ID: 1014700890

View in Genome Browser
Species Human (GRCh38)
Location 6:124686506-124686528
Sequence CTATAACAAGAACAGCACTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2992
Summary {0: 1, 1: 13, 2: 100, 3: 621, 4: 2257}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014700886_1014700890 -6 Left 1014700886 6:124686489-124686511 CCAGATCTCATAGAACCCTATAA 0: 1
1: 0
2: 0
3: 15
4: 118
Right 1014700890 6:124686506-124686528 CTATAACAAGAACAGCACTAGGG 0: 1
1: 13
2: 100
3: 621
4: 2257
1014700885_1014700890 5 Left 1014700885 6:124686478-124686500 CCTTTAAACAACCAGATCTCATA 0: 5
1: 42
2: 134
3: 242
4: 457
Right 1014700890 6:124686506-124686528 CTATAACAAGAACAGCACTAGGG 0: 1
1: 13
2: 100
3: 621
4: 2257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014700890 Original CRISPR CTATAACAAGAACAGCACTA GGG Intronic
Too many off-targets to display for this crispr