ID: 1014685998

View in Genome Browser
Species Human (GRCh38)
Location 6:124501171-124501193
Sequence GAGGTGCAGTGGTTCTCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 414}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014685998_1014686001 -9 Left 1014685998 6:124501171-124501193 CCCACAGAGAACCACTGCACCTC 0: 1
1: 0
2: 2
3: 20
4: 414
Right 1014686001 6:124501185-124501207 CTGCACCTCTACAGTGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014685998 Original CRISPR GAGGTGCAGTGGTTCTCTGT GGG (reversed) Intronic
900087881 1:907184-907206 GACGTGCAGTGGTACTGTTTTGG - Intergenic
900668244 1:3830723-3830745 GAGGTGCAGTGGTGCCATCTCGG - Intronic
901935852 1:12626209-12626231 GGAGTGCAGTGGTGCTCTCTTGG - Intergenic
902924816 1:19689107-19689129 CAGGTCCTGTGGGTCTCTGTTGG + Intronic
903599978 1:24530302-24530324 GAGGTGCAGTGGTACAATCTTGG - Intronic
905874153 1:41421794-41421816 GAGGTGCAGTGGTGCCATCTTGG + Intergenic
906194498 1:43921323-43921345 GAGCTGCAGTGCTTGGCTGTGGG - Intronic
906520287 1:46462871-46462893 GAGGTGCAGTGGTGCGATCTTGG + Intergenic
906654000 1:47534327-47534349 GAGGGGCAGTGGCTGGCTGTGGG + Intergenic
907252620 1:53151765-53151787 GAAGTGCAGTGGCTCTATCTTGG + Intergenic
907289068 1:53401303-53401325 GAGGAGAAGGGGTTCACTGTAGG + Intergenic
907427429 1:54389412-54389434 CTGGTGCGGTGCTTCTCTGTGGG - Intronic
909660531 1:78076817-78076839 GAGGTGCAGTGGTGCAATCTCGG + Intronic
910614123 1:89178273-89178295 GAAGTGCAGTGGTGCTATCTCGG - Intergenic
910923607 1:92375778-92375800 GGGGTGCAGTGGCTCTATCTTGG - Intronic
912662253 1:111542745-111542767 GGAGTGCAGTGGTTCTGTCTTGG + Intronic
912822401 1:112878601-112878623 GTCGTGCAGTGGCTCTCTGCTGG + Intergenic
913425092 1:118719985-118720007 GAGGTGCAGTGGTTCTATCTTGG + Intergenic
914161261 1:145136402-145136424 GAAGTGCAGTGGTGCTATCTTGG - Intergenic
915384412 1:155476600-155476622 GAAGTGCAGTGGTGCTATCTCGG + Intronic
916140378 1:161692273-161692295 GAAGTGCAGTGGCTCTATCTTGG + Intergenic
916211283 1:162362077-162362099 GAGCTGGAGTGCTTGTCTGTTGG - Intronic
917881667 1:179343273-179343295 GGAGTGCAGTGGTGCTATGTCGG + Intronic
918669781 1:187200650-187200672 GAGGTGCAGTGGCGCTATCTAGG - Intergenic
920502591 1:206494652-206494674 GGAGTGCAGTGGTACTGTGTCGG + Intronic
922180254 1:223227785-223227807 GAGGTGCCGAGGTTCCCCGTGGG + Intronic
922525415 1:226298839-226298861 GAAGTGCAGTGGTGCTATCTCGG - Intronic
922619536 1:226981437-226981459 GAGCTGCAGGGGGCCTCTGTGGG + Intronic
922657145 1:227395519-227395541 GAGATGCTGTGATTCTGTGTTGG - Intergenic
923764714 1:236882439-236882461 GAGGTGCAGTGGCTCGATCTCGG + Intronic
1064044724 10:12002218-12002240 CAAGTGCAGTGGTGCTCTCTCGG - Intronic
1064050788 10:12057887-12057909 GGAGTGCAGTGGCTCTCTCTTGG + Intergenic
1064722925 10:18247957-18247979 AAGGGGCAGTGGATCTCTCTGGG + Intronic
1064970206 10:21057818-21057840 CAGGTGCAGTGGCTCACTTTGGG - Intronic
1065032237 10:21599125-21599147 GAGGTGCAGTGGTGCGATCTCGG - Intronic
1065240301 10:23696819-23696841 CAGGTGCAGTGGTGGTCTCTGGG - Intronic
1065515049 10:26516491-26516513 GAAGTGCAGTGGTGCTATCTCGG - Intronic
1066079851 10:31919738-31919760 GAGGTGCAGTGGTGCGATCTCGG - Intronic
1066272161 10:33834725-33834747 GAGGTGCAGTGGTGCAATCTTGG - Intergenic
1066981004 10:42416107-42416129 GGAGTGCAGTGGTGCTATGTCGG - Intergenic
1067108610 10:43382710-43382732 GAGGTGCAGTGGTGCAATCTTGG + Intergenic
1067138334 10:43631897-43631919 GAGATCCAGTGGTTCTCTTCTGG + Intergenic
1067858020 10:49814266-49814288 GAGGTGCAGTGGTGCAGTCTTGG + Intergenic
1068067029 10:52144365-52144387 CAGTTCCAATGGTTCTCTGTTGG - Intronic
1068092111 10:52445343-52445365 GGAGTGCAGTGGTTCTATCTTGG + Intergenic
1069427629 10:68303122-68303144 GGAGTGCAGTGGTGCTCTCTGGG + Intronic
1069437019 10:68393676-68393698 GGAGTGCAGTGGTTCTATCTTGG - Intronic
1069442595 10:68442267-68442289 GAAGTGCAGTGGTGCGATGTTGG + Intronic
