ID: 1014687999

View in Genome Browser
Species Human (GRCh38)
Location 6:124527797-124527819
Sequence GACCCAAATTTGGGTCATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 1, 2: 0, 3: 2, 4: 57}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014687993_1014687999 28 Left 1014687993 6:124527746-124527768 CCTGGTCTGAGTCAGTGGAAATT 0: 1
1: 0
2: 2
3: 11
4: 131
Right 1014687999 6:124527797-124527819 GACCCAAATTTGGGTCATACAGG 0: 1
1: 1
2: 0
3: 2
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014687999 Original CRISPR GACCCAAATTTGGGTCATAC AGG Intronic
900873823 1:5326906-5326928 GACCCAAATTTGGGTAACTTTGG + Intergenic
910342372 1:86202678-86202700 GATCCAGATTTGGGTTCTACTGG - Intergenic
922182781 1:223248429-223248451 TACCCAAATTTAGATCAGACTGG - Intronic
1063824795 10:9883504-9883526 GAGCCATATTCAGGTCATACAGG + Intergenic
1069577171 10:69539031-69539053 GTCCTAAATTTGGCTCATAGAGG + Intergenic
1073695971 10:105868387-105868409 TCCCCAAATTTGGAACATACTGG - Intergenic
1083629202 11:64087130-64087152 GACCCAAATGTGGGCCACAGAGG + Intronic
1084856955 11:71995605-71995627 GACCCAAATGCAGGTCACACTGG - Intronic
1087944087 11:104137079-104137101 GACCCAAGCTTGGGAAATACTGG - Intronic
1091261913 11:134241414-134241436 GAGCCAATTCTGGGTCACACTGG - Intronic
1102657972 12:114499279-114499301 GTCCCAAATTTGGGACAGGCTGG + Intergenic
1107503463 13:41005637-41005659 GAGCCAAGTTTGGGATATACAGG - Intronic
1110233159 13:73187774-73187796 TACCCAGATTTGTGTCAAACAGG + Intergenic
1117184368 14:53225598-53225620 GACTCAAATTTGGCTCAGATAGG + Intergenic
1119066370 14:71531474-71531496 GACCCAATATTGGGTCACAAGGG - Intronic
1120573474 14:86151196-86151218 GACCCAGATTTGGGTCATGTTGG + Intergenic
1128893570 15:71352646-71352668 GATACAAATTTTGGACATACAGG + Intronic
1133816264 16:9199624-9199646 GACTCAAGTTTGGGTAACACTGG - Intergenic
1139253459 16:65519003-65519025 GACCAACACTTGGGTCATGCTGG + Intergenic
1143710819 17:8733886-8733908 GACCCTATTGTGGGTCATAGGGG + Intronic
1145246684 17:21274152-21274174 GACCTCAATTTGGGTAATCCTGG + Intergenic
1148808159 17:50274497-50274519 GACCCAAGCTTGGGACATCCTGG - Exonic
1151512543 17:74570195-74570217 GACCCACATCTGGGACATCCAGG + Intergenic
1153342668 18:3991532-3991554 CACTCAAATCTGGGTCATCCAGG - Intronic
926690932 2:15732870-15732892 GATGCATATTTGGGTCATAGTGG - Intronic
926776122 2:16424941-16424963 CATCCAAATTTAGGTAATACAGG - Intergenic
932454139 2:71835435-71835457 GCCCCAAATTTTGCTGATACAGG - Intergenic
939248982 2:139662187-139662209 GTCCCACATCTGGGTCAAACTGG + Intergenic
942552790 2:177137203-177137225 TTCCCAAATTTGGGGCATTCTGG - Intergenic
1176237870 20:64062743-64062765 GAGCCCAGTTTGGGTCATTCGGG - Intronic
1183888257 22:40903154-40903176 GGCCCAAATCAGTGTCATACAGG + Intronic
963118505 3:141754944-141754966 TATCCAAATTTGTGTCATAAAGG - Intergenic
964379453 3:156083220-156083242 GATACAGATTTGGGTGATACTGG - Intronic
966305590 3:178530375-178530397 GACCCAAATCGTGGTCGTACTGG + Intronic
971076667 4:23157370-23157392 GTCTCACATTTGGCTCATACTGG - Intergenic
975966527 4:79979197-79979219 GAGCTAAATTTGAGTCAAACTGG + Intronic
977728026 4:100320503-100320525 GACCCAGATTTGGGCAATCCTGG + Intergenic
977728386 4:100323609-100323631 GACCCAAACTAGGGTCATTATGG - Intergenic
984950177 4:185002332-185002354 GTCCCAAATTTGGGACATCCAGG + Intergenic
985522450 5:382934-382956 TACCAAAATTTGTGTAATACAGG - Intronic
990313746 5:54565083-54565105 GACCCAAATTGGGTCCTTACAGG - Intergenic
990877628 5:60504004-60504026 GAACCAAATTTGAGTCAGCCAGG + Intronic
992114084 5:73522838-73522860 GACCCAAATTTGGACTATTCAGG + Intergenic
1001310971 5:170610557-170610579 GATTCAAATTTGGGTCAGCCTGG - Intronic
1009932625 6:70194260-70194282 GCCCAAAGTTTGGGTCATCCTGG - Intronic
1011453770 6:87525071-87525093 ATTCCAAATTTTGGTCATACAGG - Intronic
1014687998 6:124527790-124527812 GACCCAAATTTGGGTCACACAGG - Intronic
1014687999 6:124527797-124527819 GACCCAAATTTGGGTCATACAGG + Intronic
1016738582 6:147506935-147506957 GCCCCAAACTTGGGTCACCCGGG - Intergenic
1021359191 7:19690622-19690644 GACCCATTTCTGGGACATACAGG - Intergenic
1022872214 7:34491562-34491584 GGTCCAAATTTGAGTCATTCTGG + Intergenic
1023836830 7:44073509-44073531 GACCCAGATTCGGGTCCTATGGG + Intronic
1028432111 7:90759555-90759577 GACCCAAAGTTGAGACATAGTGG + Intronic
1045325390 8:101114015-101114037 GACCCACTTCAGGGTCATACAGG - Intergenic
1045680846 8:104658294-104658316 GACCCAGCTTTGGGTCTTCCTGG - Intronic
1052042664 9:23757079-23757101 GAGCCAAATTTGGGTACCACCGG + Intronic
1054964814 9:71011735-71011757 TACCCATATAGGGGTCATACAGG + Intronic
1057186828 9:93061807-93061829 GACCCAGATTGAGGTCACACAGG + Intronic
1059249699 9:112877562-112877584 GCCCCAAATCTGAGTCATTCTGG + Intronic
1060482018 9:124022103-124022125 GCCACAACTTTGGGTCATGCAGG - Intronic
1196364317 X:114906669-114906691 GACCCAAATTTCGTTCTTATTGG + Exonic