ID: 1014685160

View in Genome Browser
Species Human (GRCh38)
Location 6:124488495-124488517
Sequence AGATGTACCTGGAAAATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 1, 2: 3, 3: 22, 4: 196}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014685160 Original CRISPR AGATGTACCTGGAAAATGGG TGG (reversed) Intronic
900596170 1:3481157-3481179 GTATGTCCCTGGAAAATGTGTGG - Intergenic
902991337 1:20189360-20189382 AGATGGAACTGGAGATTGGGAGG + Intronic
905953288 1:41971393-41971415 AGATGAATCTGGAAAATAGGCGG - Intronic
906722707 1:48020658-48020680 AGATGAAACTGGAAAATGCTGGG + Intergenic
907553366 1:55323594-55323616 AGATGGACCCAGAAAATGGTGGG + Intergenic
909505884 1:76389198-76389220 AAAGGTATCTGCAAAATGGGAGG + Intronic
909850955 1:80463520-80463542 AGATATTCATGGAAAATGGTGGG + Intergenic
911816731 1:102361860-102361882 AGATACACCTGTAAAATGAGAGG + Intergenic
912370431 1:109169809-109169831 AGCAGTAGCTGGTAAATGGGAGG + Intronic
913697068 1:121337151-121337173 AAATGTAACTAGAAAATGGAAGG - Intronic
914140489 1:144942896-144942918 AAATGTAACTAGAAAATGGAAGG + Intronic
914982353 1:152425905-152425927 AGAAATAGCTAGAAAATGGGTGG - Intergenic
916829632 1:168477255-168477277 AGAATTAGCTAGAAAATGGGTGG - Intergenic
916850735 1:168700764-168700786 AGTTTTGGCTGGAAAATGGGAGG - Intronic
919317223 1:195987134-195987156 AGAAGAACCAGGAAAATGGGTGG - Intergenic
919382809 1:196879329-196879351 AACTATACCTTGAAAATGGGTGG + Intronic
920146117 1:203862326-203862348 AGATGTAACTGGAGATTGGAGGG + Intronic
920484402 1:206355486-206355508 AAATGTAACTAGAAAATGGAAGG - Intronic
920951287 1:210573905-210573927 AGATGAACCAGGGAAATGAGAGG + Intronic
921675592 1:217972626-217972648 AGCAGTACCTGGCACATGGGAGG - Intergenic
923144509 1:231188461-231188483 AGATGCAGCTGGAAGATGGTGGG + Intronic
1064495488 10:15905640-15905662 AAATGTACCTGGAAAAGGGGTGG - Intergenic
1066428923 10:35334655-35334677 AGATGTCCATGGAAAATAAGTGG - Intronic
1066561097 10:36670725-36670747 GGAAGCACATGGAAAATGGGAGG - Intergenic
1069667629 10:70174108-70174130 AGATGTTCCTGGAAACTGCCAGG - Intergenic
1070983630 10:80669659-80669681 CAATGTCCCTGGAAGATGGGAGG - Intergenic
1073578902 10:104646065-104646087 AGATGTAGCTGGGAAATGCATGG + Intronic
1074954480 10:118374955-118374977 AGATTAACCTGGAAATTTGGAGG - Intergenic
1077018980 11:409196-409218 AGGTGCATCTGGGAAATGGGGGG - Intronic
1077868600 11:6242866-6242888 AGATGTTGGTGGAGAATGGGTGG - Intronic
1077929630 11:6717481-6717503 ATATGTACCTCTAACATGGGTGG - Intergenic
1078638459 11:13074023-13074045 AGTGGCACCTAGAAAATGGGAGG - Intergenic
1080830810 11:35891602-35891624 GGATATACATGGAAAATAGGGGG + Intergenic