1069543807 10:69315254-69315276 GAGGTACAGCTGTTATCTGTTGG + Intronic
1070123261 10:73598867-73598889 GGAGTGCAGTGGCGCTCTGTTGG - Intronic
1070322306 10:75363351-75363373 GAGTTGTTGTGATTCTCTGTGGG + Intergenic
1070714938 10:78712933-78712955 GAGGTGCAGTGGTGCAATCTTGG + Intergenic
1071492059 10:86142972-86142994 GAGGTGCAGAGGAGCTCTGAGGG - Intronic
1073608351 10:104918592-104918614 GTGGGGCAGTTGTCCTCTGTGGG - Intronic
1074605635 10:114962104-114962126 GGGGTGCAGTGGTGCACTCTTGG + Intronic
1075281912 10:121146392-121146414 GAGGTCCACTGTTACTCTGTTGG + Intergenic
1075927647 10:126266174-126266196 GAGGTGCAGTGCAATTCTGTAGG - Intronic
1076007806 10:126962046-126962068 GGGGTGCAGTGGTGCGCTCTCGG + Intronic
1077286084 11:1766609-1766631 GAGGTTCTGTGGTTCTCGGCGGG + Intergenic
1077535286 11:3121106-3121128 GAGGTGCAGTGGTGCTATCTTGG + Intronic
1077656459 11:4023903-4023925 AAGGTGCTGTGTTTCACTGTTGG - Exonic
1078222958 11:9366566-9366588 GAAGTGCAGTGGTGCGGTGTGGG + Intergenic
1078296997 11:10081737-10081759 GAGGTGGAGTCTTGCTCTGTGGG - Intronic
1079438027 11:20477503-20477525 GGAGTGCAGTGGTGCTATGTCGG - Intronic
1080057216 11:27918528-27918550 GAAGTGCAGTGGTTCAATCTCGG - Intergenic
1080669311 11:34361729-34361751 GAAGTGCAGTGGTGCTATCTCGG + Intergenic
1081478694 11:43462964-43462986 GAAGTGCAGTGGTGCTATCTTGG + Intronic
1082105796 11:48219932-48219954 GGAGTGCAGTGGTGCTATGTTGG - Intergenic
1082811533 11:57481955-57481977 AAGGTGGAGTGGTTCTGTGGGGG + Intergenic
1084548794 11:69828482-69828504 GAGGTGCCGTGTGTCTCTCTTGG + Intergenic
1086101794 11:83108214-83108236 CAGGTGCAGTGGCTCACTTTGGG - Intergenic
1088007473 11:104960518-104960540 GAAGTGCAGTGGTGCTATCTTGG + Intronic
1088881768 11:113978425-113978447 GAGATGCAGTGGCTCTGTGTTGG + Intronic
1089164404 11:116463943-116463965 AAGGTGCTGTGCTTGTCTGTGGG - Intergenic
1089735197 11:120546104-120546126 GAGGTACAGCCGTTCTCTGTAGG + Intronic
1089891750 11:121888632-121888654 GGAGTGCAGTGGTTCACTCTCGG + Intergenic
1089951524 11:122532277-122532299 GGGGTGCAGTGGTGCGGTGTTGG - Intergenic
1092176428 12:6411288-6411310 GAAGTGCAGTGGTGCGATGTTGG + Intergenic
1093053453 12:14531679-14531701 GAAGTGCAGTGGTGCTATCTCGG + Intronic
1094014778 12:25850634-25850656 GGAGTGCAGTGGTTCTACGTTGG - Intergenic
1094557800 12:31519912-31519934 GAGGTGCAGGGTTTCTTTTTGGG - Intronic
1094690055 12:32759894-32759916 GGAGTGCAGTGGTGCTATGTCGG - Intergenic
1097076132 12:56396181-56396203 GGGGTGCAGTGGTGCTATCTTGG - Intergenic
1097352018 12:58558865-58558887 GGGGTGCAGTGGTGCTATCTCGG - Intronic
1100826015 12:98475215-98475237 GAAGTGCAGTGGTGCACTCTTGG + Intergenic
1101221017 12:102640597-102640619 GGGGTGCAGTGGTACTATCTTGG - Intergenic
1101307237 12:103540952-103540974 GAGGTGCAGTGGTGCAGTCTTGG + Intergenic
1101339926 12:103834173-103834195 CTGGAGCAGTGGTTCTCAGTGGG - Intronic
1101716347 12:107316694-107316716 GAGGTGCAGTGGTGCAATCTTGG + Intergenic
1102306539 12:111808999-111809021 GAAGTACTGTGGTTCTCTTTAGG + Intronic
1105312992 13:19229870-19229892 GGAGTGCAGTGGTGCTGTGTTGG + Intergenic
1105342164 13:19537651-19537673 GGAGTGCAGTGGTACTGTGTTGG + Intergenic
1105366364 13:19769086-19769108 GGAGTGCAGTGGTTCCATGTCGG - Intronic
1105524343 13:21162414-21162436 GAAGTGCAGTGGTGCTATCTCGG + Intronic
1106192109 13:27462900-27462922 GAAGTGCAGTGGTGCTATCTCGG + Intergenic
1106740510 13:32635817-32635839 GAAGTGCAGTGGTGCTATCTCGG + Intronic
1107594439 13:41947879-41947901 GGGGTGCAGTGGTGCAATGTCGG - Intronic
1108548210 13:51517690-51517712 GAGGTGCAGTGGTGCAATCTTGG - Intergenic
1110109327 13:71723739-71723761 GAAGTGCAGTGGTGCTGTCTTGG + Intronic
1110982242 13:81915651-81915673 GGGGTGCAGTGGTTCCATCTTGG - Intergenic
1111685474 13:91495970-91495992 GAAGTGCAGTGGTGCTATCTCGG - Intronic
1112332442 13:98486699-98486721 GTAGTTCAGCGGTTCTCTGTTGG - Intronic
1115197822 14:30820731-30820753 GAGGTGCAGTGGCTATTTATAGG + Intergenic
