ID: 1014692189

View in Genome Browser
Species Human (GRCh38)
Location 6:124575540-124575562
Sequence CACTTCATGCAGAAGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 213}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014692189_1014692192 22 Left 1014692189 6:124575540-124575562 CCACCCTGCTTCTGCATGAAGTG 0: 1
1: 0
2: 2
3: 17
4: 213
Right 1014692192 6:124575585-124575607 CTCTGCTAACCCTTATAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014692189 Original CRISPR CACTTCATGCAGAAGCAGGG TGG (reversed) Intronic
900774198 1:4569738-4569760 CTCTTCTGGCAGATGCAGGGAGG - Intergenic
901129941 1:6955911-6955933 CCCTTCAGGCAGCAGCAGGGAGG + Intronic
901168429 1:7236386-7236408 CACTTCATACAGAGCAAGGGCGG - Intronic
901425669 1:9181254-9181276 CACCTGACGCAGAAACAGGGAGG + Intergenic
903514787 1:23903003-23903025 CTCTGCAAGCAAAAGCAGGGAGG + Intronic
904137088 1:28321534-28321556 GACTTCATGGAGAAGCAGAAGGG - Intergenic
904340607 1:29831750-29831772 CCATCCATGCTGAAGCAGGGGGG + Intergenic
905275030 1:36812041-36812063 GCCTTCAAGCAGAAGCAGGTAGG - Intronic
907162817 1:52383827-52383849 CACCTCATCCACAAGCAGGACGG + Exonic
908849812 1:68364351-68364373 CACTGCATGCAGGGGAAGGGTGG + Intergenic
910604768 1:89071732-89071754 CAGCCCATGGAGAAGCAGGGTGG + Intergenic
914781640 1:150790963-150790985 AACTTAATGCAGAGGCAAGGAGG + Intergenic
918245707 1:182657356-182657378 CAGTTCATGGACAAGCAGGAGGG - Intronic
920811576 1:209290906-209290928 CACATCAAGCAGCAGCAGGCAGG + Intergenic
924588435 1:245380486-245380508 CACGTCATGAACAAGCAGGTGGG - Intronic
1063825227 10:9889714-9889736 TCCTTCATGCATTAGCAGGGTGG + Intergenic
1063953531 10:11245876-11245898 CATTTTATGGAGAAGCAGTGTGG + Intronic
1067732012 10:48819308-48819330 CTCTTCATGCAGAAGGCTGGTGG + Intronic
1068350059 10:55831426-55831448 GAGGTCATGCAGAAGCAGGGTGG - Intergenic
1069565531 10:69461082-69461104 CCGTTCATGCAGATGCTGGGAGG + Intronic
1069571603 10:69497730-69497752 TACTTCCTACAGGAGCAGGGAGG + Intronic
1069901798 10:71710707-71710729 CAGTACATGAAGAAGCAGGGAGG + Intronic
1071150046 10:82623299-82623321 GACTTGATGGAGAAGCAGGCTGG - Intronic
1071304968 10:84291494-84291516 CACTTCATTCAGTCACAGGGTGG - Intergenic
1072688072 10:97550498-97550520 CAGCTCCTGCAGCAGCAGGGAGG - Intronic
1072748405 10:97958343-97958365 CATTTAATGGAGAAGCAGTGGGG + Intronic
1074047995 10:109856855-109856877 CACTTCATGAAGAAGCTATGTGG + Intergenic
1074289902 10:112130638-112130660 GGCTTCATGCAGCAGCTGGGTGG + Intergenic
1074851508 10:117443008-117443030 CACTTCCTCCAGCAGCTGGGGGG - Intergenic
1075237561 10:120744771-120744793 CATTTCAGGCAGAAGGATGGAGG + Intergenic
1076755256 10:132567225-132567247 CACATTCTGCAGAAGCAGGAAGG + Intronic
1077435962 11:2539299-2539321 CTCTTCAGGCAGCAGCAGGTAGG - Intronic
1078351671 11:10600196-10600218 CCCTTCAAGCAGAATCAGGTGGG + Intronic
