2:76205987-76206009 AGAAAGGTAGGATCGTAAATGGG - Intergenic
933372975 2:81440749-81440771 TGTAAGAGATGATAGAAAATGGG - Intergenic
933471346 2:82729629-82729651 TTAAAGTTTTGATGAAAAATAGG - Intergenic
935182979 2:100706560-100706582 TGAAAGGCAGGAAGGAAAAATGG + Intergenic
935460719 2:103330179-103330201 TGGAAGATATGATGAAGAATTGG + Intergenic
935657912 2:105440810-105440832 TGATATGTATGATGGAAGAGGGG + Intergenic
935958611 2:108402090-108402112 AGAAAGCCATGAGGGAAAATGGG + Intergenic
937263448 2:120601091-120601113 TGAAAGGTTGGAAGGAAATTGGG - Intergenic
937435924 2:121881244-121881266 TCAAGGGAGTGATGGAAAATTGG + Intergenic
937452312 2:122011643-122011665 GGAAATGTATGATGGAGAAAAGG - Intergenic
937502208 2:122491415-122491437 TGATAGGTTTGATTGAAAACTGG + Intergenic
939980308 2:148772572-148772594 TAAAGGTTATAATGGAAAATTGG + Intronic
940214482 2:151290049-151290071 TATAAGGTATGTTGGAAAAGTGG + Exonic
940550261 2:155145481-155145503 TTAAAAGTATGTGGGAAAATAGG + Intergenic
941078041 2:161028714-161028736 TGGAAGGTAAGATGAAAAACAGG + Intergenic
941264268 2:163340434-163340456 TGAAAGGTATTATGCAGAAAGGG + Intergenic
941855786 2:170229233-170229255 TGAGAGGTAGGAAGGCAAATAGG - Intronic
942417960 2:175778436-175778458 TGAAAATCATGATGGAAAAAGGG + Intergenic
943021489 2:182579683-182579705 TTCTAGGTATGATGGAAAACAGG - Intergenic
943348599 2:186771266-186771288 AGAATGGTATAATGGAAAAAAGG + Intergenic
943988027 2:194647720-194647742 TCAAAGATATGATGGAAAATTGG - Intergenic
945527681 2:210908815-210908837 TGAAAGATATTATGGAGAATTGG - Intergenic
946539179 2:220665148-220665170 TGAAAGATAGGGTGGCAAATTGG - Intergenic
948168386 2:235880446-235880468 TGAAATGAATGACGGAAAAATGG + Intronic
948201647 2:236133637-236133659 TGCAAGGGATGCTGGGAAATGGG + Intergenic
948317309 2:237038135-237038157 TTAAAGATATGATTAAAAATGGG - Intergenic
1173066298 20:39715891-39715913 TAAGAGCTATGAAGGAAAATTGG - Intergenic
1173082719 20:39884826-39884848 TGAAAACTATGATTGAATATAGG + Intergenic
1173676318 20:44838828-44838850 CAAAAGGTAAGATGGGAAATGGG + Intergenic
1175440401 20:58986698-58986720 TGAATGGAATGATGGACAACAGG - Intronic
1177906152 21:26973376-26973398 TGAAACTTATGATAGAAAAGAGG - Intergenic
1178364550 21:31978477-31978499 TGAAGGGGATGAGGGAAAGTGGG - Intronic
1179081881 21:38178976-38178998 TGAAAGGAAAGATGGAGGATGGG - Intronic
1181991509 22:26840376-26840398 TGAAAGCAATTCTGGAAAATAGG + Intergenic
1184156428 22:42670463-42670485 AGTAAGGGATGATGGAAACTAGG + Intergenic
949291667 3:2473590-2473612 TGATAGGTATGTTCTAAAATTGG - Intronic
949940145 3:9148543-9148565 TGTAAGGTATTATTGGAAATGGG - Intronic