1081337870 11:41889729-41889751 TGATGTACCTGGATAAAGAGTGG - Intergenic
1081625646 11:44653668-44653690 AGAAGAACCTGGAAAGTGGGGGG + Intergenic
1081685935 11:45043036-45043058 AAATGTGCCTGGAAAATGTGAGG - Intergenic
1081718598 11:45269036-45269058 AGCTTTACCTGGAGAAGGGGAGG + Intronic
1083805736 11:65072696-65072718 TGATGTGCCTGGACACTGGGGGG + Intronic
1090070793 11:123543259-123543281 AGATTTACCTGGAGCATGGTAGG + Intronic
1092890788 12:12967411-12967433 AGGTGCACCTGGAGAATGGCAGG + Intergenic
1096955706 12:55523790-55523812 TGATGTCCCTGGAAAATTTGGGG - Intergenic
1098322247 12:69257891-69257913 AGTTTTACCTGGAAAAGGTGGGG - Exonic
1099856811 12:88178397-88178419 AGAAGTCACTGGAAAATGGGAGG - Intronic
1101805774 12:108062362-108062384 AGGTGTACCTTGTAAAAGGGTGG - Intergenic
1106760335 13:32861466-32861488 AGATATACCAGGAAAGTGGATGG - Intergenic
1107557340 13:41528337-41528359 AGAATTAGCTAGAAAATGGGTGG - Intergenic
1110116063 13:71818107-71818129 AAATGTACTTTGAAAATGGCTGG - Intronic
1111628645 13:90821543-90821565 AGCTGTACCTGGAAAATAACTGG - Intergenic
1112369524 13:98782599-98782621 AGATTTACCTGGAGACAGGGTGG - Intergenic
1112622984 13:101070969-101070991 AGAAGTGCCAAGAAAATGGGGGG + Intronic
1114131400 14:19797357-19797379 AGTGGTACCTGGCAAATGGGAGG - Intronic
1114342789 14:21762362-21762384 AGATCTACCAAGAAAATGGAAGG + Intergenic
1114495631 14:23129793-23129815 AGATGCACTGGGAAAGTGGGAGG + Exonic
1114901587 14:27067180-27067202 AGATGTTACTGGAAATTGGAAGG - Intergenic
1115964715 14:38874838-38874860 AGATGTAGGTGGAAAAGGGAAGG + Intergenic
1117093302 14:52271512-52271534 ATATGTACAAGGAAAATGTGGGG + Intronic
1117197490 14:53354888-53354910 ATATGTAACTGGAAAGTGGCAGG - Intergenic
1120434335 14:84461501-84461523 AGTTGTAACTGCAAAATAGGAGG + Intergenic
1121586595 14:95067210-95067232 AGAAGTAAGTGGGAAATGGGTGG - Intergenic
1122178578 14:99938565-99938587 AGGTGGGCCTGGAGAATGGGTGG - Intronic
1122178598 14:99938627-99938649 AGGTGGGCCTGGAGAATGGGTGG - Intronic
1122865385 14:104601680-104601702 AGATGTCCCTGGAAAAGAGCAGG + Intronic
1123574463 15:21652948-21652970 AATGGTACCTGGCAAATGGGAGG - Intergenic
1123611077 15:22095536-22095558 AATGGTACCTGGCAAATGGGAGG - Exonic
1126946996 15:53832500-53832522 AGAAGTCCCTGGCAAATGAGGGG + Intergenic
1128254391 15:66186167-66186189 AGATGTCACTGGAAAAGAGGAGG + Intronic
1130063209 15:80584274-80584296 AGAGGGGCCTGGAAAATGGGTGG + Intronic
1130402760 15:83572890-83572912 AGATGAAGCAGGATAATGGGAGG + Intronic
1130752653 15:86728838-86728860 AGATTCATCTGGAAAATGGGTGG - Intronic
1202983325 15_KI270727v1_random:387292-387314 AATGGTACCTGGCAAATGGGAGG - Intergenic
1133849912 16:9493194-9493216 AGATGTATCTGGCACATGGCTGG + Intergenic