1078422243 11:11222178-11222200 CACTTCATGCTGCAGGAGGGAGG - Intergenic
1080766270 11:35300187-35300209 CCCTTGATGCATAAGCAGGTAGG - Intronic
1081489722 11:43558037-43558059 CGCTTTGTGCAGCAGCAGGGAGG - Intronic
1083961873 11:66019075-66019097 CACTTCTTCCAGAAGTGGGGTGG - Intronic
1084314500 11:68337204-68337226 CACATCATGCCGATGCGGGGTGG + Intronic
1089092249 11:115887847-115887869 GAGTTCAGGCAGAAACAGGGAGG - Intergenic
1089639139 11:119835716-119835738 TTCTTCAAGCAGAAGCAGGAGGG - Intergenic
1091316749 11:134619260-134619282 CCTTTCCTGCAGAAGCAGCGTGG + Intergenic
1092028484 12:5263220-5263242 CACTGCAAGCAGAAGCAGGCAGG + Intergenic
1092951845 12:13510935-13510957 CAATTAATGCAGAAGAAAGGGGG + Intergenic
1098189104 12:67929004-67929026 TACTTCATGCAGAATCCTGGGGG - Intergenic
1098808956 12:75059439-75059461 CATTGAATGCAGAAGCAGGTAGG + Intronic
1101957085 12:109221507-109221529 CCCTTCTTTCAGAAGCAGAGAGG + Intronic
1103764346 12:123270742-123270764 CCCTCGATGCAGAAGCCGGGAGG - Intronic
1104690988 12:130826296-130826318 CACTTCCTGAAGAACCAAGGAGG + Intronic
1104953066 12:132451105-132451127 CCCTCCCTGCAGAAGCCGGGCGG - Intergenic
1108035963 13:46290959-46290981 GATTTCATGCAGAGGCAGGGAGG + Intergenic
1108228970 13:48318282-48318304 CACTTCCTGGAGCAGCTGGGCGG - Intronic
1108443837 13:50486052-50486074 CTCTTCTTTTAGAAGCAGGGAGG - Intronic
1109075051 13:57823817-57823839 CACTGCACGCAGAAGATGGGAGG - Intergenic
1109466792 13:62745129-62745151 GATTTCATGTGGAAGCAGGGTGG - Intergenic
1110693055 13:78454708-78454730 CATTTCATGCAGAAGGAAGTTGG + Intergenic
1112693164 13:101917701-101917723 CCCTTCCTGCAGCAGAAGGGAGG - Intronic
1116009346 14:39332715-39332737 GACTGCAAGCAGAAGCAGGGTGG - Intronic
1116793885 14:49368361-49368383 CATTTCACGTAGAAGCATGGTGG - Intergenic
1118574936 14:67232850-67232872 CACTTCAAGCAAATGCAGGAAGG - Intergenic
1119480014 14:74953263-74953285 CACGTCTTGGAGAGGCAGGGAGG + Intronic
1121419185 14:93800423-93800445 AACTTCAAGCAGGAGTAGGGAGG + Intergenic
1121621179 14:95349402-95349424 GACTCCGAGCAGAAGCAGGGGGG + Intergenic
1121958003 14:98231533-98231555 CAGTTCATGCTGCGGCAGGGTGG - Intergenic
1123933761 15:25184268-25184290 CACTGGATGCCTAAGCAGGGAGG + Intergenic
1124088074 15:26570592-26570614 TACTTAATGCAGAAACATGGTGG - Intronic
1124711446 15:32016075-32016097 CACATTATGCAGAGGCAGGGAGG - Intergenic
1127694015 15:61426376-61426398 CACTTCATTCCAAAGCTGGGTGG + Intergenic
1128152987 15:65375186-65375208 CACTTCAGGCTGGAGCCGGGAGG - Exonic
1130059521 15:80559491-80559513 TTCTTCTTGCAGAAGCAGGGAGG + Intronic
1131147454 15:90023462-90023484 CACTGCATGGAGCAGCAGGTAGG + Intronic
1132537129 16:487791-487813 CACTCCCTTCAGAAGGAGGGTGG + Intronic
1132858354 16:2057636-2057658 CACTCCATGCAGCACCCGGGTGG + Intronic
1133114292 16:3567415-3567437 CACTGCATAGAGAAGCAGGTTGG + Intronic