1115218116 14:31032572-31032594 GAGGTGCAGTGGTGCGATCTCGG + Intronic
1116414276 14:44661797-44661819 GAAGTGCAGTGGTGCTATCTCGG - Intergenic
1118196564 14:63632059-63632081 GGAGTGCAGTGGTGCACTGTCGG - Intronic
1118390794 14:65293664-65293686 GGGGTGCAGTGGTGCTATCTTGG - Intergenic
1118907120 14:70031268-70031290 GAGGTGAAGAGTTTCCCTGTTGG - Intronic
1119478316 14:74944594-74944616 GAGGTGCAGTGGATCTATCTCGG + Intronic
1120141745 14:80937268-80937290 GAAGTGCAGTGGTGCTATCTTGG - Intronic
1120236768 14:81901227-81901249 CAGGTGAAGTGAATCTCTGTAGG + Intergenic
1120613692 14:86675215-86675237 GAGTTTCAGTGGCTCTGTGTAGG + Intergenic
1121160774 14:91737648-91737670 GAGGTGCAGTGGTGCGATCTAGG - Intronic
1121353912 14:93197259-93197281 GAAGTGCAGTGGCTCACTCTTGG + Intronic
1121533631 14:94676241-94676263 GAGGTGCAGTGGTGCAATCTCGG + Intergenic
1122573679 14:102726698-102726720 GAGATGCAGTGGAGCTCTCTGGG - Exonic
1123131819 14:105993594-105993616 GAGGTGCTGTGGTTGTTTGGAGG + Intergenic
1124596494 15:31095993-31096015 GAAGTGCAGTGGTGCTATCTCGG - Intronic
1125176339 15:36826428-36826450 GGAGTGCAGTGGTGCTATGTTGG - Intergenic
1126403089 15:48294295-48294317 GAGGTGCAGTGGTGCGATCTCGG - Intronic
1126591386 15:50343587-50343609 GAGGTGCAGTGGTGCCATCTCGG + Intronic
1127183394 15:56450378-56450400 GAGGTGCAGCATTTCTCTTTGGG - Intronic
1127860462 15:62989603-62989625 GGGCTGCTGTGGCTCTCTGTTGG - Intergenic
1128134536 15:65253080-65253102 GAGGTGCAGTGGTGCAATCTCGG - Intronic
1128947986 15:71843537-71843559 GGCGTGCAGTGGTGCTATGTTGG + Intronic
1129138590 15:73576347-73576369 GAGATGCAGTCTCTCTCTGTTGG + Intronic
1129784117 15:78296914-78296936 AAGGAACAGTGGTTCTGTGTTGG - Intronic
1130359361 15:83167505-83167527 GAGGTGCAGTGGTGCAGTCTTGG - Intronic
1132050981 15:98607628-98607650 GAGGTGCAGTGGTGCAATTTTGG + Intergenic
1132225192 15:100134924-100134946 GAGGTGCAGTTGGTCTTTATAGG - Intronic
1132916391 16:2348184-2348206 GAAGTGCAGTGGTGCTATCTCGG + Intergenic
1134660260 16:15978830-15978852 GGGGTGCAGTTGGTGTCTGTTGG + Intronic
1135029200 16:19024368-19024390 GAAGTGCAGTGGTTCAGTCTTGG - Intronic
1136467397 16:30454377-30454399 GAGCTGCAATGCATCTCTGTGGG + Intergenic
1136911902 16:34150686-34150708 GCGGTGCAGTGGCGCTCTCTCGG + Intergenic
1138245308 16:55462888-55462910 GAGATGCTGTGATTCTGTGTGGG - Intronic
1138280872 16:55771361-55771383 GAGGAGGAGGGGGTCTCTGTTGG - Intergenic
1138287656 16:55822501-55822523 GAGGAGAAGGGGGTCTCTGTTGG + Intronic
1140083034 16:71768448-71768470 GAGGTGCAGTGGTGCAATCTTGG - Intronic
1140374309 16:74432469-74432491 GAGATGCAGTCTTGCTCTGTTGG - Intergenic
1140375032 16:74438392-74438414 GGAGTGCAGTGGTTCAATGTTGG - Intergenic
1140815521 16:78617349-78617371 GGGGTGCAGTGGTGCAATGTCGG - Intronic
1141287821 16:82688968-82688990 CAGGTGCCCTGGTTCTCCGTGGG - Intronic
1141891064 16:86926742-86926764 GAGGGGCAGGGGTTATCTGCGGG - Intergenic
1142251040 16:88992227-88992249 GAGGTGCATGGCTTCTCTCTGGG + Intergenic
1142702095 17:1669071-1669093 GAGGTGCAGAGGGTCTCCCTAGG - Intronic
1143122626 17:4618347-4618369 GAGCTGCAGTGGTCCTTGGTGGG + Intergenic
1143814139 17:9498011-9498033 AAGGTTCATTGCTTCTCTGTGGG - Intronic
1144330975 17:14223939-14223961 AAGGTACACTTGTTCTCTGTCGG + Intergenic
1144794876 17:17884276-17884298 GAGGTGCTATGGTGCTCTGAGGG + Intronic
1145406019 17:22594831-22594853 GGAGTGCAGTGGTTCTTTCTTGG - Intergenic
1146045271 17:29500262-29500284 GAGGTGCAGTGGTACGATCTTGG - Intronic
1147059852 17:37866729-37866751 GTAGTGCAGTGGTTCACTCTTGG - Intergenic
1148372259 17:47109196-47109218 GAAGTGCAGTGGCTCTATCTCGG - Intergenic
1148409119 17:47449220-47449242 GTAGTGCAGTGGTTCACTCTTGG - Intergenic
1148454827 17:47805532-47805554 CAGGTGCTGTGGTGCTCTGAGGG + Intergenic
1148472057 17:47900724-47900746 GGGGTGCAGTGGTGCGCTCTCGG - Intronic
1148938727 17:51187796-51187818 GGAGTGCAGTGGTGCACTGTCGG - Intronic