1134423255 16:14113849-14113871 AAATGTACCTGGAAAATTTAAGG - Intronic
1135033473 16:19057512-19057534 AAATGTACCTGTAAAAAGGCAGG + Intronic
1135536497 16:23298466-23298488 AGAGATAGCTAGAAAATGGGCGG + Intronic
1136711794 16:32243483-32243505 AGAGGAACCAGGAGAATGGGAGG - Intergenic
1136756122 16:32685924-32685946 AGAGGAACCAGGAGAATGGGAGG + Intergenic
1136811991 16:33184449-33184471 AGAGGAACCAGGAGAATGGGAGG - Intergenic
1136818467 16:33294529-33294551 AGAGGAACCAGGAGAATGGGAGG - Intronic
1136825031 16:33351062-33351084 AGAGGAACCAGGAGAATGGGAGG - Intergenic
1136830097 16:33449833-33449855 AGAGGAACCAGGAGAATGGGAGG - Intergenic
1137621917 16:49881883-49881905 AGAAGTTCCTGGAACATGGTTGG - Intergenic
1139798279 16:69500320-69500342 AGATGTTCTTGGAAACTTGGGGG + Intergenic
1202990569 16_KI270728v1_random:7419-7441 AGAGGAACCAGGAGAATGGGAGG - Intergenic
1203058260 16_KI270728v1_random:946276-946298 AGAGGAACCAGGAGAATGGGAGG + Intergenic
1145290113 17:21536532-21536554 AGATTTACATGAAAAATGAGTGG - Intronic
1147947419 17:44087782-44087804 AGCTCTACCTGGAAGAAGGGAGG - Intronic
1148510959 17:48169387-48169409 AGATATATGTGGAACATGGGCGG + Intronic
1149425844 17:56553795-56553817 AAATCTACTTGAAAAATGGGTGG + Intergenic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1153014127 18:568061-568083 AAGTTCACCTGGAAAATGGGTGG + Intergenic
1156203545 18:34860394-34860416 AGATATACCTGGAACATAGTTGG - Intronic
1158563703 18:58536493-58536515 ATATAGACCTGGAAATTGGGAGG - Exonic
1159332498 18:67016084-67016106 GAATGTACCTGGAAAATTTGGGG - Intergenic
1159457389 18:68677997-68678019 TGATGTCCCTGGAAAAGGGAAGG + Intronic
1161352988 19:3804051-3804073 AGAGCTACCTGGAAATTGGGAGG - Exonic
1161731471 19:5963618-5963640 GGATGTCCCTGGAAATGGGGGGG - Intronic
1162883954 19:13682329-13682351 AGAAATAGCTAGAAAATGGGCGG + Intergenic
1164416838 19:28052987-28053009 AGATTTACCAAGAAAATGGAAGG + Intergenic
1167733045 19:51273006-51273028 AGAAAAACCTAGAAAATGGGAGG + Intergenic
925408704 2:3626406-3626428 TTCTGTACCTGTAAAATGGGGGG + Intronic
925895848 2:8471275-8471297 AGAAGTACCTGTGAAATGTGAGG - Intergenic
926385386 2:12330746-12330768 ATGTCTGCCTGGAAAATGGGAGG + Intergenic
929117055 2:38453340-38453362 TAATCTACCTGGAAAATGGCGGG + Intergenic
929989627 2:46774803-46774825 ATATGTAGTTGGAAAATGAGAGG + Intergenic
932588039 2:73044496-73044518 ACAGATACCTGGGAAATGGGAGG + Intronic
934145586 2:89090134-89090156 AGAAATAGCTAGAAAATGGGTGG + Intergenic
934223672 2:90110437-90110459 AGAAATAGCTAGAAAATGGGTGG - Intergenic
935195663 2:100814209-100814231 AAATGTACCAGAAGAATGGGAGG - Intergenic
935760723 2:106318154-106318176 AGATATAGCTGGACAATGGCAGG + Intergenic