1133208105 16:4246298-4246320 GACTTTAAGCACAAGCAGGGAGG - Intergenic
1139128441 16:64110560-64110582 CACTTCATACAGTAACAGGATGG - Intergenic
1142756755 17:2021034-2021056 CACGAGATGGAGAAGCAGGGAGG + Intronic
1144268993 17:13600408-13600430 CACTTCATGCAGAAGGCGAAGGG - Intronic
1144725593 17:17500454-17500476 AACTTCAAGAAGAAGCAGGAGGG - Intergenic
1145206857 17:20989097-20989119 CTCTACATACAGAAGCAGGAGGG + Intergenic
1146455579 17:33006938-33006960 CACTTCCTTCAGAGGCATGGGGG + Intergenic
1146725869 17:35155297-35155319 CACTGCATGCAGAATCACTGTGG - Exonic
1147338087 17:39738938-39738960 CATTTCATGCTGAAGCCAGGAGG - Intronic
1147717464 17:42518038-42518060 CACTTCATGTGGCAGGAGGGAGG - Intronic
1147865942 17:43552370-43552392 CGCTTCATCTAGAAGCAGAGAGG - Intronic
1148152500 17:45404919-45404941 CACTTCACTCAGGAGCAGGTAGG - Exonic
1148909994 17:50936828-50936850 AACTGCATGCAGGAGGAGGGAGG - Intergenic
1151851766 17:76694840-76694862 CACCACAGCCAGAAGCAGGGAGG - Intronic
1151912845 17:77095429-77095451 CACTTCATGCAGAGACAAGGTGG - Intronic
1158265611 18:55657856-55657878 CAGTTTATGCAAAAGCAGGAGGG + Intronic
1161349304 19:3783506-3783528 CCCTTAATGCAGAAATAGGGGGG - Intronic
1161379144 19:3955511-3955533 GACATCATGCTGAAGTAGGGTGG - Intergenic
1162126038 19:8499956-8499978 CACTAAATGGAGAAGTAGGGAGG - Intronic
1162182378 19:8879114-8879136 CAATTCTTGCAGAAGTAAGGTGG - Intronic
1163321188 19:16575978-16576000 CCCATCTTGCAGAAGCCGGGTGG - Exonic
1164679115 19:30122157-30122179 CACTTCACACAGATGGAGGGAGG + Intergenic
1164918194 19:32068641-32068663 CCCTTCTTGGAGGAGCAGGGGGG + Intergenic
1165601451 19:37058417-37058439 CAGTCCATCCAGAAGCAGAGGGG - Intronic
1165875888 19:39006637-39006659 CAATTCATACAGAAACAAGGAGG - Intronic
1165929843 19:39350353-39350375 CTCTTCATTCAGAAGCAGGATGG - Intronic
1167858843 19:52266760-52266782 AGCTTTATTCAGAAGCAGGGGGG - Intergenic
1168152450 19:54456304-54456326 CACTGCAGGAAGAAGCAGGAGGG - Exonic
926459419 2:13110355-13110377 TACTTCATGCAGCAGGTGGGTGG - Intergenic
928290880 2:30036373-30036395 CTTTTCATGAAGAAGTAGGGAGG - Intergenic
931607561 2:64067248-64067270 GACTTAATGCAGAAGCATGCAGG - Intergenic
936527461 2:113251293-113251315 CTCTTCATGCAGCTGCAGGTGGG + Intronic
938402218 2:131003306-131003328 CACTTCATACAGAAACAGTGTGG - Intronic
940003443 2:148989674-148989696 CCATTCTTGCAGAAGCAAGGTGG + Intronic
940121677 2:150274848-150274870 CACTTCATGGAGAAGCTCTGTGG - Intergenic
942074908 2:172348669-172348691 GACTTTATGCAGAAAGAGGGCGG - Intergenic
944293299 2:198033046-198033068 AACTTCATTCAGAAGCTGAGAGG - Intronic
944480538 2:200153075-200153097 GACTTCATGGGGAAGAAGGGAGG + Intergenic
946306074 2:218857736-218857758 CTCCTCAGGCAGAGGCAGGGCGG + Intergenic
946510398 2:220349633-220349655 CTCTGCATTCAGGAGCAGGGAGG + Intergenic