950765466 3:15269926-15269948 TGAAAGGTAAAATGGACCATGGG - Intronic
951126367 3:18989102-18989124 TGAAGTGTATGTTGGAAAAAAGG + Intergenic
951840876 3:27032595-27032617 TAAAAGGTATGAAGTAAAATGGG - Intergenic
952321135 3:32278709-32278731 TAAAAGGTATTATGTAAAATTGG - Intronic
955033002 3:55238831-55238853 TTCAAAGTATGATGGACAATTGG - Intergenic
955608195 3:60729439-60729461 TAAAATGTATGGGGGAAAATAGG + Intronic
956975658 3:74575723-74575745 TGAAAGAGATGAGGGAAAAGGGG - Intergenic
957298579 3:78362362-78362384 TGATAGGTATGGGGGAAAAAAGG + Intergenic
957582922 3:82099197-82099219 AGATAGGTTTGATGGAAAATAGG - Intergenic
957684593 3:83485137-83485159 TGAAAGGGATAAAGTAAAATAGG + Intergenic
959195355 3:103173658-103173680 TAAAAGGTATGATGGGAAGAGGG - Intergenic
961966111 3:130904688-130904710 TGTAAAGTATGATGGAACACAGG - Intronic
962132010 3:132689832-132689854 TCAAAGGAATCATGAAAAATTGG + Intronic
962324895 3:134424799-134424821 TGAAAAGCGTTATGGAAAATGGG + Intergenic
962850688 3:139306450-139306472 TGAAAGGAAGGATGAAAAATGGG + Intronic
962904989 3:139793476-139793498 TGAAAGGAATGAAGGACAAATGG - Intergenic
963161468 3:142154712-142154734 TGAAAAGTGTGATGGCAAACAGG + Intergenic
963222753 3:142828994-142829016 TGAAGGTTAAGATGTAAAATAGG - Intronic
963559441 3:146843549-146843571 TGAAAGGTATGGTGAAGCATTGG + Intergenic
963641847 3:147870240-147870262 TGTCAGGTCTGATCGAAAATAGG - Intergenic
964371585 3:156005570-156005592 GGAAAGGGATGAGAGAAAATGGG + Intergenic
964386834 3:156156403-156156425 TGAATGCTATGTTGGAAAATAGG + Intronic
964435324 3:156645324-156645346 TGAAATGTATGTTGGACAACAGG - Intergenic
964733153 3:159888949-159888971 TGTAAGATATGCTTGAAAATAGG + Intronic
965362603 3:167760060-167760082 TCAAAGGTATGATGAGAAACAGG - Intronic
966031969 3:175360646-175360668 AGAAAATTATGAGGGAAAATTGG - Intronic
967382812 3:188879302-188879324 TAATAGGTAGGATGGAAAGTAGG - Exonic
967799868 3:193644750-193644772 TGAAAGGAATGAAGAAAGATGGG - Intronic
968482142 4:838159-838181 GGAAAGGTCTGATGGAATCTGGG + Intergenic
971267429 4:25107795-25107817 AGAAAAGAATAATGGAAAATGGG - Intergenic
972103444 4:35451029-35451051 TGAAAAATATTATAGAAAATTGG - Intergenic
972203506 4:36744272-36744294 TGAAAGACATGGTAGAAAATTGG - Intergenic
972555096 4:40173489-40173511 TGAGAGGTATGAGGGAACAGAGG + Intergenic
972565403 4:40264971-40264993 TGAGAGGTTTGAAGGAAGATGGG + Intergenic
974268634 4:59619853-59619875 TGAAATACATGATGTAAAATTGG - Intergenic
974502189 4:62720793-62720815 TAAAAGGTATAATGGAACTTTGG + Intergenic
975231494 4:71939514-71939536 TGAAAGGTTAGATGGATATTTGG + Intergenic
976635129 4:87279664-87279686 GGAAAGGAAGGATGGAAAATGGG + Intergenic