1149758510 17:59208202-59208224 GAAGTGCAGTGGTGCTATCTGGG - Intronic
1151463133 17:74267412-74267434 GAGTTGCTGTGGTTGGCTGTGGG - Intergenic
1152165571 17:78702870-78702892 GAAGTGCAGTGGTGCTATCTCGG + Intronic
1152327418 17:79649678-79649700 GAGGTGGAGTGTTGCTCTGTCGG - Intergenic
1152883980 17:82837442-82837464 GAGGTGCAGTTTTTCTCTAGAGG + Intronic
1153025864 18:671796-671818 GAGATGGAGTCTTTCTCTGTCGG + Intronic
1153244039 18:3056282-3056304 GGGGTGCAGTGGTGCTGTCTCGG + Intergenic
1154204222 18:12323755-12323777 GAGGTGCAGTGGTGCGATCTCGG - Intronic
1154937472 18:21075900-21075922 GGAGTGCAGTGGTGCTATGTCGG - Intronic
1155005268 18:21723564-21723586 GAAGTGCAGTGGTGCTATCTCGG + Intronic
1156001201 18:32386325-32386347 GATGTGCAGTGTTTGTCTCTTGG - Intronic
1156734538 18:40237687-40237709 GAGGAGGAGAGCTTCTCTGTGGG + Intergenic
1157560509 18:48642308-48642330 GTGGTTCAGTTGGTCTCTGTGGG + Intronic
1158086101 18:53653609-53653631 GAAGTGCAGTGGTACTATCTTGG + Intergenic
1158392134 18:57052488-57052510 GAGGCCCAGTAATTCTCTGTGGG + Intergenic
1159861670 18:73656048-73656070 GGAGTGCAGTGGTTCTATCTTGG - Intergenic
1160729707 19:635602-635624 GGGGTGCAGGGGGTGTCTGTAGG - Intergenic
1161875901 19:6909081-6909103 GAAGTGCAGTGGTGCTATCTTGG - Intronic
1162616238 19:11803030-11803052 GGAGTGCAGTGGCTCTCTCTTGG + Intronic
1163012689 19:14435088-14435110 GAGGAGCAGGGGTTCTCCATAGG + Intronic
1163601366 19:18251174-18251196 GGAGTGCAGTGGTTCAATGTGGG + Intronic
1164142772 19:22487914-22487936 GAGGTGCAGTCTTTGTCTATGGG - Intronic
1165679416 19:37761137-37761159 CAGGTGCAGTGGTGCTGTCTTGG - Intronic
1165859330 19:38899081-38899103 GAGGTGCAGTGGTGCAGTGGAGG + Intronic
1166408755 19:42542436-42542458 GGAGTGCAGTGGTTCTATCTCGG + Intronic
1167728609 19:51236105-51236127 GGAGTGCAGTGGTGCTATGTCGG - Intronic
1167895999 19:52581561-52581583 GGAGTGCAGTGGTTCGATGTTGG + Intronic
1167935957 19:52908793-52908815 GTGGTGCAGTGGTGCGATGTTGG - Intergenic
925911731 2:8578225-8578247 GAGTTGCTGTGTTTCTGTGTTGG - Intergenic
926760459 2:16274079-16274101 GAGGTGGAGTCTTGCTCTGTCGG + Intergenic
928259154 2:29751017-29751039 GGGGTGCAGTGGCTCAGTGTCGG - Intronic
928587899 2:32780488-32780510 GAGGTGCAGTGGTGCAATCTCGG + Intronic
929499662 2:42479593-42479615 GAAGTGCAGTGGTGCTATCTTGG - Intronic
931384379 2:61784263-61784285 GGAGTGCAGTGGTTCTATCTGGG - Intergenic
931634924 2:64332530-64332552 GCCGTGCAGAGGTTCCCTGTAGG + Intergenic
932691117 2:73914506-73914528 GAAGTGCAGTGGTGCTATCTTGG - Intronic
933321880 2:80786149-80786171 GACTTGCAGTGCCTCTCTGTGGG + Intergenic
933782890 2:85814089-85814111 GAGCTGCAGTGGTGCCCTATGGG + Intergenic
935069906 2:99684987-99685009 GAGGTGCAGTGGTGCTATCTTGG + Intronic
935764989 2:106358110-106358132 GAGCCGCAGTAGGTCTCTGTGGG - Intergenic
936372681 2:111916164-111916186 GAAGTGCAGTGGCACTCTGATGG + Intronic
936623521 2:114124336-114124358 GAGGTGCAGTGGTGCTATCTCGG + Intergenic
938878703 2:135561665-135561687 GGAGTGCAGTGGTTCTATGGTGG - Intronic
939306730 2:140421202-140421224 GAGGTGCAGTGGTGCAATCTTGG - Intronic
941642081 2:167999510-167999532 GGGGTGCAGTGGTGCTATCTCGG + Intronic
941733550 2:168946813-168946835 CTGGTGCAGTGGTTTTCTATTGG + Intronic
943067096 2:183099944-183099966 GAAGTGCAGTGGTGCTATCTCGG - Exonic
943325878 2:186497563-186497585 GAAGTGCAGTTATTCTTTGTTGG + Intronic
944310061 2:198223428-198223450 GAAGTGCAGTGGTGCTATCTAGG + Intronic
944569784 2:201032472-201032494 GCAGTGCTGTGCTTCTCTGTGGG - Intronic
944588421 2:201193847-201193869 GTGGTGCAGTGGTACTTTTTTGG + Intronic
945140680 2:206683392-206683414 GGAGTGCAGTGGCTCTCTCTTGG + Intronic
945227146 2:207543651-207543673 GAAGTGCAGTGGTGCTATCTTGG + Intronic
946368090 2:219262988-219263010 GGGGTGCAGTGGTGCTATCTCGG - Intronic
947140396 2:227014917-227014939 GAGATGGAGTCTTTCTCTGTTGG + Intronic
947711960 2:232321538-232321560 GAGGCCCAGTGCGTCTCTGTGGG + Intronic