946790299 2:223293918-223293940 GACTGCAAGCAGAAGCAGGGTGG - Intergenic
948894246 2:240920972-240920994 CATGCCATGCAGAACCAGGGGGG - Intronic
1170091186 20:12591244-12591266 CAGCTCATGCAGAAGCCAGGTGG - Intergenic
1172617389 20:36298292-36298314 CACTAGATGCTGAAGCAGGCAGG + Intergenic
1176095663 20:63343291-63343313 CATTGCCTGCAGAAGCCGGGCGG + Intronic
1177553797 21:22662315-22662337 CACATGATGCAGAAGCAGAAGGG + Intergenic
1177826641 21:26091701-26091723 CACTTCAAGCTGAGGTAGGGGGG + Intronic
1180786313 22:18549697-18549719 CACCTCATGAGGAAGAAGGGAGG - Intergenic
1181131594 22:20735423-20735445 CACCTCATGAGGAAGAAGGGAGG - Intronic
1181243234 22:21489250-21489272 CACCTCATGAGGAAGAAGGGAGG - Intergenic
1182031415 22:27162208-27162230 CACTTCATGCACAAGCTGGGAGG + Intergenic
1182171746 22:28237053-28237075 CACTTGATCCAGAAGAAGGCAGG - Intronic
1182895948 22:33859446-33859468 CACTTCTTCCAGAAGCCTGGTGG - Intronic
1183075732 22:35425754-35425776 CACTCCATGAACAAGCAGGACGG - Intergenic
1183983407 22:41555724-41555746 CACTGCAGGCAGAAGAATGGGGG - Intergenic
1185067772 22:48640601-48640623 CATTTCTTGCAGAGGCTGGGCGG + Intronic
1185309687 22:50147196-50147218 CACTCTGTGCAGAAGCAGGGAGG + Intronic
1185309694 22:50147244-50147266 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
1185309701 22:50147292-50147314 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
1185309708 22:50147340-50147362 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
1185309715 22:50147388-50147410 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
1185309722 22:50147436-50147458 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
1185309729 22:50147484-50147506 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
1185309736 22:50147532-50147554 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
1185309743 22:50147580-50147602 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
949283527 3:2374337-2374359 AACTGCATGAAGAAGCATGGAGG - Intronic
949371172 3:3336201-3336223 CACTTCATTCATAATCAGAGTGG + Intergenic
949499636 3:4667398-4667420 GGCTTCATGCAGAAGCAGATTGG + Exonic
950896862 3:16460568-16460590 CATTTCAAGCAGAGGCTGGGTGG + Intronic
951246683 3:20349575-20349597 CAATACATGCAGAAGCTGGATGG + Intergenic
952751414 3:36827824-36827846 CACTTGATGCTGCAGCAGTGTGG + Exonic
953494450 3:43374050-43374072 CACTCCATGCTGAAGCCTGGGGG - Intronic
956800534 3:72753927-72753949 CCCTTCATGGAGAAACAGAGTGG - Intronic
957776415 3:84760854-84760876 CAGGGCAAGCAGAAGCAGGGTGG + Intergenic
959144938 3:102533183-102533205 GACTACATGGAGAAGGAGGGAGG - Intergenic
961012749 3:123447407-123447429 CAGTTCCTGCTGAAGCAGGTAGG - Exonic
961633426 3:128317986-128318008 CACTCCAGGCAGAGGCAGGATGG + Intronic
962363129 3:134758059-134758081 CAGTTCTATCAGAAGCAGGGTGG - Intronic
963538012 3:146552384-146552406 CACTTAATGGAGAAGGAGGCTGG + Intergenic