935827438 2:106965372-106965394 AGGAGTACCTGGAAACTTGGGGG - Intergenic
940002689 2:148982339-148982361 TTTTCTACCTGGAAAATGGGTGG + Intronic
942233055 2:173877658-173877680 AGATGGACATTGAGAATGGGAGG - Intergenic
944201673 2:197114289-197114311 AAATGTAGCTAGAAAATTGGAGG - Intronic
945395889 2:209316919-209316941 AGCTGTACCTGGAAACTGGCAGG - Intergenic
945549433 2:211201308-211201330 AAATGTACCTGGCATATGGTGGG + Intergenic
946858991 2:223982036-223982058 AAATGTACGTGCAAAATGTGGGG + Intronic
947561354 2:231155913-231155935 ATATGTAGCTTGTAAATGGGAGG - Intronic
947643131 2:231718246-231718268 AGGTGTACCTGAGAAAGGGGAGG + Intergenic
947684396 2:232070062-232070084 AGATATACCTTGTACATGGGTGG - Intronic
948527181 2:238578343-238578365 ACATGTACCTGGAGATTGGCTGG + Intergenic
948766457 2:240224096-240224118 AAATAAATCTGGAAAATGGGAGG + Intergenic
1172388418 20:34549682-34549704 AGAAATAGCTAGAAAATGGGCGG + Intronic
1173113654 20:40219736-40219758 AAATGTTCCAGGAGAATGGGTGG - Intergenic
1175589910 20:60181100-60181122 AGATGTGCCAGGAAAGTGGCAGG - Intergenic
1176994042 21:15533143-15533165 AGAAGTAAGTGGAAAATGGTAGG + Intergenic
1178041861 21:28648120-28648142 AGAAGTCCCTGGAAAATGTTAGG + Intergenic
1179420761 21:41234725-41234747 AGATGTGCCTGCCACATGGGAGG - Intronic
1181894058 22:26091219-26091241 AGATTTTGCTGGAAAATGAGAGG + Intergenic
1182006002 22:26960235-26960257 AGATGTACCTGGAAAAAGGGAGG + Intergenic
1182052065 22:27320899-27320921 AGATGTGTCTGGAGAATCGGTGG + Intergenic
1183938751 22:41280450-41280472 AGATGTACCTGGGAGAGGGATGG - Intronic
1184931915 22:47687694-47687716 AGATTTACATGCAAAATGGGTGG + Intergenic
950773991 3:15333991-15334013 GGATGTACCTGCAAAGTTGGAGG - Intronic
952281014 3:31923315-31923337 AGCTGTACCTGGTATTTGGGTGG - Intronic
953004495 3:38965537-38965559 AGATGTGGCTGGAACAGGGGTGG - Intergenic
954796350 3:53163126-53163148 AGCTGTACCTGGCTGATGGGTGG + Intronic
956781469 3:72606464-72606486 AGGTGTGCCTGGTAAATGGATGG + Intergenic
957950356 3:87118040-87118062 TGATGTAACTTGAAAGTGGGAGG + Intergenic
958628741 3:96660753-96660775 ACATTTGCCTGTAAAATGGGTGG + Intergenic
958929330 3:100192194-100192216 AGATGAGCATGGAAAATGGGAGG - Intronic
960462139 3:117949202-117949224 AGATCTACCATGCAAATGGGGGG - Intergenic
960620191 3:119629926-119629948 AGAAGTACTTGGAAAAAGAGAGG + Intergenic
961209653 3:125116005-125116027 GGCAGTACCTGGAGAATGGGAGG - Intronic
961226102 3:125248315-125248337 GGAGGTAGCTGGAAATTGGGGGG - Intronic
962533674 3:136307388-136307410 AAATGCAACTGAAAAATGGGAGG + Intronic
963285628 3:143431865-143431887 AGATGTACCTGGCAAATTGGAGG - Intronic
963668495 3:148221652-148221674 ATAAGTATCTGGAAAAGGGGAGG - Intergenic