948497462 2:238361302-238361324 CAGGTGCAGTGGTTCACTTTGGG - Intronic
949010172 2:241673706-241673728 GAGCTGCAGTGGTAATGTGTGGG + Exonic
1169109357 20:3022067-3022089 GAGGCGCTGTGGCTTTCTGTTGG - Exonic
1170232609 20:14067172-14067194 GGGGTGCAGTGGTGCTATCTTGG + Intronic
1170984878 20:21248231-21248253 GGAGTGCAGTGGTGCTCTCTTGG - Intergenic
1171769323 20:29310362-29310384 GCGGTGCAGTGGTGCTCTCTCGG - Intergenic
1171868128 20:30505415-30505437 GCGGTGCAGTGGCGCTCTCTCGG - Intergenic
1171907224 20:30909026-30909048 GCGGTGCAGTGGCGCTCTCTAGG + Intergenic
1172455571 20:35069888-35069910 GGAGTGCAGTGGCTCTATGTTGG - Intronic
1172543215 20:35738103-35738125 GGGGTGCAGTGGTTCTATCACGG - Intronic
1172544893 20:35752604-35752626 GGAGTGCAGTGGTGCTATGTCGG - Intergenic
1173825092 20:46043146-46043168 GAGCTCCAGAGGTTCTCTGTGGG - Exonic
1174027667 20:47592091-47592113 GGAGTGCAGTGGTGCTCTTTTGG + Intronic
1174243681 20:49159329-49159351 GAGGAGAAGTTGTTCTCTCTTGG - Intronic
1174628473 20:51935604-51935626 GGGGTGCAGTGGTGCTATCTCGG + Intergenic
1177801909 21:25836084-25836106 GAAGTGCAGTGGTACTATCTCGG - Intergenic
1178602391 21:34005747-34005769 GGGGTGCAGTGGTTCGATCTTGG - Intergenic
1178732580 21:35118054-35118076 GAGATGGAGTCGTGCTCTGTTGG - Intronic
1180154030 21:45969112-45969134 GGGGTGCAGTGGTGCTATCTCGG - Intergenic
1180340630 22:11614963-11614985 GTGGTGCAGTGGCGCTCTCTCGG + Intergenic
1180795370 22:18601533-18601555 GTGGTGCAGTGGTTCGATCTTGG - Intergenic
1181014454 22:20061194-20061216 GAGGTGAAGAGGTTCCCTCTTGG + Intronic
1181226370 22:21393779-21393801 GTGGTGCAGTGGTTCGATCTTGG + Intergenic
1181252280 22:21541059-21541081 GTGGTGCAGTGGTTCGATCTTGG - Intergenic
1182313196 22:29424127-29424149 GAAGTGCAGTGGTGCTATCTTGG - Intergenic
1182492356 22:30681751-30681773 GAAGTGCAGTGGTTCAATCTTGG - Intergenic
1182815377 22:33157545-33157567 AATGAGCAGTGGTTCTCTGTTGG - Intergenic
1183875905 22:40781294-40781316 GGAGTGCAGTGGTTCTATCTCGG + Intronic
1184129014 22:42506189-42506211 GCAGTGCAGTGGTGCTCTCTCGG - Intergenic
949550787 3:5111216-5111238 GGAGTGCAGTGGTGCACTGTTGG + Intergenic
949684298 3:6550107-6550129 GAGGTGAAGTGCTTCTTTATAGG - Intergenic
950110632 3:10416630-10416652 GAGGGACAGTGGTTCTCTTGGGG + Intronic
950481013 3:13243758-13243780 CATGTGCAGTTGTTCTCTGGGGG + Intergenic
950646418 3:14379800-14379822 CAGGTGCAGTGGTTCATTGGAGG + Intergenic
950668185 3:14509800-14509822 GAGGTGAACTGGGGCTCTGTGGG - Exonic
952537487 3:34326896-34326918 GACTTGCAGTGTTTCCCTGTAGG + Intergenic
952950793 3:38523382-38523404 GAGGTGGAGTCTTGCTCTGTCGG + Intronic
953486692 3:43305531-43305553 GGAGTGCAGTGGTGCCCTGTCGG + Intronic
955475447 3:59331444-59331466 GATGGGCTGTGGTTCTCTCTGGG - Intergenic
955973830 3:64462147-64462169 GAAGTGCAGTGGTGCTATCTCGG - Intergenic
956022459 3:64947161-64947183 GAGATGGAGTCTTTCTCTGTTGG - Intergenic
957638546 3:82818444-82818466 AATGTGCAGTGCTTATCTGTGGG + Intergenic
957851279 3:85810588-85810610 GGAGTGCAGTGGTGCTGTGTTGG + Intronic
960658549 3:120032973-120032995 GAGGTACAGTGTTTCTTTTTGGG - Intronic
961246230 3:125456250-125456272 GAGATGCACTGGTTCTAAGTGGG + Intronic
961505717 3:127369503-127369525 GAGGTGCAGTGGGCCTCGGCTGG - Intergenic
964276916 3:155018604-155018626 GAGGTTGAGTGGGTCTCTGCAGG - Intergenic
964369518 3:155985293-155985315 GGGGTGCAGTGGTACTATCTTGG + Intergenic
964589498 3:158344236-158344258 GAGATGCAGTCTTGCTCTGTCGG - Intronic
964957188 3:162374539-162374561 GGAGTGCAGTGGTGCTATGTTGG - Intergenic
965488486 3:169307781-169307803 TAGGAGCAGTGGTTCCCTATAGG - Intronic
965764806 3:172119117-172119139 GGAGTGCAGTGGTTCAATGTCGG - Intronic
966697814 3:182810279-182810301 GAGGTGCAGTGGTGCCATCTCGG - Intronic
966751597 3:183327272-183327294 GGAGTGCAGTGGTGCTCTCTCGG - Intronic
967226717 3:187298943-187298965 GGGGTGCAGTGGTTCAATCTTGG - Intergenic
968734420 4:2288047-2288069 GAGGTGCAGTGGGCCTCGGAAGG + Intronic