963922464 3:150919000-150919022 CATCTCAGGCAGAAGCAAGGCGG + Intronic
964242609 3:154614736-154614758 CACTTCTTGCAGAAACTGGAGGG + Intergenic
968702250 4:2062623-2062645 CCCTTCAAGGAGAAGCAGCGTGG - Intronic
969208693 4:5669637-5669659 CACTTCATGAAGCAGGAGGGAGG - Intronic
969699575 4:8760798-8760820 CACCACAGGGAGAAGCAGGGAGG - Intergenic
971971482 4:33626177-33626199 CACTTTTTGCAAAAGCAGTGAGG + Intergenic
972279496 4:37588444-37588466 CACTGCACGCAGCAGCAGGAGGG - Intronic
976226956 4:82801620-82801642 TAATTCACACAGAAGCAGGGAGG + Intergenic
976383012 4:84421644-84421666 CTCTTCAGACAGAAGGAGGGAGG - Intergenic
976387663 4:84480185-84480207 ACCTTCCTGCAGAGGCAGGGAGG + Intergenic
978941948 4:114447600-114447622 CACTTGTGGCAGAAGCTGGGGGG + Intergenic
979912695 4:126389472-126389494 CACTTCATGTAGAACGAGGGAGG - Intergenic
981085510 4:140679133-140679155 CACATCAGGCAGAAGCAGGGTGG + Exonic
983244732 4:165274975-165274997 CACGCCTTGGAGAAGCAGGGTGG - Intronic
984256273 4:177393333-177393355 AGCTTCATGCAGAAGGAAGGCGG + Intergenic
986253214 5:6080147-6080169 CACTCCAGGCAGAAGGAGGTGGG + Intergenic
986442744 5:7796156-7796178 TACTTCATGCATAAACAGGATGG + Intronic
986496697 5:8349331-8349353 CATCCCATGGAGAAGCAGGGAGG - Intergenic
986512017 5:8517428-8517450 CAGAGCAAGCAGAAGCAGGGTGG - Intergenic
986818034 5:11434159-11434181 CAATACATGCAGCAGCATGGAGG + Intronic
988135472 5:27165321-27165343 CACTCCATGAAGATGCAGGCAGG - Intergenic
989748938 5:44867768-44867790 CACCTCATGGAGTTGCAGGGAGG - Intergenic
992454303 5:76902120-76902142 CTCTTCAAGCAGAAGGAAGGGGG + Intronic
992838520 5:80664388-80664410 CCCTCCAGGCAGAAGCTGGGAGG - Intronic
994013801 5:94941292-94941314 CACTTCCTACAGCGGCAGGGAGG + Intronic
995285998 5:110388794-110388816 CAGTACATGCAGAATCGGGGTGG + Intronic
999207939 5:149863463-149863485 CACTTCATGCTGAAGGACAGGGG - Intronic
999466537 5:151811672-151811694 GACTTCATGCAAAAAAAGGGGGG + Exonic
1000176235 5:158757329-158757351 GACTTGATGCAGTAGAAGGGAGG - Intronic
1000620375 5:163478728-163478750 CTTTTCCTGCAAAAGCAGGGTGG - Exonic
1001126558 5:169024711-169024733 CACATCCTCCAGAAGCGGGGTGG + Intronic
1001859984 5:175045763-175045785 CACTTCATGCAACACCCGGGAGG + Intergenic
1002875015 6:1202798-1202820 CACTAAATGCAGAGGCACGGAGG - Intergenic
1003051695 6:2786409-2786431 CACTCCAGACAGAAGGAGGGAGG - Intronic
1003083167 6:3038464-3038486 CACACCATGCAGTAGCTGGGAGG + Intergenic
1004007801 6:11652833-11652855 CACATCATGCAGGAGGAGGATGG + Intergenic
1007060432 6:38935236-38935258 CATTTCTTACAGAAGCAGTGTGG + Intronic
1009335972 6:62491866-62491888 GAGTGCAAGCAGAAGCAGGGTGG + Intergenic
1012490730 6:99780181-99780203 CACTGGAAGCAGAGGCAGGGTGG + Intergenic
1013178750 6:107700386-107700408 CTCTACCTGCAGGAGCAGGGCGG + Intergenic
1014692189 6:124575540-124575562 CACTTCATGCAGAAGCAGGGTGG - Intronic