976966432 4:91047102-91047124 TGCAAGGAATGCTGGGAAATGGG + Intronic
978884019 4:113744470-113744492 AGAAAGGTATGAAGGAAATTAGG - Intronic
980656087 4:135788438-135788460 TGGAAGTTATGTTGGAAATTGGG - Intergenic
981054103 4:140342118-140342140 TGGGAGATATGGTGGAAAATAGG - Intronic
981256249 4:142663132-142663154 AGAAAGGTATGAAGTACAATGGG + Intronic
982400899 4:154966719-154966741 TGAAAAGTATGATCTAATATAGG + Intergenic
982623645 4:157736400-157736422 TGGAAGTACTGATGGAAAATAGG + Intergenic
982633162 4:157858101-157858123 GGAAAGGTATTTTGGAACATGGG + Intergenic
982710635 4:158755449-158755471 TGAAAGCTATGCAGGAAAAGAGG - Intergenic
982721533 4:158864988-158865010 AGAAAGGAATGGTGGCAAATGGG - Intronic
982824144 4:159980827-159980849 TTCAAGGAATCATGGAAAATAGG + Intergenic
983914781 4:173280764-173280786 TGAGAGGAATGATGCAGAATAGG + Intronic
984226572 4:177042634-177042656 TAAAATGTGTGAAGGAAAATAGG - Intergenic
984320719 4:178192280-178192302 TGAAAGGTAAGAAAGAAAAGTGG + Intergenic
986287975 5:6374488-6374510 TGAAAGGTATGGGGGAATAAAGG + Intronic
986638618 5:9849841-9849863 TGAAAGGTATAGAGGAAGATGGG - Intergenic
987022441 5:13888493-13888515 TGAAAAGGATGATGGAGAAAAGG - Intronic
987824724 5:23015239-23015261 TGGAAGGTATAACTGAAAATAGG - Intergenic
987990572 5:25206180-25206202 TGAAAGGGATGATGTAATGTTGG + Intergenic
988050368 5:26021580-26021602 GGGAAGGTAGGAAGGAAAATAGG + Intergenic
988345698 5:30035524-30035546 AGAGGGGTAGGATGGAAAATTGG + Intergenic
988730562 5:33968653-33968675 TGACAGGTAAAATGGGAAATTGG + Intronic
989215943 5:38904714-38904736 TGAAAGGTAAGAGAGAAGATAGG - Intronic
989776341 5:45212423-45212445 TGAAAGGTCTGGTTGTAAATTGG - Intergenic
990243011 5:53834498-53834520 TGAAAGTTACCATGGGAAATGGG - Intergenic
990338299 5:54796507-54796529 TAAAAGGAATGATAGAAAACAGG - Intergenic
991631467 5:68660667-68660689 GGAAAGGCATGATGGGAAACTGG + Intergenic
992493615 5:77270484-77270506 TGAACGGTAAGAGGGAATATGGG - Intronic
993332494 5:86617925-86617947 TGAAAAGAAAGATGGGAAATGGG - Intronic
993394620 5:87368975-87368997 TAAAAGTAATCATGGAAAATAGG - Intronic
994149052 5:96427342-96427364 TGAATGGTATAGAGGAAAATTGG + Intronic
994874341 5:105396838-105396860 GGAAAGATAAGATGGAAAGTGGG + Intergenic
996259384 5:121446649-121446671 TGAAGGGTATGATGTAAACCTGG + Intergenic
996547964 5:124700710-124700732 TAAAAGGTATTGTGGAAATTAGG - Intronic
997301235 5:132807083-132807105 TGAAAGGGATGATTAAAGATGGG + Intronic
998083510 5:139296281-139296303 TGAAGAGTATGATGGGAAAATGG + Intronic
998609047 5:143667813-143667835 TGAAAGAGATCATGGAAAATAGG - Intergenic