968771723 4:2511791-2511813 GAGGTGCACAGATCCTCTGTGGG + Intronic
968868726 4:3230182-3230204 GAGCTGCAGTGCTTCTCAGATGG + Intronic
969406773 4:6998587-6998609 GAAGTGCAGTGGTGCTATCTCGG + Intronic
970393568 4:15641975-15641997 GAGGTGCAGTGGTGCAATCTCGG - Intronic
970838045 4:20434433-20434455 GAGGTGCAGTGGTGCGATCTTGG - Intronic
970907458 4:21232937-21232959 GAGGTGGAGAGGTTCACTGAGGG + Intronic
971011326 4:22438948-22438970 GGAGTGCAGTGGTGCTCTCTTGG - Intronic
971152925 4:24052912-24052934 GAAGTGCAGTGGTGCTATCTTGG + Intergenic
971601096 4:28593335-28593357 GAAGTGCAGTGGCTCTATCTCGG + Intergenic
972576776 4:40359167-40359189 GGAGTGCAGTGGCTCTCTCTCGG + Intergenic
973252569 4:48075597-48075619 GGAGTGCAGTGGTGCTCTCTCGG - Intronic
973903952 4:55507556-55507578 GGAGTGCAGTGGTGCTCTCTTGG - Intronic
974037602 4:56830476-56830498 GGAGTGCAGTGGTGCTATGTCGG - Intergenic
974556318 4:63453469-63453491 GGAGTGCAGTGGTGCTCTCTTGG + Intergenic
976567392 4:86566662-86566684 GGAGTGCAGTGGTACTGTGTCGG - Intronic
976714636 4:88110490-88110512 GGAGTGCAGTGGTGCTGTGTCGG - Intronic
978072797 4:104492252-104492274 GAGGAGCTGTGGTTTGCTGTGGG - Intronic
978232941 4:106423002-106423024 GAGGTGCAGTGGTTTTCAACTGG - Intergenic
978521550 4:109620947-109620969 GGAGTGCAGTGGCTCTCTCTTGG + Intronic
979604435 4:122622946-122622968 CAGGAGCAATGGTTCTCTCTAGG - Intergenic
980967051 4:139532041-139532063 GAGGTGCAGTGGTGCCATGTCGG - Intronic
981187082 4:141816268-141816290 GAGGTGGTGTGCTTCTCTGGGGG - Intergenic
981272945 4:142865878-142865900 GAGGTGCAGTGGTGCGATCTTGG - Intergenic
981989551 4:150901246-150901268 GGAGTGCAGTGGTGCTCTCTCGG - Intronic
982848183 4:160277011-160277033 TAGGTGCAGGGGTTCTCTGCAGG + Intergenic
982878983 4:160686522-160686544 GAGGTCAAGGTGTTCTCTGTTGG - Intergenic
983346669 4:166535653-166535675 GAAGTGCAGTGGCTCTATCTTGG - Intergenic
984267503 4:177512240-177512262 GGAGTGCAGTGGTTCTATCTTGG + Intergenic
984420396 4:179513943-179513965 GTGGTGCAGTGGATCTCTGGAGG - Intergenic
985069099 4:186150770-186150792 GAGGTGCAGTGGTGCCATGTCGG + Intronic
986001313 5:3633185-3633207 GAGGTGCAGTGGTGCGATCTCGG + Intergenic
986597192 5:9436305-9436327 CAGGTGCTGTGGTTCTCCATGGG + Intronic
986765324 5:10920790-10920812 AAGGTGCAGTGGTTAAATGTGGG + Intergenic
988106598 5:26757918-26757940 CAGGTGCAGTGGTGCTATCTTGG - Intergenic
988558725 5:32261180-32261202 GAAGTGCAGTGGTGCTATCTCGG - Intronic
989387583 5:40868673-40868695 GGAGTGCAGTGGTGCTATGTCGG + Intergenic
990865831 5:60378800-60378822 GGAGTGCAGTGGTGCTCTCTAGG - Intronic
991052741 5:62290445-62290467 GAGGTGCAGTGGTGCAATCTTGG - Intergenic
992713671 5:79487226-79487248 GGGGTGCAGTGGTGCTGTCTCGG - Intronic
992889277 5:81189092-81189114 GAGGTGCAGTGGTTGTCAGCAGG - Intronic
996310049 5:122094337-122094359 GGGGTGCAGTGGTGCAATGTTGG + Intergenic
997122550 5:131190081-131190103 GAGGTGCAGTGGTGCGATCTCGG - Intronic
997480604 5:134181529-134181551 GAGGTGCAGTGGTTCTATCTCGG - Intronic
997482077 5:134193373-134193395 GAAGTGCAGTGGCTCTATCTTGG + Intronic
998175555 5:139899770-139899792 GAGAGGCAGAGGATCTCTGTTGG - Intronic
998903549 5:146879560-146879582 GGGTAGCAGTGGCTCTCTGTGGG - Intronic
999754793 5:154656387-154656409 GAGGTGCAGTGGTGCAATCTCGG + Intergenic
1000143436 5:158429297-158429319 GGGGTGCAGTGGTGCTATCTTGG - Intergenic
1000879136 5:166677151-166677173 GAGGTGCAGTGGTGCAATCTTGG + Intergenic
1001763666 5:174227706-174227728 GAGGTGCATTGCTTCCCTGAAGG - Intronic
1002274973 5:178098260-178098282 GAAGTGCAGTGGTGCTATCTTGG - Intergenic
1002275273 5:178100438-178100460 GAGGTGCAGTGGTGCAATCTTGG + Intergenic
1002547725 5:179962183-179962205 GAGGTGCAGTGCTCCTCTGAAGG + Intronic
1002618920 5:180472706-180472728 ATAGTGCAGTGGTTCTCAGTTGG + Intergenic
1002821261 6:727136-727158 GGAGTGCAGTGGTTCCCTCTAGG + Intergenic
1002966159 6:1968675-1968697 GAGATGCAGTGGGTCAGTGTTGG - Intronic