1017578051 6:155828354-155828376 GACTACATGCAGAAGCATGGAGG + Intergenic
1018853591 6:167659155-167659177 CACTGCAGCCAGAAGAAGGGAGG - Intergenic
1018949377 6:168369232-168369254 CAGTACATACAGAAGGAGGGAGG - Intergenic
1020619176 7:10497212-10497234 CACCTCATACAGAAGCATTGGGG + Intergenic
1020979252 7:15047025-15047047 CACTCCCTGGAGAAGGAGGGAGG + Intergenic
1022522955 7:31019688-31019710 AACTTCATGAACAAGGAGGGAGG + Intergenic
1022613247 7:31899017-31899039 CGCTTCAGACAGAGGCAGGGAGG - Intronic
1023601426 7:41885248-41885270 CAGCTCCTGGAGAAGCAGGGAGG + Intergenic
1025094735 7:56088289-56088311 CACTTCCTGCAATACCAGGGAGG - Intronic
1028488646 7:91386901-91386923 CACCTCATGGAGAAGTAGAGGGG + Intergenic
1028502303 7:91532927-91532949 CCATTCTTGCAGAAGCAAGGTGG - Intergenic
1029315631 7:99710700-99710722 CAGTACATGGAGAAGGAGGGAGG - Intronic
1029860326 7:103564541-103564563 CACTTGAGGCAGAAAGAGGGGGG + Intronic
1030781053 7:113600590-113600612 GAGTGCAAGCAGAAGCAGGGTGG + Intergenic
1032189761 7:129757884-129757906 CAGGGCATGCAGAAGCATGGAGG - Intergenic
1035453439 7:158993978-158994000 GACTGCAGGCAGGAGCAGGGTGG - Intergenic
1036045262 8:5132919-5132941 AATTTCCTACAGAAGCAGGGAGG - Intergenic
1039365434 8:36923499-36923521 CACAGCATTCAGAAGCAGTGAGG + Intronic
1042377827 8:68075971-68075993 GACTTCAGGCAACAGCAGGGAGG + Intronic
1044865926 8:96571293-96571315 CATTTCAGGCAGAGGCAGAGCGG + Intronic
1045533411 8:103005075-103005097 TATATCATCCAGAAGCAGGGAGG - Intergenic
1049427775 8:142544932-142544954 CCCTCCAGGAAGAAGCAGGGGGG + Exonic
1050519683 9:6484452-6484474 CACTGCATCCAGGAGGAGGGGGG - Intronic
1051354704 9:16231044-16231066 CGCTTTTTGCACAAGCAGGGAGG - Intronic
1052806793 9:33020336-33020358 GACTTGATGCAGAGGTAGGGAGG - Intronic
1054822722 9:69539700-69539722 CATTTCATGGAGTAGCAAGGAGG - Intronic
1054875925 9:70096430-70096452 CACTTCAGACAGAAAGAGGGAGG + Intronic
1054922351 9:70554991-70555013 GACTTCATGCTGAAGCCAGGGGG - Intronic
1055401173 9:75925681-75925703 CATTTCAGGCAGAAGGAAGGAGG + Intronic
1055775811 9:79766039-79766061 CACTTCATGGAGATGCTGTGAGG - Intergenic
1057270453 9:93647381-93647403 CTGTCCCTGCAGAAGCAGGGAGG + Intronic
1059552296 9:115241359-115241381 CACTTGAACCTGAAGCAGGGCGG + Intronic
1060773454 9:126349373-126349395 GAGGTCTTGCAGAAGCAGGGAGG - Intronic
1062231932 9:135486698-135486720 CACTTCTTGGAGCAGCTGGGCGG + Exonic
1185721340 X:2384295-2384317 CACTTGCTGTGGAAGCAGGGAGG + Intronic
1187795268 X:22996961-22996983 CAATTCATGGAGAAGTATGGAGG + Intergenic
1192052113 X:67733772-67733794 AACATCATGAAGAGGCAGGGGGG + Intergenic
1195398057 X:104432498-104432520 CACTACATGCGGAAGAAGGAAGG + Intergenic
1195571464 X:106402371-106402393 CACTTCTTGCTGCAGCTGGGTGG + Intergenic
1198783510 X:140261635-140261657 CACTTCATTTAGAAATAGGGTGG + Intergenic