966301055 3:178480143-178480165 AGAGGGACCTGGAAGATGGGTGG + Intronic
966479084 3:180385024-180385046 AGAAGTTCCTGCAAAATTGGGGG - Intergenic
968980262 4:3844298-3844320 AGCTGGCCCAGGAAAATGGGAGG - Intergenic
971344186 4:25797247-25797269 AGAGGCTCCTGGAAAATGTGGGG - Intronic
971747468 4:30602347-30602369 AGAGGTATCTGGAAAGTGGCTGG + Intergenic
971854302 4:32024207-32024229 AGATGAACCTGGGACATGGGAGG - Intergenic
972409352 4:38777333-38777355 TGATGTGCTTGGAAAATGTGAGG + Intronic
973542043 4:51944586-51944608 AGAATTACCTGGAGCATGGGGGG + Intergenic
975289330 4:72658554-72658576 AGAAGGGACTGGAAAATGGGAGG + Intergenic
977285595 4:95102374-95102396 GGCTGTGCCTGGAAAATGGGAGG + Intronic
979773168 4:124555147-124555169 AGGAGTACCTGGAAAATTGGAGG - Intergenic
984059898 4:174978680-174978702 AGCTGAACCTGGAAGATGGTAGG - Intergenic
984279607 4:177653318-177653340 AGAATTAACTGAAAAATGGGTGG + Intergenic
986905333 5:12488519-12488541 TGATTTACCAGGAAAATAGGTGG + Intergenic
988473679 5:31564437-31564459 AGAAGTACCAAGAAAAGGGGCGG + Intergenic
989779513 5:45247305-45247327 AGGTGGACCTGGAAAAGCGGAGG + Intergenic
991516264 5:67438979-67439001 AGATGTACCTGGGGAATTGGAGG + Intergenic
992382730 5:76254904-76254926 ATTTGTACCAGGAAAAGGGGTGG - Intronic
993812545 5:92500109-92500131 ACTTTTACCTGGAAACTGGGAGG - Intergenic
995314551 5:110753258-110753280 AGAGGTAACTGGAAGATGAGGGG + Intronic
997802797 5:136883636-136883658 AGATGGGCATGGAAAGTGGGAGG + Intergenic
998890542 5:146741232-146741254 ATATGTACATGGAGAAAGGGGGG - Intronic
999477052 5:151910031-151910053 AAATGTCACTGGAAAATGGAAGG - Intronic
1000349819 5:160344558-160344580 AGATGGCTCTGGAAAATGGTGGG - Intronic
1001240323 5:170063965-170063987 AGATGTAGCTGGAAAGGTGGGGG - Intronic
1006527992 6:34624675-34624697 AGATGTACCAGAGGAATGGGTGG - Intronic
1006988984 6:38197049-38197071 GGATGTAGCTGGAACATGGTAGG + Intronic
1007364666 6:41383032-41383054 AGATGTAGCTGGAAAGAGAGAGG + Intergenic
1007638649 6:43317696-43317718 AGATGATGCTGGAAAATGAGGGG - Intronic
1009321997 6:62303017-62303039 ATATTTACCTGGAAGATTGGGGG - Intergenic
1010208477 6:73344302-73344324 AGTTGAACCTGGGAAATGGGAGG - Intergenic
1011732024 6:90274619-90274641 AGATGCAGCTGGAAAGTGTGTGG - Intronic
1011851231 6:91631459-91631481 AGAGGTACTTGGGAAAAGGGAGG - Intergenic
1013313603 6:108920553-108920575 TGCTGTCCCTGGAAAATTGGAGG - Intronic
1014685160 6:124488495-124488517 AGATGTACCTGGAAAATGGGTGG - Intronic
1014689420 6:124544422-124544444 AGCTGTACCTGCTAAAGGGGAGG - Intronic
1015381611 6:132576473-132576495 ACATGTTCCTGGAAATAGGGAGG + Intergenic
1015684370 6:135843130-135843152 AAATGAACCCAGAAAATGGGTGG + Intergenic