1003030547 6:2597023-2597045 CTGGTGCAGTGGTTCTCAGCCGG - Intergenic
1004137279 6:12979477-12979499 CAGTTGCAGTGGGTCTCTGGTGG + Intronic
1004719875 6:18259342-18259364 GAGGTGCAGTGGTGCGATCTCGG - Intronic
1005022556 6:21432072-21432094 GAAGTGCAGTGGTGCTATCTCGG - Intergenic
1005442503 6:25885476-25885498 CAGATGGAGTAGTTCTCTGTAGG - Intergenic
1005961819 6:30699139-30699161 GAAGTGCAGTGGCTCGATGTCGG - Intergenic
1006028988 6:31165461-31165483 TTGGTGCAGTGGTTCTCAGTGGG - Intronic
1006768474 6:36530413-36530435 GAAGTGCAGTGGTACTATCTCGG + Intronic
1006780673 6:36630312-36630334 GAAGTGCAGTGGATCTATCTCGG - Intergenic
1007175479 6:39893465-39893487 GGAGTGCAGTGGTTCCATGTCGG - Intronic
1010056540 6:71571786-71571808 GGGGTGCAGTGGTACACTCTTGG + Intergenic
1010438612 6:75865412-75865434 GGAGTGCAGTGGTTCTTTCTTGG + Intronic
1010479892 6:76338267-76338289 GAGGTTCTCTGGTTCTCTATGGG + Intergenic
1011658228 6:89571100-89571122 GGGGTGCAGTGGTGCTATCTTGG + Intronic
1011832266 6:91387896-91387918 TAGGTGCACTGGTTTTGTGTCGG - Intergenic
1012575975 6:100798755-100798777 GAGTGGCATTGGTTCGCTGTAGG + Exonic
1014685998 6:124501171-124501193 GAGGTGCAGTGGTTCTCTGTGGG - Intronic
1015159907 6:130141769-130141791 GGAGTGCAGTGGTGCACTGTCGG + Intergenic
1015815957 6:137211015-137211037 TTATTGCAGTGGTTCTCTGTGGG + Intronic
1015901367 6:138071424-138071446 ATGGTGCTGTGGTTCTCTCTGGG - Intergenic
1015902008 6:138076868-138076890 GGGGTGCTGTGGTTTGCTGTGGG - Intergenic
1016089098 6:139953770-139953792 GGGGTGCAGTGGTGCTATCTGGG + Intergenic
1017043153 6:150323961-150323983 GAAGTGCAGTGGTGCTATCTGGG - Intergenic
1019397280 7:828320-828342 GGAGTGCAGTGGTGCTGTGTTGG + Intronic
1020041546 7:5006883-5006905 GGGGTGCAGTGGTTCGATCTTGG + Intronic
1020190773 7:5995837-5995859 GTGGTGCATTGGTTGACTGTAGG - Intronic
1020784911 7:12561527-12561549 GAGGTGCAGTGGCACTATCTCGG - Intergenic
1020803011 7:12755367-12755389 GGAGTGCAGTGGTTCTATCTCGG - Intergenic
1021087740 7:16443225-16443247 GAAGTGCAGTGGTGCTATCTTGG - Intergenic
1021102997 7:16605546-16605568 GAGGTGCAGTGGCTCGATCTTGG + Intronic
1022273158 7:28830073-28830095 GAAGTGCAGTGGTGCTATCTTGG + Intergenic
1022892126 7:34712127-34712149 GATCTGCAGTGGTTCACAGTGGG - Intronic
1023535758 7:41207554-41207576 AAGGTGTAGTGGTTATTTGTTGG + Intergenic
1023970550 7:44987509-44987531 GGAGTGCAGTGGTGCTATGTCGG - Intergenic
1026982160 7:74533183-74533205 GGAGTGCAGTGGTGCTATGTCGG + Intronic
1027426476 7:78066409-78066431 GGAGTGCAGTGGTGCTATGTCGG - Intronic
1029681900 7:102117345-102117367 GGGGTGCAGTGGTGCTATCTCGG - Intronic
1031261234 7:119523977-119523999 GGGGTGCAGTGGTGCTATCTCGG + Intergenic
1031586395 7:123535637-123535659 GAAGTGCAGTGGTTCGATCTCGG + Intergenic
1031687040 7:124743572-124743594 AAGGTGAAGTGGTACTCTGAGGG - Intergenic
1032143400 7:129355505-129355527 TAGGAGCAGTGGTTCACTGTTGG + Intronic
1033640701 7:143261100-143261122 GAAGTGCAGTGGTTCAATTTTGG - Intronic
1034888724 7:154820179-154820201 GTGCTGCAGTGGTGCCCTGTTGG - Intronic
1036181849 8:6592703-6592725 GAAGTGCAGTGGCGCTCTGTGGG + Intronic
1036384130 8:8263111-8263133 ATGGGGCAGCGGTTCTCTGTTGG - Intergenic
1037877547 8:22555294-22555316 GAGGTGATGTGGGTATCTGTTGG + Intronic
1038045646 8:23763764-23763786 GGGGTACAGTGGTGCTCTCTTGG + Intergenic
1039054157 8:33521381-33521403 GGGGTGCAGTGGTTCAATCTTGG + Intergenic
1039105548 8:33985453-33985475 GATGTGCAGTGGTGCTATCTTGG + Intergenic
1039171270 8:34748771-34748793 GAAGTGCAGTGGTGCTATCTTGG + Intergenic
1039240918 8:35555802-35555824 GAGGTGGAGTCTTGCTCTGTTGG - Intronic
1039723851 8:40193902-40193924 GAGGTTCTGTGGTTCTAGGTAGG - Intergenic
1039870600 8:41542033-41542055 GAGGTGCAATGGTTTTGTATCGG - Exonic
1039981993 8:42415750-42415772 GAGATGGAGTCTTTCTCTGTCGG + Intergenic
1041245981 8:55889066-55889088 GAAGTGCAGTGGTGCTATCTCGG + Intronic