998690538 5:144582584-144582606 TAAAAGGTAAGATGGAATAGTGG + Intergenic
999409775 5:151340585-151340607 AGAAAGGTAGGAGGGAAACTAGG + Intronic
999586608 5:153095965-153095987 TGTAAGGTACAATGGAAAAAAGG - Intergenic
1000132189 5:158310224-158310246 GGAAAGGGAGGAAGGAAAATAGG - Intergenic
1000392259 5:160736328-160736350 GCAAAGGTATGATGATAAATGGG + Intronic
1000479006 5:161747760-161747782 TGGAAGAGATTATGGAAAATTGG + Intergenic
1000957931 5:167564169-167564191 AGAAAGGGAGGATGGAGAATTGG + Intronic
1001342961 5:170863680-170863702 TAAAAGGTATGGTGGAACTTTGG + Intronic
1003250380 6:4424272-4424294 TGAAAGAGATTATGAAAAATTGG - Intergenic
1003673738 6:8183319-8183341 TGGAAGGTTTGATTGAAAAGGGG + Intergenic
1004450562 6:15741477-15741499 TGAAAAGTATGCAGGGAAATAGG + Intergenic
1005445979 6:25923674-25923696 AGGTAAGTATGATGGAAAATAGG - Exonic
1005449897 6:25962411-25962433 TGAAGGGTGTGGTGGAAAAAGGG - Intergenic
1007145948 6:39631815-39631837 TGAAAGAGATTATGTAAAATTGG + Intronic
1007990729 6:46252808-46252830 TGAAGGGTATGAAGAAAAACTGG + Intronic
1008006052 6:46410411-46410433 TCAAATGTACGATTGAAAATAGG - Intronic
1008043422 6:46827372-46827394 AGAAAGGGAAGATGGAAAAATGG - Intronic
1009024138 6:57977671-57977693 TGAAAGGTATCAAGCAAAAATGG + Intergenic
1009477625 6:64114091-64114113 TGAAAGCTATGAGGAAAAAGTGG + Intronic
1009516584 6:64626936-64626958 TGAAAGGTATGCTCCATAATTGG + Intronic
1010521428 6:76842955-76842977 TAAAAGGCATGATGAAAAAGAGG + Intergenic
1010943297 6:81945361-81945383 TGCTAGGTATTAGGGAAAATAGG - Intergenic
1010946219 6:81976310-81976332 TGAAATACATTATGGAAAATGGG - Intergenic
1011190151 6:84719727-84719749 TGAAAAGGATGATGGGGAATGGG + Intronic
1012874533 6:104710981-104711003 TGAAAGGTATTTTGGAATCTAGG - Intergenic
1013250567 6:108329103-108329125 TGAAAGGAAGGAGGGAAGATAGG - Intronic
1014038054 6:116791003-116791025 TGAAAGGTGGTATGGAATATAGG - Intergenic
1014354503 6:120388672-120388694 TGGAAGGTTTGATGGAAGAAAGG - Intergenic
1014678499 6:124398471-124398493 TGAAAGGTATGATGGAAAATAGG + Intronic
1014931926 6:127345393-127345415 TAAAAAGAAAGATGGAAAATGGG - Intergenic
1015232370 6:130930165-130930187 TGAAAGGAATAATGGGAAACAGG - Intronic
1015399819 6:132776554-132776576 TCAAAGGTAAGATGAAAATTAGG - Intronic
1015623507 6:135156795-135156817 TGATAGGTAAGATAGAAAAGAGG - Intergenic
1016562311 6:145410373-145410395 TGAGAGGTTTGAGGGCAAATTGG + Intergenic
1016945888 6:149532410-149532432 TGAAAGATATGTTGAACAATTGG - Intronic
1017221056 6:151966519-151966541 TGAAAGACATGATAGATAATGGG - Intronic
1017588919 6:155957539-155957561 AAAAAGGTTTGATGAAAAATTGG - Intergenic