1018242355 6:161790296-161790318 AGATGTATCAGGAAAATGGTGGG + Intronic
1018873706 6:167802477-167802499 AGAAGTACCTGGGAAAGGGAAGG + Intergenic
1021554485 7:21905342-21905364 AGCTGTACCTGGGAAAGGGGAGG - Intronic
1022322777 7:29303018-29303040 AGATGGACCTGGAAGATGGGCGG - Intronic
1026427259 7:70308330-70308352 GGATGTACTAGGAAAATGGAAGG + Intronic
1028074294 7:86492648-86492670 AGATGTACCTGGTATATAGTAGG + Intergenic
1028471388 7:91210586-91210608 AGATGTACCTAGAACATGTACGG - Exonic
1030332533 7:108286649-108286671 AGCTGTGTCTGCAAAATGGGAGG - Intronic
1031381292 7:121088922-121088944 AGATGTACCTGGCTAATGATGGG + Intronic
1032419846 7:131769641-131769663 AGATGTACATGGCAAATGGCTGG - Intergenic
1032510536 7:132468681-132468703 AGGTGTTCCTGGAAAAGTGGAGG - Intronic
1037375627 8:18224654-18224676 ATATGTAGCTGGAAAAGTGGGGG + Intergenic
1038389779 8:27185478-27185500 AGATGAAACAGGAAAATGCGTGG - Intergenic
1039217270 8:35286420-35286442 AGAAGCACCTGGCAAATGTGGGG - Intronic
1039393648 8:37203982-37204004 AGAAGTAGCTTAAAAATGGGAGG + Intergenic
1041362192 8:57065987-57066009 AGAGGTACTTGGCAAATGGTGGG + Intergenic
1042113811 8:65410121-65410143 AGATGCACATGTAAAATGTGTGG + Intergenic
1044399864 8:91758206-91758228 AGATGTACTTGGAAACTAGCAGG + Intergenic
1046567400 8:115919005-115919027 AATTGTACCAGGAAAATAGGAGG + Intergenic
1047523331 8:125612467-125612489 AGAGGGACCTGGCAGATGGGTGG + Intergenic
1048873608 8:138818605-138818627 AGATGCTCCTGGAGAATTGGAGG - Intronic
1048938328 8:139375436-139375458 AGAAATAGCTGGAAAATAGGTGG + Intergenic
1049045384 8:140147087-140147109 ATATGAAACTGGAAAATGAGAGG - Intronic
1049126716 8:140795707-140795729 AACTGTGCCTGGAAAATGGAAGG + Intronic
1052085864 9:24264689-24264711 GGATTTACTGGGAAAATGGGCGG + Intergenic
1052396712 9:27947965-27947987 AGATGTACCTGTAAAATGCAAGG - Intergenic
1052648591 9:31271204-31271226 AGAGGTGCCTGGGTAATGGGGGG + Intergenic
1056560945 9:87728637-87728659 AGATGTTCCGGAAAACTGGGAGG + Exonic
1057309296 9:93931792-93931814 AGAAGACCCTGAAAAATGGGAGG + Intergenic
1057414847 9:94852067-94852089 AGATGAACCTAGAACAAGGGTGG + Intronic
1058270592 9:102967591-102967613 TGAGGTACATGGAAAATTGGAGG + Intergenic
1058422284 9:104843396-104843418 AGCAGAACCTGGAAATTGGGAGG - Intronic
1059656397 9:116361523-116361545 AGATATTCCTGGAAGATGGAAGG - Intronic
1186313787 X:8347259-8347281 AGGTTTACCTGGCAGATGGGAGG + Intergenic
1187087221 X:16052982-16053004 AGAGGAAGCTGGAAAGTGGGTGG - Intergenic
1188010646 X:25052195-25052217 AAAGGTAGCTGGCAAATGGGAGG - Intergenic
1191949489 X:66572740-66572762 AGAAGAACCTGGAAATTGTGAGG - Intergenic
1195480104 X:105335115-105335137 AGAAGTCCTTGGAATATGGGAGG - Intronic