1041484484 8:58359317-58359339 CAGGTTCACTGGTTCTCTGGGGG - Intergenic
1041914102 8:63122088-63122110 GAAGTGCAGTGGTGCTATCTCGG - Intergenic
1042026879 8:64433376-64433398 ATGTTGCAGTGGTTCTCTCTGGG - Intergenic
1042335328 8:67623944-67623966 GAGGTGCAGTGGTGCGATCTCGG - Intronic
1042554330 8:70021546-70021568 GAGGTTCAGTGGCTCTCTTGAGG - Intergenic
1043183662 8:77117846-77117868 AAGTTTCCGTGGTTCTCTGTGGG - Intergenic
1043434467 8:80224697-80224719 GGAGTGCAGTGGTGCTATGTTGG - Intronic
1044623203 8:94210998-94211020 GAGATGCAGTCTTGCTCTGTCGG - Intronic
1044662949 8:94609310-94609332 GAAGTGCAGTGGTTCAATCTTGG - Intergenic
1045102696 8:98861396-98861418 GGGGTGCAGTGGTGCTATCTCGG + Intronic
1048361336 8:133699696-133699718 AAGCTGCAGGTGTTCTCTGTGGG - Intergenic
1048817121 8:138344317-138344339 GATGGGCTGTGATTCTCTGTTGG - Intronic
1050671030 9:7997149-7997171 AAGGTGCAGAGGTTCCCTTTTGG - Intergenic
1050763143 9:9098305-9098327 GAAGTGCAGTGGTGTGCTGTTGG + Intronic
1051202926 9:14649172-14649194 TGGGTACAGTGGTTCTCAGTTGG - Intronic
1051559963 9:18429838-18429860 GGAGTGCAGTGGTGCTATGTCGG + Intergenic
1051706253 9:19883614-19883636 GAAGTGCAGTGGTGCTATCTCGG + Intergenic
1052398188 9:27966857-27966879 GAGGGGTAGTTGTTCTCCGTAGG - Intronic
1054867000 9:70013155-70013177 GGAGTGCAGTGGTGCTATGTTGG + Intergenic
1055055211 9:72017449-72017471 GGTGTGCAGTGGTGCTATGTCGG + Intergenic
1056789979 9:89618930-89618952 AAGGGGCAGTGGGTCTCTCTGGG - Intergenic
1057413124 9:94835992-94836014 GAGGTGCAGTGGTACAGGGTAGG + Intronic
1058974487 9:110113503-110113525 CAGGTGCAGTGGCTCACTTTGGG - Intronic
1062448639 9:136606342-136606364 GGGGTGCAGCCGTGCTCTGTGGG + Intergenic
1062559173 9:137131983-137132005 TAGGTGCAGTGGTGCTATCTTGG + Intergenic
1187919499 X:24187154-24187176 GATGTGCAGTGGCTATCTGCAGG + Intronic
1187998889 X:24959411-24959433 GGGGTGCAGTGGTGCGCTCTTGG - Intronic
1188401935 X:29756461-29756483 GGGGTGCAGTGGTACTATCTTGG + Intronic
1188759511 X:34009143-34009165 GAAGTGCAGTGGTGCTATCTCGG - Intergenic
1189297051 X:39926290-39926312 GAGGAGCGGGGGTTTTCTGTGGG + Intergenic
1189794198 X:44631908-44631930 GAGGTGCAGTGGTACGATCTCGG - Intergenic
1190243345 X:48674960-48674982 GAGGTGCATTGTTTTTCTTTGGG - Intergenic
1190271351 X:48866196-48866218 GAAGTGCAGTGGTGCTATCTCGG - Intergenic
1190299260 X:49046989-49047011 GAGGTGCAGTGGCACTATCTCGG + Intergenic
1191971325 X:66819926-66819948 GGAGTGCAGTGGTTCTATCTTGG + Intergenic
1192866527 X:75138955-75138977 GACGTGCAGTGGCTCTATCTCGG - Intronic
1193238926 X:79143344-79143366 GAGGTGCAGTGGTCCGATCTTGG - Intergenic
1193747240 X:85297656-85297678 CATTTGCAGTGGTACTCTGTGGG + Intronic
1195371699 X:104182037-104182059 GAGGTGCAGTGGTGCGATCTTGG + Intronic
1195516399 X:105781055-105781077 GAGGTCCAGTTGTTATTTGTAGG - Intergenic
1195529408 X:105935303-105935325 GATCTGCTGTGGTTCTTTGTGGG + Exonic
1197755316 X:129989834-129989856 GAAGTGCAGTGGTGCTATCTTGG + Intronic
1198413574 X:136396444-136396466 GGAGTGCAGTGGTTCTATCTTGG + Intronic
1200885458 Y:8263505-8263527 GGGGTGCAGTGGTTCCATGCTGG - Intergenic
1201075272 Y:10182030-10182052 GTGGTGCAGTGGCACTCTCTCGG + Intergenic
1201282105 Y:12351174-12351196 GAAGTGCAGTGGTGCAATGTTGG - Intergenic
1201322471 Y:12715367-12715389 GTGGTGCAGTGGTGCGATGTCGG + Intronic
1201345952 Y:12984916-12984938 GAGCTGCAGTGTTTCTCTCATGG - Intergenic
1202118742 Y:21502885-21502907 GGGGTGCAGTGGCTCTGTCTTGG + Intergenic
1202121194 Y:21526425-21526447 GGGGTGCAGTGGCTCTGTCTTGG + Intronic
1202123646 Y:21549965-21549987 GGGGTGCAGTGGCTCTGTCTTGG + Intergenic
1202155362 Y:21879415-21879437 GGGGTGCAGTGGCTCTGTCTTGG - Intergenic
1202157809 Y:21902957-21902979 GGGGTGCAGTGGCTCTGTCTTGG - Intronic
1202184257 Y:22167882-22167904 GGGGTGCAGTGGCTCTGTCTTGG - Intergenic
1202207102 Y:22418519-22418541 GGGGTGCAGTGGCTCTGTCTTGG + Intergenic
1202590148 Y:26473992-26474014 GGAGTGCAGTGGTACTGTGTTGG - Intergenic