1018204286 6:161422664-161422686 TGAAAGGAATAGAGGAAAATAGG + Intronic
1019641390 7:2105632-2105654 TGAAGGTTCTGAGGGAAAATGGG + Intronic
1019695711 7:2445110-2445132 TAAAAGGTTTGATTGAAAACTGG + Intergenic
1019908090 7:4079821-4079843 TGAAAGTTGTGATTCAAAATAGG + Intronic
1020679974 7:11224175-11224197 TAAAAAGAATCATGGAAAATTGG + Intergenic
1020985627 7:15130590-15130612 GGAAAGGAACGATTGAAAATAGG + Intergenic
1021132346 7:16926352-16926374 TGAAAGGTATGCTTAAAAACAGG + Intergenic
1021247041 7:18275838-18275860 TGACAGGTATGTTAGAAAATAGG - Intronic
1021409314 7:20311548-20311570 TGAAAGTTGTCATGTAAAATGGG - Intergenic
1021534726 7:21690305-21690327 TGAAAGGTATGGAGGGAAAGAGG + Intronic
1021919669 7:25472191-25472213 TGAAATGTAACATGGAAAATGGG + Intergenic
1022467186 7:30659955-30659977 TTAAAGGTATGATATATAATGGG + Intronic
1023126867 7:36962903-36962925 GGAAAAGTATTACGGAAAATTGG + Intronic
1023572745 7:41589225-41589247 TGAAAGCTAGTATAGAAAATAGG - Intergenic
1026924086 7:74177373-74177395 TGAAATGTATACTGAAAAATGGG - Intronic
1027296328 7:76775730-76775752 TGAAAGGGAGGATGGAATAAGGG + Intergenic
1027660582 7:80983622-80983644 GGAAAGGGATGATGAAAAAATGG + Intergenic
1028495800 7:91459215-91459237 TGAAAGAGATGATGTAAAGTTGG - Intergenic
1029631091 7:101750957-101750979 TGAAAGGCATTATGAAAACTAGG - Intergenic
1030314135 7:108097071-108097093 TGAAAGGTATGATGGGAAATTGG + Intronic
1030811864 7:113982349-113982371 AGTAAGGTATGATGGGAAATTGG + Intronic
1031352862 7:120757034-120757056 TGAAAAGTAGGAAGGATAATAGG - Intergenic
1032663151 7:134007830-134007852 TGCAAGGTAGGAGGGAAAACTGG + Exonic
1034006028 7:147473222-147473244 TGAAAGGGATTAGGGAAATTAGG + Intronic
1036166470 8:6438841-6438863 TGAAAGGGAAGAAGGAAAACGGG + Intronic
1037148412 8:15603371-15603393 TGATAAGTATGTGGGAAAATGGG + Intronic
1037235656 8:16716863-16716885 TAAAAGTTAAGATGGAAACTGGG + Intergenic
1038819138 8:30936277-30936299 TGAAATATGTGATGGAAATTTGG + Intergenic
1040414729 8:47186273-47186295 TGAGTTGTATGATGGGAAATGGG - Intergenic
1041053606 8:53960654-53960676 TGAAAGGTCTGATGAGAAAGGGG - Intergenic
1041622796 8:59991838-59991860 TGAAATGTTTGATAGAATATAGG - Intergenic
1041970263 8:63733184-63733206 TGAAGGGTAAGAAGGAGAATTGG - Intergenic
1043347157 8:79311847-79311869 TAAAAGGTAAAATGGAAAAGAGG + Intergenic
1043467222 8:80522893-80522915 GGGAAAGTGTGATGGAAAATAGG + Exonic
1043614161 8:82104697-82104719 TGGAAAGAAAGATGGAAAATAGG + Intergenic
1044154622 8:88828254-88828276 GGAAAGGTATGTTGGAATATTGG - Intergenic
1045547631 8:103142098-103142120 TGAAATCTAAAATGGAAAATAGG + Intronic
1049007891 8:139867419-139867441 TTAAAGGTCTGATGAAGAATCGG + Intronic
1050059245 9:1687899-1687921 TAAAGGGCATGATGGAACATGGG + Intergenic
1050121105 9:2308119-2308141 ATAATGGTATTATGGAAAATGGG + Intergenic
1050852895 9:10310597-10310619 GGAAAGGAATAATGGAAATTTGG + Intronic
1052139574 9:24962817-24962839 TAAAACATCTGATGGAAAATTGG - Intergenic
1052762421 9:32606156-32606178 TGCAAGGGAGGCTGGAAAATGGG + Intergenic
1053534145 9:38909196-38909218 TTAAAGGTAGGATGCAAATTAGG - Intergenic
1054206369 9:62133615-62133637 TTAAAGGTAGGATGCAAATTAGG - Intergenic
1054631989 9:67454731-67454753 TTAAAGGTAGGATGCAAATTAGG + Intergenic
1054872936 9:70066119-70066141 GGATAGGTATGAAGGAAGATTGG + Intronic
1057326860 9:94073069-94073091 TGGAAGGCATTGTGGAAAATTGG + Intronic
1057980952 9:99662663-99662685 TGCATTTTATGATGGAAAATGGG + Intergenic
1057986726 9:99724349-99724371 TAACAGATATTATGGAAAATGGG - Intergenic
1058128364 9:101222319-101222341 TGAGACATATGATGGAAAAATGG - Intronic
1058777506 9:108299290-108299312 TGAAAGGATTGGTGAAAAATAGG - Intergenic
1059850504 9:118333122-118333144 AGAAACATATCATGGAAAATGGG - Intergenic
1060244388 9:121931859-121931881 AGAAAGGCATGAAGGAAGATGGG - Intronic
1060769414 9:126320648-126320670 TGCAAGGGAGGATGGGAAATTGG - Intergenic
1061633818 9:131892409-131892431 TTAAAGGTATCATGCAAAGTAGG + Intronic
1185664292 X:1752423-1752445 TGAAAAGAATGCTGGAAATTCGG + Intergenic
1187349887 X:18503665-18503687 TAAAATGTATGATTGAAAAGAGG - Intronic
1187825071 X:23326952-23326974 TTACAGGAATGATAGAAAATGGG - Intergenic
1189017156 X:37296190-37296212 GCAAAGAAATGATGGAAAATTGG - Intergenic
1190107897 X:47572426-47572448 GGAAAATTATGATGGGAAATAGG + Exonic
1190155540 X:47988984-47989006 TGAAAAGTTTGATGAAGAATGGG + Intronic
1191952215 X:66604821-66604843 TGAGAGTGATGATGGAAAAGCGG + Intronic
1192117317 X:68423659-68423681 TGAAAGGAATCATGAACAATAGG + Intronic
1192722402 X:73712877-73712899 TTAGAGATATCATGGAAAATGGG - Intergenic
1192771955 X:74202643-74202665 TGACAGGGATGGGGGAAAATAGG + Intergenic
1194149983 X:90311590-90311612 TGAAAGGTAGAATGGAACAAAGG + Intergenic
1195533832 X:105987788-105987810 TGAAAGATATTGTGGAGAATTGG + Intergenic
1197166331 X:123381596-123381618 AGAGAGGGATGATGGAAATTAGG - Intronic
1198669242 X:139060925-139060947 TGAAAAATTTAATGGAAAATAGG - Intronic
1198801907 X:140456833-140456855 TGAAAGCAATCATGGGAAATAGG - Intergenic
1200286344 X:154826242-154826264 TGAAAGAAAATATGGAAAATAGG - Intronic
1200496410 Y:3888673-3888695 TGAAAGGTAGAATGGAACAAAGG + Intergenic
1201356880 Y:13106476-13106498 TGAAAAGGATGATGATAAATTGG + Intergenic
1201940228 Y:19450995-19451017 TGAGAGATATGAGGTAAAATTGG - Intergenic